Management of stage Ⅳ rectal cancer - World Journal of ...

<strong>World</strong> <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 817-952<br />

www.wjgnet.com<br />

ISSN 1007-9327 (print)<br />

ISSN 2219-2840 (online)

---

Editorial Board<br />

2010-2013<br />

The <strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology Editorial Board consists <strong>of</strong> 1144 members, representing a team <strong>of</strong> worldwide<br />

experts in gastroenterology and hepatology. They are from 60 countries, including Albania (1), Argentina (8),<br />

Australia (29), Austria (14), Belgium (12), Brazil (10), Brunei Darussalam (1), Bulgaria (2), Canada (20), Chile (3),<br />

China (69), Colombia (1), Croatia (2), Cuba (1), Czech (4), Denmark (8), Ecuador (1), Egypt (2), Estonia (2), Finland<br />

(8), France (24), Germany (75), Greece (14), Hungary (10), India (26), Iran (6), Ireland (7), Israel (12), Italy (101),<br />

Japan (112), Jordan (1), Kuwait (1), Lebanon (3), Lithuania (2), Malaysia (1), Mexico (10), Moldova (1), Netherlands<br />

(29), New Zealand (2), Norway (11), Pakistan (2), Poland (11), Portugal (4), Romania (3), Russia (1), Saudi Arabia<br />

(3), Serbia (3), Singapore (10), South Africa (2), South Korea (32), Spain (38), Sweden (18), Switzerland (11),<br />

Thailand (1), Trinidad and Tobago (1), Turkey (24), United Arab Emirates (2), United Kingdom (82), United States<br />

(249), and Uruguay (1).<br />

HONORARY EDITORS-IN-CHIEF<br />

James L Boyer, New Haven<br />

Ke-Ji Chen, Beijing<br />

Martin H Floch, New Haven<br />

Emmet B Keeffe, Palo Alto<br />

Geng-Tao Liu, Beijing<br />

Lein-Ray Mo, Tainan<br />

Eamonn M Quigley, Cork<br />

Rafiq A Sheikh, Sacramento<br />

Nicholas J Talley, Rochester<br />

Ming-Lung Yu, Kaohsiung<br />

PRESIDENT AND EDITOR-IN-<br />

CHIEF<br />

Lian-Sheng Ma, Beijing<br />

ACADEMIC EDITOR-IN-CHIEF<br />

Tauseef Ali, Oklahoma City<br />

Mauro Bortolotti, Bologna<br />

Tarkan Karakan, Ankara<br />

Weekitt Kittisupamongkol, Bangkok<br />

Anastasios Koulaouzidis, Edinburgh<br />

Bo-Rong Pan, Xi’an<br />

Sylvia LF Pender, Southampton<br />

Max S Petrov, Auckland<br />

George Y Wu, Farmington<br />

STRATEGY ASSOCIATE<br />

EDITORS-IN-CHIEF<br />

Peter Draganov, Florida<br />

Hugh J Freeman, Vancouver<br />

Maria C Gutiérrez-Ruiz, Mexico<br />

Kazuhiro Hanazaki, Kochi<br />

Akio Inui, Kagoshima<br />

Kalpesh Jani, Baroda<br />

Javier S Martin, Punta del Este<br />

WJG|www.wjgnet.com<br />

Natalia A Osna, Omaha<br />

Wei Tang, Tokyo<br />

Alan BR Thomson, Edmonton<br />

Harry HX Xia, Hanover<br />

Jesus K Yamamoto-Furusho, Mexico<br />

Yoshio Yamaoka, Houston<br />

ASSOCIATE EDITORS-IN-CHIEF<br />

You-Yong Lu, Beijing<br />

John M Luk, Singapore<br />

Hiroshi Shimada, Yokohama<br />

GUEST EDITORIAL BOARD<br />

MEMBERS<br />

Chien-Jen Chen, Taipei<br />

Yang-Yuan Chen, Changhua<br />

Jen-Hwey Chiu, Taipei<br />

Seng-Kee Chuah, Kaohsiung<br />

Wan-Long Chuang, Kaohsiun<br />

Ming-Chih Hou, Taipei<br />

Kevin Cheng-Wen Hsiao, Taipei<br />

Po-Shiuan Hsieh, Taipei<br />

Tsung-Hui Hu, Kaohsiung<br />

Wen-Hsin Huang, Taichung<br />

Chao-Hung Hung, Kaohsiung<br />

I-Rue Lai, Taipei<br />

Teng-Yu Lee, Taichung<br />

Ching Chung Lin, Taipei<br />

Hui-Kang Liu, Taipei<br />

Hon-Yi Shi, Kaohsiung<br />

Chih-Chi Wang, Kaohsiung<br />

Jin-Town Wang, Taipei<br />

Cheng-Shyong Wu, Chia-Yi<br />

Jaw-Ching Wu, Taipei<br />

Jiunn-Jong Wu, Tainan<br />

Ming-Shiang Wu, Taipei<br />

I<br />

Ta-Sen Yeh, Taoyuan<br />

Hsu-Heng Yen, Changhua<br />

Ming-Whei Yu, Taipei<br />

MEMBERS OF THE EDITORIAL<br />

BOARD<br />

Albania<br />

Bashkim Resuli, Tirana<br />

Argentina<br />

Julio H Carri, Córdoba<br />

Eduardo de Santibañes, Buenos Aires<br />

Bernardo Frider, Buenos Aires<br />

Carlos J Pirola, Buenos Aires<br />

Bernabe Matias Quesada, Buenos Aires<br />

Silvia Sookoian, Buenos Aires<br />

Adriana M Torres, Rosario<br />

Maria Ines Vaccaro, Buenos Aires<br />

Australia<br />

Leon Anton Adams, Nedlands<br />

Richard Anderson, Victoria<br />

Minoti V Apte, New South Wales<br />

Andrew V Biankin, Sydney<br />

Filip Braet, Sydney<br />

Christopher Christophi, Melbourne<br />

Philip G Dinning, Koagarah<br />

Guy D Eslick, Sydney<br />

Michael A Fink, Melbourne<br />

January 7, 2011

---

Robert JL Fraser, Daw Park<br />

Jacob George, Westmead<br />

Mark D Gorrell, Sydney<br />

Alexander G Heriot, Melbourne<br />

Michael Horowitz, Adelaide<br />

John E Kellow, Sydney<br />

William Kemp, Melbourne<br />

Finlay A Macrae, Victoria<br />

Daniel Markovich, Brisbane<br />

Vance Matthews, Melbourne<br />

Phillip S Oates, Perth<br />

Shan Rajendra, Tasmania<br />

Rajvinder Singh, Elizabeth Vale<br />

Ross C Smith, Sydney<br />

Kevin J Spring, Brisbane<br />

Nathan Subramaniam, Brisbane<br />

Phil Sutton, Melbourne<br />

Cuong D Tran, North Adelaide<br />

Debbie Trinder, Fremantle<br />

David Ian Watson, Bedford Park<br />

Austria<br />

Herwig R Cerwenka, Graz<br />

Ashraf Dahaba, Graz<br />

Peter Ferenci, Vienna<br />

Valentin Fuhrmann, Vienna<br />

Alfred Gangl, Vienna<br />

Alexander M Hirschl, Wien<br />

Kurt Lenz, Linz<br />

Dietmar Öfner, Salzburg<br />

Markus Peck-Radosavljevic, Vienna<br />

Markus Raderer, Vienna<br />

Stefan Riss, Vienna<br />

Georg Roth, Vienna<br />

Michael Trauner, Graz<br />

Thomas Wild, Kapellerfeld<br />

Belgium<br />

Rudi Beyaert, Gent<br />

Benedicte Y De Winter, Antwerp<br />

Inge I Depoortere, Leuven<br />

Olivier Detry, Liège<br />

Philip Meuleman, Ghent<br />

Marc Peeters, De Pintelaan<br />

Freddy Penninckx, Leuven<br />

Jean-Yves L Reginster, Liège<br />

Mark De Ridder, Brussels<br />

Etienne M Sokal, Brussels<br />

Kristin Verbeke, Leuven<br />

Eddie Wisse, Keerbergen<br />

Brazil<br />

José LF Caboclo, São José do Rio Preto<br />

Roberto J Carvalho-Filho, São Paulo<br />

Jaime Natan Eisig, São Paulo<br />

Andre Castro Lyra, Salvador<br />

Marcelo Lima Ribeiro, Braganca Paulista<br />

Joao Batista Teixeira Rocha, Santa Maria<br />

Heitor Rosa, Goiania<br />

Damiao C Moraes Santos, Rio de Janeiro<br />

Ana Cristina Simões e Silva, Belo Horizonte<br />

Eduardo Garcia Vilela, Belo Horizonte<br />

WJG|www.wjgnet.com<br />

Brunei Darussalam<br />

Vui Heng Chong, Bandar Seri Begawan<br />

Bulgaria<br />

Zahariy Krastev, S<strong>of</strong>ia<br />

Mihaela Petrova, S<strong>of</strong>ia<br />

Canada<br />

Alain Bitton, Montreal<br />

Michael F Byrne, Vancouver<br />

Kris Chadee, Calgary<br />

Wangxue Chen, Ottawa<br />

Ram Prakash Galwa, Ottawa<br />

Philip H Gordon, Montreal<br />

Waliul Khan, Ontario<br />

Qiang Liu, Saskatoon<br />

John K Marshall, Ontario<br />

Andrew L Mason, Alberta<br />

Kostas Pantopoulos, Quebec<br />

Nathalie Perreault, Sherbrooke<br />

Baljinder Singh Salh, Vancouver<br />

Eldon Shaffer, Calgary<br />

Martin Storr, Calgary<br />

Pingchang Yang, Hamilton<br />

Eric M Yoshida, Vancouver<br />

Claudia Zwingmann, Montreal<br />

Chile<br />

Marcelo A Beltran, La Serena<br />

Xabier De Aretxabala, Santiago<br />

Silvana Zanlungo, Santiago<br />

China<br />

Hui-Jie Bian, Xi’an<br />

San-Jun Cai, Shanghai<br />

Guang-Wen Cao, Shanghai<br />

Xiao-Ping Chen, Wuhan<br />

Chi-Hin Cho, Hong Kong<br />

Zong-Jie Cui, Beijing<br />

Jing-Yuan Fang, Shanghai<br />

De-Liang Fu, Shanghai<br />

Ze-Guang Han, Shanghai<br />

Chun-Yi Hao, Beijing<br />

Ming-Liang He, Hong Kong<br />

Ching-Lung Lai, Hong Kong<br />

Simon Law, Hong Kong<br />

Yuk-Tong Lee, Hong Kong<br />

En-Min Li, Shantou<br />

Fei Li, Beijing<br />

Yu-Yuan Li, Guangzhou<br />

Zhao-Shen Li, Shanghai<br />

Xing-Hua Lu, Beijing<br />

Yi-Min Mao, Shanghai<br />

Qin Su, Beijing<br />

Paul Kwong-Hang Tam, Hong Kong<br />

Yuk Him Tam, Hong Kong<br />

Ren-Xiang Tan, Nanjing<br />

Wei-Dong Tong, Chongqing<br />

Eric WC Tse, Hong Kong<br />

II<br />

Fu-Sheng Wang, Beijing<br />

Xiang-Dong Wang, Shanghai<br />

Nathalie Wong, Hong Kong<br />

Justin CY Wu, Hong Kong<br />

Wen-Rong Xu, Zhenjiang<br />

An-Gang Yang, Xi’an<br />

Wei-Cheng You, Beijing<br />

Chun-Qing Zhang, Jinan<br />

Jian-Zhong Zhang, Beijing<br />

Xiao-Peng Zhang, Beijing<br />

Xuan Zhang, Beijing<br />

Colombia<br />

Germán Campuzano-Maya, Medellín<br />

Croatia<br />

Tamara Cacev, Zagreb<br />

Marko Duvnjak, Zagreb<br />

Cuba<br />

Damian C Rodriguez, Havana<br />

Czech<br />

Jan Bures, Hradec Kralove<br />

Milan Jirsa, Praha<br />

Marcela Kopacova, Hradec Kralove<br />

Pavel Trunečka, Prague<br />

Denmark<br />

Leif Percival Andersen, Copenhagen<br />

Asbjørn M Drewes, Aalborg<br />

Morten Frisch, Copenhagen<br />

Jan Mollenhauer, Odense<br />

Morten Hylander Møller, Holte<br />

Søren Rafaelsen, Vejle<br />

Jorgen Rask-Madsen, Skodsborg<br />

Peer Wille-Jørgensen, Copenhagen<br />

Ecuador<br />

Fernando E Sempértegui, Quito<br />

Egypt<br />

Zeinab Nabil Ahmed, Cairo<br />

Hussein M Atta, El-Minia<br />

Estonia<br />

Riina Salupere, Tartu<br />

Tamara Vorobjova, Tartu<br />

Finland<br />

Saila Kauhanen, Turku<br />

January 7, 2011

---

Thomas Kietzmann, Oulu<br />

Kaija-Leena Kolho, Helsinki<br />

Jukka-Pekka Mecklin, Jyvaskyla<br />

Minna Nyström, Helsinki<br />

Pauli Antero Puolakkainen, Turku<br />

Juhani Sand, Tampere<br />

Lea Veijola, Helsinki<br />

France<br />

Claire Bonithon-Kopp, Dijon<br />

Lionel Bueno, Toulouse<br />

Sabine Colnot, Paris<br />

Catherine Daniel, Lille Cedex<br />

Alexis Desmoulière, Limoges<br />

Thabut Dominique, Paris<br />

Francoise L Fabiani, Angers<br />

Jean-Luc Faucheron, Grenoble<br />

Jean Paul Galmiche, Nantes cedex<br />

Boris Guiu, Dijon<br />

Paul H<strong>of</strong>man, Nice<br />

Laurent Huwart, Paris<br />

Juan Iovanna, Marseille<br />

Abdel-Majid Khatib, Paris<br />

Philippe Lehours, Bordeaux<br />

Flavio Maina, Marseille<br />

Patrick Marcellin, Paris<br />

Rene Gerolami Santandera, Marseille<br />

Annie Schmid-Alliana, Nice cedex<br />

Alain L Servin, Châtenay-Malabry<br />

Stephane Supiot, Nantes<br />

Baumert F Thomas, Strasbourg<br />

Jean-Jacques Tuech, Rouen<br />

Frank Zerbib, Bordeaux Cedex<br />

Germany<br />

Erwin Biecker, Siegburg<br />

Hubert Blum, Freiburg<br />

Thomas Bock, Tuebingen<br />

Dean Bogoevski, Hamburg<br />

Elfriede Bollschweiler, Köln<br />

Jürgen Borlak, Hannover<br />

Christa Buechler, Regensburg<br />

Jürgen Büning, Lübeck<br />

Elke Cario, Essen<br />

Bruno Christ, Halle/Saale<br />

Christoph F Dietrich, Bad Mergentheim<br />

Ulrich R Fölsch, Kiel<br />

Nikolaus Gassler, Aachen<br />

Markus Gerhard, Munich<br />

Dieter Glebe, Giessen<br />

Ralph Graeser, Freiburg<br />

Axel M Gressner, Aachen<br />

Nils Habbe, Marburg<br />

Thilo Hackert, Heidelberg<br />

Wolfgang Hagmann, Heidelberg<br />

Dirk Haller, Freising<br />

Philip D Hard, Giessen<br />

Claus Hellerbrand, Regensburg<br />

Klaus R Herrlinger, Stuttgart<br />

Eberhard Hildt, Berlin<br />

Andrea Hille, Goettingen<br />

Joerg C H<strong>of</strong>fmann, Berlin<br />

Philipe N Khalil, Munich<br />

Andrej Khandoga, Munich<br />

Jorg Kleeff, Munich<br />

Ingmar Königsrainer, Tübingen<br />

Peter Konturek, Erlangen<br />

WJG|www.wjgnet.com<br />

Stefan Kubicka, Hannover<br />

Joachim Labenz, Siegen<br />

Michael Linnebacher, Rostock<br />

Jutta Elisabeth Lüttges, Riegelsberg<br />

Peter Malfertheiner, Magdeburg<br />

Oliver Mann, Hamburg<br />

Peter N Meier, Hannover<br />

Sabine Mihm, Göttingen<br />

Klaus Mönkemüller, Bottrop<br />

Jonas Mudter, Erlangen<br />

Sebastian Mueller, Heidelberg<br />

Robert Obermaier, Freiburg<br />

Matthias Ocker, Erlangen<br />

Stephan Johannes Ott, Kiel<br />

Gustav Paumgartner, Munich<br />

Christoph Reichel, Bad Brückenau<br />

Markus Reiser, Bochum<br />

Steffen Rickes, Magdeburg<br />

Elke Roeb, Giessen<br />

Christian Rust, Munich<br />

Hans Scherubl, Berlin<br />

Martin K Schilling, Homburg<br />

Joerg F Schlaak, Essen<br />

Rene Schmidt, Freiburg<br />

Andreas G Schreyer, Regensburg<br />

Karsten Schulmann, Bochum<br />

Henning Schulze-Bergkamen, Mainz<br />

Manfred V Singer, Mannheim<br />

Jens Standop, Bonn<br />

Jurgen M Stein, Frankfurt<br />

Ulrike S Stein, Berlin<br />

Wolfgang R Stremmel, Heidelberg<br />

Harald F Teutsch, Ulm<br />

Hans L Tillmann, Leipzig<br />

Christian Trautwein, Aachen<br />

Joerg Trojan, Frankfurt<br />

Arndt Vogel, Hannover<br />

Siegfried Wagner, Deggendorf<br />

Frank Ulrich Weiss, Greifswald<br />

Fritz von Weizsäcker, Berlin<br />

Thomas Wex, Magdeburg<br />

Stefan Wirth, Wuppertal<br />

Marty Zdichavsky, Tübingen<br />

Greece<br />

Helen Christopoulou-Aletra, Thessaloniki<br />

T Choli-Papadopoulou, Thessaloniki<br />

Tsianos Epameinondas, Ioannina<br />

Ioannis Kanellos, Thessaloniki<br />

Elias A Kouroumalis, Heraklion<br />

Ioannis E Koutroubakis, Heraklion<br />

Michael Koutsilieris, Athens<br />

Andreas Larentzakis, Athens<br />

Emanuel K Manesis, Athens<br />

Spilios Manolakopoulos, Athens<br />

Konstantinos Mimidis, Alexandroupolis<br />

George Papatheodoridis, Athens<br />

Spiros Sgouros, Athens<br />

Evangelos Tsiambas, Ag Paraskevi Attiki<br />

Hungary<br />

György M Buzás, Budapest<br />

László Czakó, Szeged<br />

Gyula Farkas, Szeged<br />

Peter Hegyi, Szeged<br />

Peter L Lakatos, Budapest<br />

III<br />

Yvette Mándi, Szeged<br />

Zoltan Rakonczay, Szeged<br />

Ferenc Sipos, Budapest<br />

Zsuzsa Szondy, Debrecen<br />

Gabor Veres, Budapest<br />

India<br />

Philip Abraham, Mumbai<br />

Vineet Ahuja, New Delhi<br />

Giriraj Ratan Chandak, Hyderabad<br />

Devinder Kumar Dhawan, Chandigarh<br />

Radha K Dhiman, Chandigarh<br />

Pankaj Garg, Panchkula<br />

Pramod Kumar Garg, New Delhi<br />

Debidas Ghosh, Midnpore<br />

Uday C Ghoshal, Lucknow<br />

Bhupendra Kumar Jain, Delhi<br />

Ashok Kumar, Lucknow<br />

Bikash Medhi, Chandigarh<br />

Sri P Misra, Allahabad<br />

Gopal Nath, Varanasi<br />

Samiran Nundy, New Delhi<br />

Jagannath Palepu, Mumbai<br />

Vandana Panda, Mumbai<br />

Benjamin Perakath, Tamil Nadu<br />

Ramesh Roop Rai, Jaipur<br />

Nageshwar D Reddy, Hyderabad<br />

Barjesh Chander Sharma, New Delhi<br />

Virendra Singh, Chandigarh<br />

Rupjyoti Talukdar, Guwahati<br />

Rakesh Kumar Tandon, New Delhi<br />

Jai Dev Wig, Chandigarh<br />

Iran<br />

Mohammad Abdollahi, Tehran<br />

Peyman Adibi, Isfahan<br />

Seyed-Moayed Alavian, Tehran<br />

Seyed Mohsen Dehghani, Shiraz<br />

Reza Malekzadeh, Tehran<br />

Alireza Mani, Tehran<br />

Ireland<br />

Billy Bourke, Dublin<br />

Ted Dinan, Cork<br />

Catherine Greene, Dublin<br />

Ross McManus, Dublin<br />

Anthony P Moran, Galway<br />

Marion Rowland, Dublin<br />

Israel<br />

Simon Bar-Meir, Hashomer<br />

Alexander Becker, Afula<br />

Abraham R Eliakim, Haifa<br />

Sigal Fishman, Tel Aviv<br />

Boris Kirshtein, Beer Sheva<br />

Eli Magen, Ashdod<br />

Menachem Moshkowitz, Tel-Aviv<br />

Assy Nimer, Safed<br />

Shmuel Odes, Beer Sheva<br />

Mark Pines, Bet Dagan<br />

Ron Shaoul, Haifa<br />

Ami D Sperber, Beer-Sheva<br />

January 7, 2011

---

Italy<br />

Donato F Altomare, Bari<br />

Piero Amodio, Padova<br />

Angelo Andriulli, San Giovanni Rotondo<br />

Paolo Angeli, Padova<br />

Bruno Annibale, Rome<br />

Paolo Aurello, Rome<br />

Salvatore Auricchio, Naples<br />

Antonio Basoli, Rome<br />

Claudio Bassi, Verona<br />

Gabrio Bassotti, Perugia<br />

Mauro Bernardi, Bologna<br />

Alberto Biondi, Rome<br />

Luigi Bonavina, Milano<br />

Guglielmo Borgia, Naples<br />

Roberto Berni Canani, Naples<br />

Maria Gabriella Caruso, Bari<br />

Fausto Catena, Bologna<br />

Giuseppe Chiarioni, Valeggio<br />

Michele Cicala, Rome<br />

Dario Conte, Milano<br />

Francesco Costa, Pisa<br />

Antonio Craxì, Palermo<br />

Salvatore Cucchiara, Rome<br />

Giuseppe Currò, Messina<br />

Mario M D’Elios, Florence<br />

Mirko D’On<strong>of</strong>rio, Verona<br />

Silvio Danese, Milano<br />

Roberto de Franchis, Milano<br />

Paola De Nardi, Milan<br />

Giovanni D De Palma, Naples<br />

Giuliana Decorti, Trieste<br />

Gianlorenzo Dionigi, Varese<br />

Massimo Falconi, Verona<br />

Silvia Fargion, Milan<br />

Giammarco Fava, Ancona<br />

Francesco Feo, Sassari<br />

Alessandra Ferlini, Ferrara<br />

Alessandro Ferrero, Torino<br />

Mirella Fraquelli, Milan<br />

Luca Frulloni, Verona<br />

Giovanni B Gaeta, Napoli<br />

Antonio Gasbarrini, Rome<br />

Edoardo G Giannini, Genoa<br />

Alessandro Granito, Bologna<br />

Fabio Grizzi, Milan<br />

Salvatore Gruttadauria, Palermo<br />

Pietro Invernizzi, Milan<br />

Achille Iolascon, Naples<br />

Angelo A Izzo, Naples<br />

Ezio Laconi, Cagliari<br />

Giovanni Latella, L’Aquila<br />

Massimo Levrero, Rome<br />

Francesco Luzza, Catanzaro<br />

Lucia Malaguarnera, Catania<br />

Francesco Manguso, Napoli<br />

Pier Mannuccio Mannucci, Milan<br />

Giancarlo Mansueto, Verona<br />

Giulio Marchesini, Bologna<br />

Mara Massimi, Coppito<br />

Giovanni Milito, Rome<br />

Giuseppe Montalto, Palermo<br />

Giovanni Monteleone, Rome<br />

Luca Morelli, Trento<br />

Giovanni Musso, Torino<br />

Mario Nano, Torino<br />

Gerardo Nardone, Napoli<br />

Riccardo Nascimbeni, Brescia<br />

Valerio Nobili, Rome<br />

Fabio Pace, Milan<br />

Nadia Peparini, Rome<br />

WJG|www.wjgnet.com<br />

Marcello Persico, Naples<br />

Mario Pescatori, Rome<br />

Raffaele Pezzilli, Bologna<br />

Alberto Piperno, Monza<br />

Anna C Piscaglia, Rome<br />

Piero Portincasa, Bari<br />

Michele Reni, Milan<br />

Vittorio Ricci, Pavia<br />

Oliviero Riggio, Rome<br />

Mario Rizzetto, Torino<br />

Ballarin Roberto, Modena<br />

Gerardo Rosati, Potenza<br />

Franco Roviello, Siena<br />

Cesare Ruffolo, Treviso<br />

Massimo Rugge, Padova<br />

Marco Scarpa, Padova<br />

C armelo Scarpignato, Parma<br />

Giuseppe Sica, Rome<br />

Marco Silano, Rome<br />

Pierpaolo Sileri, Rome<br />

Vincenzo Stanghellini, Bologna<br />

Fiorucci Stefano, Perugia<br />

Giovanni Tarantino, Naples<br />

Alberto Tommasini, Trieste<br />

Guido Torzilli, Rozzano Milan<br />

Cesare Tosetti, Porretta Terme<br />

Antonello Trecca, Rome<br />

Vincenzo Villanacci, Brescia<br />

Lucia Ricci Vitiani, Rome<br />

Marco Vivarelli, Bologna<br />

Japan<br />

Kyoichi Adachi, Izumo<br />

Yasushi Adachi, Sapporo<br />

Takafumi Ando, Nagoya<br />

Akira Andoh, Otsu<br />

Masahiro Arai, Tokyo<br />

Hitoshi Asakura, Tokyo<br />

Kazuo Chijiiwa, Miyazaki<br />

Yuichiro Eguchi, Saga<br />

Itaru Endo, Yokohama<br />

Munechika Enjoji, Fukuoka<br />

Yasuhiro Fujino, Akashi<br />

Mitsuhiro Fujishiro, Tokyo<br />

Kouhei Fukushima, Sendai<br />

Masanori Hatakeyama, Tokyo<br />

Keiji Hirata, Kitakyushu<br />

Toru Hiyama, Higashihiroshima<br />

Masahiro Iizuka, Akita<br />

Susumu Ikehara, Osaka<br />

Kenichi Ikejima, Bunkyo-ku<br />

Yutaka Inagaki, Kanagawa<br />

Hiromi Ishibashi, Nagasaki<br />

Shunji Ishihara, Izumo<br />

Toru Ishikawa, Niigata<br />

Toshiyuki Ishiwata, Tokyo<br />

Hajime Isomoto, Nagasaki<br />

Yoshiaki Iwasaki, Okayama<br />

Satoru Kakizaki, Gunma<br />

Terumi Kamisawa, Tokyo<br />

Mototsugu Kato, Sapporo<br />

Naoya Kato, Tokyo<br />

Takumi Kawaguchi, Kurume<br />

Yohei Kida, Kainan<br />

Shogo Kikuchi, Aichi<br />

Tsuneo Kitamura, Chiba<br />

Takashi Kobayashi, Tokyo<br />

Yasuhiro Koga, Isehara<br />

Takashi Kojima, Sapporo<br />

Norihiro Kokudo, Tokyo<br />

Masatoshi Kudo, Osaka<br />

Shin Maeda, Tokyo<br />

IV<br />

Satoshi Mamori, Hyogo<br />

Atsushi Masamune, Sendai<br />

Yasushi Matsuzaki, Tsukuba<br />

Kenji Miki, Tokyo<br />

Toshihiro Mitaka, Sapporo<br />

Hiroto Miwa, Hyogo<br />

Kotaro Miyake, Tokushima<br />

Manabu Morimoto, Yokohama<br />

Yoshiharu Motoo, Kanazawa<br />

Yoshiaki Murakami, Hiroshima<br />

Yoshiki Murakami, Kyoto<br />

Kunihiko Murase, Tusima<br />

Akihito Nagahara, Tokyo<br />

Yuji Naito, Kyoto<br />

Atsushi Nakajima, Yokohama<br />

Hisato Nakajima, Tokyo<br />

Hiroki Nakamura, Yamaguchi<br />

Shotaro Nakamura, Fukuoka<br />

Akimasa Nakao, Nagogya<br />

Shuhei Nishiguchi, Hyogo<br />

Mikio Nishioka, Niihama<br />

Keiji Ogura, Tokyo<br />

Susumu Ohmada, Maebashi<br />

Hirohide Ohnishi, Akita<br />

Kenji Okajima, Nagoya<br />

Kazuichi Okazaki, Osaka<br />

Morikazu Onji, Ehime<br />

Satoshi Osawa, Hamamatsu<br />

Hidetsugu Saito, Tokyo<br />

Yutaka Saito, Tokyo<br />

Naoaki Sakata, Sendai<br />

Yasushi Sano, Chiba<br />

Tokihiko Sawada, Tochigi<br />

Tomohiko Shimatan, Hiroshima<br />

Yukihiro Shimizu, Kyoto<br />

Shinji Shimoda, Fukuoka<br />

Yoshio Shirai, Niigata<br />

Masayuki Sho, Nara<br />

Shoichiro Sumi, Kyoto<br />

Hidekazu Suzuki, Tokyo<br />

Masahiro Tajika, Nagoya<br />

Yoshihisa Takahashi, Tokyo<br />

Toshinari Takamura, Kanazawa<br />

Hiroaki Takeuchi, Kochi<br />

Yoshitaka Takuma, Okayama<br />

Akihiro Tamori, Osaka<br />

Atsushi Tanaka, Tokyo<br />

Shinji Tanaka, Hiroshima<br />

Satoshi Tanno, Hokkaido<br />

Shinji Togo, Yokohama<br />

Hitoshi Tsuda, Tokyo<br />

Hiroyuki Uehara, Osaka<br />

Masahito Uemura, Kashihara<br />

Yoshiyuki Ueno, Sendai<br />

Mitsuyoshi Urashima, Tokyo<br />

Takuya Watanabe, Niigata<br />

Satoshi Yamagiwa, Niigata<br />

Taketo Yamaguchi, Chiba<br />

Mitsunori Yamakawa, Yamagata<br />

Takayuki Yamamoto, Yokkaichi<br />

Yutaka Yata, Maebashi<br />

Hiroshi Yoshida, Tokyo<br />

Norimasa Yoshida, Kyoto<br />

Yuichi Yoshida, Osaka<br />

Kentaro Yoshika, Toyoake<br />

Hitoshi Yoshiji, Nara<br />

Katsutoshi Yoshizato, Higashihiroshima<br />

Tomoharu Yoshizumi, Fukuoka<br />

Jordan<br />

Ismail Matalka, Irbid<br />

January 7, 2011

---

Islam Khan, Safat<br />

Kuwait<br />

Lebanon<br />

Bassam N Abboud, Beirut<br />

Ala I Sharara, Beirut<br />

Rita Slim, Beirut<br />

Lithuania<br />

Giedrius Barauskas, Kaunas<br />

Limas Kupcinskas, Kaunas<br />

Malaysia<br />

Andrew Seng Boon Chua, Ipoh<br />

Mexico<br />

Richard A Awad, Mexico<br />

Aldo Torre Delgadillo, Mexico<br />

Diego Garcia-Compean, Monterrey<br />

Paulino M Hernández Magro, Celaya<br />

Miguel Angel Mercado, Distrito Federal<br />

Arturo Panduro, Jalisco<br />

Omar Vergara-Fernandez, Tlalpan<br />

Saúl Villa-Trevio, Mexico<br />

Moldova<br />

Igor Mishin, Kishinev<br />

Netherlands<br />

Ulrich Beuers, Amsterdam<br />

Lee Bouwman, Leiden<br />

Albert J Bredenoord, Nieuwegein<br />

Lodewijk AA Brosens, Utrecht<br />

J Bart A Crusius, Amsterdam<br />

Wouter de Herder, Rotterdam<br />

Pieter JF de Jonge, Rotterdam<br />

Robert J de Knegt, Rotterdam<br />

Wendy W Johanna de Leng, Utrecht<br />

Annemarie de Vries, Rotterdam<br />

James CH Hardwick, Leiden<br />

Frank Hoentjen, Haarlem<br />

Misha Luyer, Sittard<br />

Jeroen Maljaars, Maastricht<br />

Gerrit A Meijer, Amsterdam<br />

Servaas Morré, Amsterdam<br />

Chris JJ Mulder, Amsterdam<br />

John Plukker, Groningen<br />

Albert Frederik Pull ter Gunne, Tilburg<br />

Paul E Sijens, Groningen<br />

BW Marcel Spanier, Arnhem<br />

Shiri Sverdlov, Maastricht<br />

Maarten Tushuizen, Amsterdam<br />

Jantine van Baal, Heidelberglaan<br />

Astrid van der Velde, The Hague<br />

Karel van Erpecum, Utrecht<br />

Loes van Keimpema, Nijmegen<br />

WJG|www.wjgnet.com<br />

Robert Christiaan Verdonk, Groningen<br />

Erwin G Zoetendal, Wageningen<br />

New Zealand<br />

Andrew S Day, Christchurch<br />

Norway<br />

Olav Dalgard, Oslo<br />

Trond Peder Flaten, Trondheim<br />

Reidar Fossmark, Trondheim<br />

Rasmus Goll, Tromso<br />

Ole Høie, Arendal<br />

Asle W Medhus, Oslo<br />

Espen Melum, Oslo<br />

Trine Olsen, Tromso<br />

Eyvind J Paulssen, Tromso<br />

Jon Arne Søreide, Stavanger<br />

Kjetil Soreide, Stavanger<br />

Pakistan<br />

Shahab Abid, Karachi<br />

Syed MW Jafri, Karachi<br />

Poland<br />

Marek Bebenek, Wroclaw<br />

Tomasz Brzozowski, Cracow<br />

Halina Cichoż-Lach, Lublin<br />

Andrzej Dabrowski, Bialystok<br />

Hanna Gregorek, Warsaw<br />

Marek Hartleb, Katowice<br />

Beata Jolanta Jablońska, Katowice<br />

Stanislaw J Konturek, Krakow<br />

Jan Kulig, Krakow<br />

Dariusz M Lebensztejn, Bialystok<br />

Julian Swierczynski, Gdansk<br />

Portugal<br />

Raquel Almeida, Porto<br />

Ana Isabel Lopes, Lisboa Codex<br />

Ricardo Marcos, Porto<br />

Guida Portela-Gomes, Estoril<br />

Romania<br />

Dan L Dumitrascu, Cluj<br />

Adrian Saftoiu, Craiova<br />

Andrada Seicean, Cluj-Napoca<br />

Russia<br />

Vasiliy I Reshetnyak, Moscow<br />

Saudi Arabia<br />

Ibrahim A Al M<strong>of</strong>leh, Riyadh<br />

Abdul-Wahed Meshikhes, Qatif<br />

Faisal Sanai, Riyadh<br />

V<br />

Serbia<br />

Tamara M Alempijevic, Belgrade<br />

Dusan M Jovanovic, Sremska Kamenica<br />

Zoran Krivokapic, Belgrade<br />

Singapore<br />

Madhav Bhatia, Singapore<br />

Kong Weng Eu, Singapore<br />

Brian Kim Poh Goh, Singapore<br />

Khek-Yu Ho, Singapore<br />

Kok Sun Ho, Singapore<br />

Fock Kwong Ming, Singapore<br />

London Lucien Ooi, Singapore<br />

Nagarajan Perumal, Singapore<br />

Francis Seow-Choen, Singapore<br />

South Africa<br />

Rosemary Joyce Burnett, Pretoria<br />

Michael Kew, Cape Town<br />

South Korea<br />

Sang Hoon Ahn, Seoul<br />

Sung-Gil Chi, Seoul<br />

Myung-Gyu Choi, Seoul<br />

Hoon Jai Chun, Seoul<br />

Yeun-Jun Chung, Seoul<br />

Young-Hwa Chung, Seoul<br />

Kim Donghee, Seoul<br />

Ki-Baik Hahm, Incheon<br />

Sun Pyo Hong, Geonggi-do<br />

Seong Gyu Hwang, Seongnam<br />

Hong Joo Kim, Seoul<br />

Jae J Kim, Seoul<br />

Jin-Hong Kim, Suwon<br />

Nayoung Kim, Seongnam-si<br />

Sang Geon Kim, Seoul<br />

Seon Hahn Kim, Seoul<br />

Sung Kim, Seoul<br />

Won Ho Kim, Seoul<br />

Jeong Min Lee, Seoul<br />

Kyu Taek Lee, Seoul<br />

Sang Kil Lee, Seoul<br />

Sang Yeoup Lee, Gyeongsangnam-do<br />

Yong Chan Lee, Seoul<br />

Eun-Yi Moon, Seoul<br />

Hyoung-Chul Oh, Seoul<br />

Seung Woon Paik, Seoul<br />

Joong-Won Park, Goyang<br />

Ji Kon Ryu, Seoul<br />

Si Young Song, Seoul<br />

Marie Yeo, Suwon<br />

Byung Chul Yoo, Seoul<br />

Dae-Yeul Yu, Daejeon<br />

Spain<br />

Maria-Angeles Aller, Madrid<br />

Raul J Andrade, Málaga<br />

Luis Aparisi, Valencia<br />

Gloria González Aseguinolaza, Navarra<br />

Matias A Avila, Pamplona<br />

January 7, 2011

---

Fernando Azpiroz, Barcelona<br />

Ramon Bataller, Barcelona<br />

Belén Beltrán, Valencia<br />

Adolfo Benages, Valencia<br />

Josep M Bordas, Barcelona<br />

Lisardo Boscá, Madrid<br />

Luis Bujanda, San Sebastián<br />

Juli Busquets, Barcelona<br />

Matilde Bustos, Pamplona<br />

José Julián calvo Andrés, Salamanca<br />

Andres Cardenas, Barcelona<br />

Antoni Castells, Barcelona<br />

Fernando J Corrales, Pamplona<br />

J E Domínguez-Muñoz, Santiago de Compostela<br />

Juan Carlos Laguna Egea, Barcelona<br />

Isabel Fabregat, Barcelona<br />

Antoni Farré, Barcelona<br />

Vicente Felipo, Valencia<br />

Laureano Fernández-Cruz, Barcelona<br />

Luis Grande, Barcelona<br />

Angel Lanas, Zaragoza<br />

Juan-Ramón Larrubia, Guadalajara<br />

María IT López, Jaén<br />

Juan Macías, Seville<br />

Javier Martin, Granada<br />

José Manuel Martin-Villa, Madrid<br />

Julio Mayol, Madrid<br />

Mireia Miquel, Sabadell<br />

Albert Parés, Barcelona<br />

Jesús M Prieto, Pamplona<br />

Pedro L Majano Rodriguez, Madrid<br />

Joan Roselló-Catafau, Barcelona<br />

Eva Vaquero, Barcelona<br />

Sweden<br />

Lars Erik Agréus, Stockholm<br />

Mats Andersson, Stockholm<br />

Roland Andersson, Lund<br />

Mauro D’Amato, Huddinge<br />

Evangelos Kalaitzakis, Gothenburg<br />

Greger Lindberg, Stockholm<br />

Annika Lindblom, Stockholm<br />

Sara Lindén, Göteborg<br />

Hanns-Ulrich Marschall, Stockholm<br />

Pär Erik Myrelid, Linköping<br />

Åke Nilsson, Lund<br />

Helena Nordenstedt, Stockholm<br />

Kjell Öberg, Uppsala<br />

Lars A Pahlman, Uppsala<br />

Stefan G Pierzynowski, Lund<br />

Sara Regnér, Malmö<br />

Bobby Tingstedt, Lund<br />

Zongli Zheng, Stockholm<br />

Switzerland<br />

Pascal Bucher, Geneva<br />

Michelangelo Foti, Geneva<br />

Jean L Frossard, Geneva<br />

Andreas Geier, Zürich<br />

Pascal Gervaz, Geneva<br />

Gerd A Kullak-Ublick, Zürich<br />

Fabrizio Montecucco, Geneva<br />

Paul M Schneider, Zürich<br />

Felix Stickel, Berne<br />

Bruno Stieger, Zürich<br />

Inti Zlobec, Basel<br />

WJG|www.wjgnet.com<br />

Trinidad and Tobago<br />

Shivananda Nayak, Mount Hope<br />

Turkey<br />

Sinan Akay, Tekirdag<br />

Metin Basaranoglu, Istanbul<br />

Yusuf Bayraktar, Ankara<br />

A Mithat Bozdayi, Ankara<br />

Hayrullah Derici, Balıkesir<br />

Eren Ersoy, Ankara<br />

Mukaddes Esrefoglu, Malatya<br />

Can Goen, Kutahya<br />

Selin Kapan, Istanbul<br />

Aydin Karabacakoglu, Konya<br />

Cuneyt Kayaalp, Malatya<br />

Kemal Kismet, Ankara<br />

Seyfettin Köklü, Ankara<br />

Mehmet Refik Mas, Etlik-Ankara<br />

Osman C Ozdogan, Istanbul<br />

Bülent Salman, Ankara<br />

Orhan Sezgin, Mersin<br />

Ilker Tasci, Ankara<br />

Müge Tecder-Ünal, Ankara<br />

Ahmet Tekin, Mersin<br />

Mesut Tez, Ankara<br />

Ekmel Tezel, Ankara<br />

Özlem Yilmaz, Izmir<br />

United Arab Emirates<br />

Fikri M Abu-Zidan, Al-Ain<br />

Sherif M Karam, Al-Ain<br />

United Kingdom<br />

Simon Afford, Birmingham<br />

Navneet K Ahluwalia, Stockport<br />

Mohamed H Ahmed, Southampton<br />

Basil Ammori, Salford<br />

Lesley A Anderson, Belfast<br />

Chin Wee Ang, Liverpool<br />

Yeng S Ang, Wigan<br />

Anthony TR Axon, Leeds<br />

Kathleen B Bamford, London<br />

Jim D Bell, London<br />

John Beynon, Swansea<br />

Chris Briggs, Sheffield<br />

Ge<strong>of</strong>frey Burnstock, London<br />

Alastair D Burt, Newcastle<br />

Jeff Butterworth, Shrewsbury<br />

Jeremy FL Cobbold, London<br />

Jean E Crabtree, Leeds<br />

Tatjana Crnogorac-Jurcevic, London<br />

William Dickey, Londonderry<br />

Sunil Dolwani, Cardiff<br />

Emad M El-Omar, Aberdeen<br />

A M El-Tawil, Birmingham<br />

Charles B Ferguson, Belfast<br />

Andrew Fowell, Southampton<br />

Piers Gatenby, London<br />

Daniel R Gaya, Edinburgh<br />

Anil George, London<br />

Rob Glynne-Jones, Northwood<br />

Jason CB Goh, Birmingham<br />

Gianpiero Gravante, Leicester<br />

VI<br />

Brian Green, Belfast<br />

William Greenhalf, Liverpool<br />

Indra N Guha, Nottingham<br />

Stefan G Hübscher, Birmingham<br />

Robin Hughes, London<br />

Pali Hungin, Stockton<br />

Nawfal Hussein, Nottingham<br />

Clement W Imrie, Glasgow<br />

Janusz AZ Jankowski, Oxford<br />

Sharad Karandikar, Birmingham<br />

Peter Karayiannis, London<br />

Shahid A Khan, London<br />

Patricia F Lalor, Birmingham<br />

John S Leeds, Sheffield<br />

Ian Lindsey, Oxford<br />

Hong-Xiang Liu, Cambridge<br />

Dileep N Lobo, Nottingham<br />

Graham MacKay, Glasgow<br />

Mark Edward McAlindon, Sheffield<br />

Anne McCune, Bristol<br />

Donald Campbell McMillan, Glasgow<br />

Giorgina Mieli-Vergani, London<br />

Jamie Murphy, London<br />

Guy Fairbairn Nash, Poole<br />

James Neuberger, Birmingham<br />

Patrick O’Dwyer, Glasgow<br />

Christos Paraskeva, Bristol<br />

Richard Parker, North Staffordshire<br />

Thamara Perera, Birmingham<br />

Kondragunta Rajendra Prasad, Leeds<br />

D Mark Pritchard, Liverpool<br />

Alberto Quaglia, London<br />

Akhilesh B Reddy, Cambridge<br />

Kevin Robertson, Glasgow<br />

Sanchoy Sarkar, Liverpool<br />

John B Sch<strong>of</strong>ield, Kent<br />

Marco Senzolo, Padova<br />

Venkatesh Shanmugam, Derby<br />

Paul Sharp, London<br />

Chew Thean Soon, Manchester<br />

Aravind Suppiah, East Yorkshire<br />

Noriko Suzuki, Middlesex<br />

Simon D Taylor-Robinson, London<br />

Frank I Tovey, London<br />

A McCulloch Veitch, Wolverhampton<br />

Vamsi R Velchuru, Lowest<strong>of</strong>t<br />

Sumita Verma, Brighton<br />

Catherine Walter, Cheltenham<br />

Julian RF Walters, London<br />

Roger Williams, London<br />

United States<br />

Kareem M Abu-Elmagd, Pittsburgh<br />

Sami R Achem, Florida<br />

Golo Ahlenstiel, Bethesda<br />

Bhupinder S Anand, Houston<br />

M Ananthanarayanan, New York<br />

Balamurugan N Appakalal, Minneapolis<br />

Dimitrios V Avgerinos, New York<br />

Shashi Bala, Worcester<br />

Anthony J Bauer, Pittsburgh<br />

Kevin E Behrns, Gainesville<br />

Roberto Bergamaschi, New York<br />

Henry J Binder, New Haven<br />

Edmund J Bini, New York<br />

Wojciech Blonski, Philadelphia<br />

Mark Bloomston, Columbus<br />

Edward L Bradley III, Sarasota<br />

Carla W Brady, Durham<br />

January 7, 2011

---

David A Brenner, San Diego<br />

Adeel A Butt, Pittsburgh<br />

Shi-Ying Cai, New Haven<br />

Justin MM Cates, Nashville<br />

Eugene P Ceppa, Durham<br />

Jianyuan Chai, Long Beach<br />

Ronald S Chamberlain, Livingston<br />

Fei Chen, Morgantown<br />

Xian-Ming Chen, Omaha<br />

Ramsey Chi-man Cheung, Palo Alto<br />

Denesh Chitkara, East Brunswick<br />

Clifford S Cho, Madison<br />

Parimal Chowdhury, Arkansas<br />

John David Christein, Birmingham<br />

Thomas Clancy, Boston<br />

Ana J Coito, Los Angeles<br />

Ricardo Alberto Cruciani, New York<br />

Joseph J Cullen, Iowa City<br />

Mark J Czaja, New York<br />

Mariana D Dabeva, Bronx<br />

Jessica A Davila, Houston<br />

Conor P Delaney, Cleveland<br />

Laurie DeLeve, Los Angeles<br />

Anthony J Demetris, Pittsburgh<br />

Sharon DeMorrow, Temple<br />

Bijan Eghtesad, Cleveland<br />

Yoram Elitsur, Huntington<br />

Mohamad A Eloubeidi, Alabama<br />

Wael El-Rifai, Nashville<br />

Sukru H Emre, New Haven<br />

Giamila Fantuzzi, Chicago<br />

Ashkan Farhadi, Irvine<br />

Ronnie Fass, Tucson<br />

Martín E Fernández-Zapico, Rochester<br />

Alessandro Fichera, Chicago<br />

Josef E Fischer, Boston<br />

Piero Marco Fisichella, Maywood<br />

Fritz Francois, New York<br />

Glenn T Furuta, Aurora<br />

T Clark Gamblin, Pittsburgh<br />

Henning Gerke, Iowa City<br />

Jean-Francois Geschwind, Baltimore<br />

R Mark Ghobrial, Texas<br />

John F Gibbs, Buffalo<br />

Shannon S Glaser, Temple<br />

Ajay Goel, Dallas<br />

Jon C Gould, Madison<br />

Eileen F Grady, San Francisco<br />

James H Grendell, New York<br />

John R Grider, Richmond<br />

Anna S Gukovskaya, Los Angeles<br />

Chakshu Gupta, St. Joseph<br />

Grigoriy E Gurvits, New York<br />

Hai-Yong Han, Phoenix<br />

Yuan-Ping Han, Los Angeles<br />

Imran Hassan, Springfield<br />

Charles P Heise, Madison<br />

Lisa J Herrinton, Oakland<br />

Oscar Joe Hines, Los Angeles<br />

Samuel B Ho, San Diego<br />

Steven Hochwald, Gainesville<br />

Richard Hu, Los Angeles<br />

Eric S Hungness, Chicago<br />

Jamal A Ibdah, Columbia<br />

Atif Iqbal, Omaha<br />

Hartmut Jaeschke, Tucson<br />

Donald M Jensen, Chicago<br />

Robert Jensen, Bethesda<br />

Leonard R Johnson, Memphis<br />

Andreas M Kaiser, Los Angeles<br />

JingXuan Kang, Charlestown<br />

John Y Kao, Michigan<br />

Randeep Singh Kashyap, New York<br />

Rashmi Kaul, Tulsa<br />

WJG|www.wjgnet.com<br />

Jonathan D Kaunitz, Los Angeles<br />

Stephen M Kavic, Baltimore<br />

Ali Keshavarzian, Chicago<br />

Amir Maqbul Khan, Marshall<br />

Kusum K Kharbanda, Omaha<br />

Chang Kim, West Lafayette<br />

Dean Y Kim, Detroit<br />

Miran Kim, Providence<br />

Burton I Korelitz, New York<br />

Josh Korzenik, Boston<br />

Richard A Kozarek, Seattle<br />

Alyssa M Krasinskas, Pittsburgh<br />

Shiu-Ming Kuo, Buffalo<br />

Michelle Lai, Boston<br />

Michael Leitman, New York<br />

Dong-Hui Li, Houston<br />

Ming Li, New Orleans<br />

Zhiping Li, Baltimore<br />

Gary R Lichtenstein, Philadelphia<br />

Chen Liu, Gainesville<br />

Zhang-Xu Liu, Los Angeles<br />

Craig D Logsdon, Houston<br />

Kaye M Reid Lombardo, Rochester<br />

Michael R Lucey, Madison<br />

Kirk Ludwig, Wisconsin<br />

James D Luketich, Pittsburgh<br />

Patrick M Lynch, Houston<br />

John S Macdonald, New York<br />

Willis C Maddrey, Dallas<br />

Mercedes Susan Mandell, Aurora<br />

Christopher Mantyh, Durham<br />

Wendy M Mars, Pittsburgh<br />

John Marshall, Columbia<br />

Robert CG Martin, Louisville<br />

Laura E Matarese, Pittsburgh<br />

Craig J McClain, Louisville<br />

Lynne V McFarland, Washington<br />

David J McGee, Shreveport<br />

Valentina Medici, Sacramento<br />

Stephan Menne, New York<br />

Didier Merlin, Atlanta<br />

George Michalopoulos, Pittsburgh<br />

James M Millis, Chicago<br />

Pramod K Mistry, New Haven<br />

Emiko Mizoguchi, Boston<br />

Huanbiao Mo, Denton<br />

Robert C Moesinger, Ogden<br />

Smruti R Mohanty, Chicago<br />

John Morton, Stanford<br />

Peter L Moses, Burlington<br />

Sandeep Mukherjee, Omaha<br />

Million Mulugeta, Los Angeles<br />

Michel M Murr, Tampa<br />

Pete Muscarella, Columbus<br />

Ece A Mutlu, Chicago<br />

Masaki Nagaya, Boston<br />

Laura E Nagy, Cleveland<br />

Aejaz Nasir, Tampa<br />

Udayakumar Navaneethan, Cincinnati<br />

Stephen JD O’Keefe, Pittsburgh<br />

Robert D Odze, Boston<br />

Giuseppe Orlando, Winston Salem<br />

Pal Pacher, Rockville<br />

Georgios Papachristou, Pittsburgh<br />

Jong Park, Tampa<br />

William R Parker, Durham<br />

Mansour A Parsi, Cleveland<br />

Marco Giuseppe Patti, Chicago<br />

Zhiheng Pei, New York<br />

CS Pitchumoni, New Brunswiuc<br />

Parviz M Pour, Omaha<br />

Xia<strong>of</strong>a Qin, Newark<br />

Florencia Georgina Que, Rochester<br />

Massimo Raimondo, Jacksonville<br />

VII<br />

Raymund R Razonable, Minnesota<br />

Kevin Michael Reavis, Orange<br />

Robert V Rege, Dallas<br />

Douglas K Rex, Indianapolis<br />

Victor E Reyes, Galveston<br />

Basil Rigas, New York<br />

Richard A Rippe, Chapel Hill<br />

Alexander S Rosemurgy, Tampa<br />

Philip Rosenthal, San Francisco<br />

Raul J Rosenthal, Weston<br />

Joel H Rubenstein, Ann Arbor<br />

Shawn D Safford, Norfolk<br />

Rabih M Salloum, Rochester<br />

Bruce E Sands, Boston<br />

Tor C Savidge, Galveston<br />

Michael L Schilsky, New Haven<br />

Beat Schnüriger, California<br />

Robert E Schoen, Pittsburgh<br />

Matthew James Schuchert, Pittsburgh<br />

Ekihiro Seki, La Jolla<br />

Le Shen, Chicago<br />

Perry Shen, Winston-Salem<br />

Stuart Sherman, Indianapolis<br />

Mitchell L Shiffman, Richmond<br />

Shivendra Shukla, Columbia<br />

Bronislaw L Slomiany, Newark<br />

Scott Steele, Fort Lewis<br />

Branko Stefanovic, Tallahassee<br />

Lygia Stewart, San Francisco<br />

Luca Stocchi, Cleveland<br />

Daniel S Straus, Riverside<br />

Robert Todd Striker, Madison<br />

Jonathan Strosberg, Tampa<br />

Christina Surawicz, Seattle<br />

Patricia Sylla, Boston<br />

Wing-Kin Syn, Durham<br />

Yvette Taché, Los Angeles<br />

Kazuaki Takabe, Richmond<br />

Kam-Meng Tchou-Wong, New York<br />

Klaus Thaler, Columbia<br />

Charles Thomas, Oregon<br />

Natalie J Torok, Sacramento<br />

George Triadafilopoulos, Stanford<br />

Chung-Jyi Tsai, Lexington<br />

Thérèse Tuohy, Salt Lake City<br />

Andrew Ukleja, Florida<br />

Santhi Swaroop Vege, Rochester<br />

Aaron Vinik, Norfolk<br />

Dinesh Vyas, Washington<br />

Arnold Wald, Wisconsin<br />

Scott A Waldman, Philadelphia<br />

Jack R Wands, Providence<br />

Jiping Wang, Boston<br />

Irving Waxman, Chicago<br />

Wilfred M Weinstein, Los Angeles<br />

Steven D Wexner, Weston<br />

John W Wiley, Ann Arbor<br />

Jackie Wood, Ohio<br />

Jian Wu, Sacramento<br />

Wen Xie, Pittsburgh<br />

Guang-Yin Xu, Galveston<br />

Fang Yan, Nashville<br />

Radha Krishna Yellapu, New York<br />

Anthony T Yeung, Philadelphia<br />

Zobair M Younossi, Virginia<br />

Liqing Yu, Winston-Salem<br />

Run Yu, Los Angeles<br />

Ruben Zamora, Pittsburgh<br />

Michael E Zenilman, New York<br />

Mark A Zern, Sacramento<br />

Lin Zhang, Pittsburgh<br />

Martin D Zielinski, Rochester<br />

Michael A Zimmerman, Colorado<br />

January 7, 2011

---

Contents<br />

BRIEF ARTICLE<br />

WJG|www.wjgnet.com<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Volume 17 Number 7 February 21, 2011<br />

906 Outcome <strong>of</strong> non surgical hepatic decompression procedures in Egyptian<br />

patients with Budd-Chiari<br />

Eldorry A, Barakat E, Abdella H, Abdelhakam S, Shaker M, Hamed A, Sakr M<br />

914 Body mass index is associated with age-at-onset <strong>of</strong> HCV-infected<br />

hepatocellular carcinoma patients<br />

Akiyama T, Mizuta T, Kawazoe S, Eguchi Y, Kawaguchi Y, Takahashi H, Ozaki I, Fujimoto K<br />

922 Vitamin D deficiency in cirrhosis relates to liver dysfunction rather than<br />

aetiology<br />

Malham M, Jørgensen SP, Ott P, Agnholt J, Vilstrup H, Borre M, Dahlerup JF<br />

926 Natural orifice transluminal endoscopic wedge hepatic resection with a water-<br />

jet hybrid knife in a non-survival porcine model<br />

Shi H, Jiang SJ, Li B, Fu DK, Xin P, Wang YG<br />

932 Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells<br />

Yang ZL, Zheng Q, Yan J, Pan Y, Wang ZG<br />

938 Transplantation <strong>of</strong> microencapsulated umbilical-cord-blood-derived hepatic-<br />

like cells for treatment <strong>of</strong> hepatic failure<br />

Zhang FT, Wan HJ, Li MH, Ye J, Yin MJ, Huang CQ, Yu J<br />

946 Primary clear cell carcinoma in the liver: CT and MRI findings<br />

Liu QY, Li HG, Gao M, Lin XF, Li Y, Chen JY<br />

February 21, 2011|Volume 17| ssue 7|

---

Contents<br />

APPENDIX<br />

FLYLEAF<br />

EDITORS FOR<br />

THIS ISSUE<br />

NAME OF JOURNAL<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

LAUNCH DATE<br />

October 1, 1995<br />

RESPONSIBLE INSTITUTION<br />

Department <strong>of</strong> Science and Technology <strong>of</strong> Shanxi<br />

Province<br />

SPONSOR<br />

Taiyuan Research and Treatment Center for Digestive<br />

Diseases, 77 Shuangta Xijie, Taiyuan 030001, Shanxi<br />

Province, China<br />

EDITING<br />

Editorial Board <strong>of</strong> <strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology,<br />

Room 903, Building D, Ocean International Center,<br />

No. 62 Dongsihuan Zhonglu, Chaoyang District,<br />

Beijing 100025, China<br />

Telephone: +86-10-5908-0039<br />

Fax: +86-10-8538-1893<br />

E-mail: wjg@wjgnet.com<br />

http://www.wjgnet.com<br />

PUBLISHING<br />

Baishideng Publishing Group Co., Limited,<br />

Room 1701, 17/F, Henan Building,<br />

No.90 Jaffe Road, Wanchai, Hong Kong, China<br />

Fax: +852-3115-8812<br />

Telephone: +852-5804-2046<br />

E-mail: baishideng@wjgnet.com<br />

http://www.wjgnet.com<br />

SUBSCRIPTION<br />

Beijing Baishideng BioMed Scientific Co., Ltd.,<br />

Room 903, Building D, Ocean International Center,<br />

No. 62 Dongsihuan Zhonglu, Chaoyang District,<br />

Beijing 100025, China<br />

Telephone: +86-10-8538-1892<br />

Fax: +86-10-8538-1893<br />

E-mail: baishideng@wjgnet.com<br />

http://www.wjgnet.com<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Volume 17 Number 7 February 21, 2011<br />

ACKNOWLEDGMENTS I Acknowledgments to reviewers <strong>of</strong> <strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

ABOUT COVER<br />

AIM AND SCOPE<br />

WJG|www.wjgnet.com<br />

I Meetings<br />

I-VI Instructions to authors<br />

Sharma C, Eltawil KM, Renfrew PD, Walsh MJ, Molinari M. Advances in diagnosis,<br />

treatment and palliation <strong>of</strong> pancreatic carcinoma: 1990-2010.<br />

<strong>World</strong> J Gastroenterol 2011; 17(7): 867-897<br />

http://www.wjgnet.com/1007-9327/full/v17/i7/867.htm<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology (<strong>World</strong> J Gastroenterol, WJG, print ISSN 1007-9327, DOI:<br />

10.3748) is a weekly, open-access, peer-reviewed journal supported by an editorial board <strong>of</strong><br />

1144 experts in gastroenterology and hepatology from 60 countries.<br />

The major task <strong>of</strong> WJG is to report rapidly the most recent results in basic and clinical<br />

research on esophageal, gastrointestinal, liver, pancreas and biliary tract diseases, Helicobacter<br />

pylori, endoscopy and gastrointestinal surgery, including: gastroesophageal reflux disease,<br />

gastrointestinal bleeding, infection and tumors; gastric and duodenal disorders; intestinal<br />

inflammation, micr<strong>of</strong>lora and immunity; celiac disease, dyspepsia and nutrition; viral hepatitis,<br />

portal hypertension, liver fibrosis, liver cirrhosis, liver transplantation, and metabolic liver<br />

disease; molecular and cell biology; geriatric and pediatric gastroenterology; diagnosis and<br />

screening, imaging and advanced technology.<br />

I-VII Editorial Board<br />

Responsible Assistant Editor: Xiao-Fang Liu Responsible Science Editor: Zhong-Fang Shi<br />

Responsible Electronic Editor: Wen-Hua Ma Pro<strong>of</strong>ing Editorial Office Director: Jian-Xia Cheng<br />

Pro<strong>of</strong>ing Editor-in-Chief: Lian-Sheng Ma<br />

PRINT SUBSCRIPTION<br />

RMB 245 Yuan for each issue, RMB 11760 Yuan for<br />

one year.<br />

ONLINE SUBSCRIPTION<br />

One-Year Price 864.00 USD<br />

PUBLICATION DATE<br />

February 21, 2011<br />

SERIAL PUBLICATION NUMBER<br />

ISSN 1007-9327 (print)<br />

ISSN 2219-2840 (online)<br />

HONORARY EDITORS-IN-CHIEF<br />

James L Boyer, New Haven<br />

Ke-Ji Chen, Beijing<br />

Martin H Floch, New Haven<br />

Geng-Tao Liu, Beijing<br />

Emmet B Keeffe, Palo Alto<br />

Lein-Ray Mo, Tainan<br />

Eamonn M Quigley, Cork<br />

Rafiq A Sheikh, Sacramento<br />

Nicholas J Talley, Rochester<br />

Ming-Lung Yu, Kaohsiung<br />

PRESIDENT AND EDITOR-IN-CHIEF<br />

Lian-Sheng Ma, Beijing<br />

ACADEMIC EDITOR-IN-CHIEF<br />

Tauseef Ali, Oklahoma<br />

Mauro Bortolotti, Bologna<br />

Tarkan Karakan, Ankara<br />

Weekitt Kittisupamongkol, Bangkok<br />

Anastasios Koulaouzidis, Edinburgh<br />

Gerd A Kullak-Ublick, Zürich<br />

Bo-Rong Pan, Xi’an<br />

Sylvia LF Pender, Southampton<br />

Max S Petrov, Auckland<br />

George Y Wu, Farmington<br />

STRATEGY ASSOCIATE EDITORS-IN-CHIEF<br />

Peter Draganov, Florida<br />

Hugh J Freeman, Vancouver<br />

Maria Concepción Gutiérrez-Ruiz, México<br />

Kazuhiro Hanazaki, Kochi<br />

Akio Inui, Kagoshima<br />

Kalpesh Jani, Baroda<br />

Javier S Martin, Punta del Este<br />

Natalia A Osna, Omaha<br />

Wei Tang, Tokyo<br />

Alan BR Thomson, Edmonton<br />

Harry HX Xia, Hanover<br />

ASSOCIATE EDITORS-IN-CHIEF<br />

You-Yong Lu, Beijing<br />

John M Luk, Pokfulam<br />

Hiroshi Shimada, Yokohama<br />

EDITORIAL OFFICE<br />

Jian-Xia Cheng, Director<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Room 903, Building D, Ocean International Center,<br />

No. 62 Dongsihuan Zhonglu, Chaoyang District,<br />

Beijing 100025, China<br />

Telephone: +86-10-5908-0039<br />

Fax: +86-10-8538-1893<br />

E-mail: wjg@wjgnet.com<br />

http://www.wjgnet.com<br />

COPYRIGHT<br />

© 2011 Baishideng. Articles published by this Open-<br />

Access journal are distributed under the terms <strong>of</strong> the<br />

Creative Commons Attribution Non-commercial<br />

License, which permits use, distribution, and reproduction<br />

in any medium, provided the original work<br />

is properly cited, the use is non commercial and is<br />

otherwise in compliance with the license.<br />

SPECIAL STATEMENT<br />

All articles published in this journal represent the<br />

viewpoints <strong>of</strong> the authors except where indicated<br />

otherwise.<br />

INSTRUCTIONS TO AUTHORS<br />

Full instructions are available online at http://www.<br />

wjgnet.com/1007-9327/g_info_20100315215714.htm.<br />

If you do not have web access please contact the<br />

editorial <strong>of</strong>fice.<br />

ONLINE SUBMISSION<br />

http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

February 21, 2011|Volume 17| ssue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.817<br />

MicroRNAs in pancreatic ductal adenocarcinoma<br />

Jong Y Park, James Helm, Domenico Coppola, Donghwa Kim, Mokenge Malafa, Seung Joon Kim<br />

Jong Y Park, Division <strong>of</strong> Cancer Prevention and Control, M<strong>of</strong>fitt<br />

Cancer Center, FL 33612, United States<br />

James Helm, Mokenge Malafa, Gastrointestinal Tumor Program,<br />

M<strong>of</strong>fitt Cancer Center, FL 33612, United States<br />

Domenico Coppola, Department <strong>of</strong> Anatomic Pathology, M<strong>of</strong>fitt<br />

Cancer Center, FL 33612, United States<br />

Donghwa Kim, Department <strong>of</strong> Molecular Oncology, M<strong>of</strong>fitt<br />

Cancer Center, FL 33612, United States<br />

Seung Joon Kim, Department <strong>of</strong> Internal Medicine, College<br />

<strong>of</strong> Medicine, the Catholic University <strong>of</strong> Korea, Seoul 137-040,<br />

South Korea<br />

Author contributions: Park JY drafted the initial concept,<br />

wrote, reviewed and finalized the manuscript; Helm J provided<br />

clinical information, participated in writing, and revised the<br />

manuscript; Coppola D provided clinical information, participated<br />

in writing, and revised the manuscript; Kim D provided<br />

valuable advice for study design and drew the figure; Malafa<br />

M provided clinical information, participated in writing, and<br />

revised the manuscript; Kim SJ designed the manuscript format,<br />

collected the references and wrote the manuscript.<br />

Supported by M<strong>of</strong>fitt Faculty Support Fund<br />

Correspondence to: Seung Joon Kim, MD, PhD, Department<br />

<strong>of</strong> Internal Medicine, College <strong>of</strong> Medicine, the Catholic<br />

University <strong>of</strong> Korea, Seoul 137-040,<br />

South Korea. cmcksj@catholic.ac.kr<br />

Telephone: +82-2-22586063 Fax: +82-2-5993589<br />

Received: August 14, 2010 Revised: November 25, 2010<br />

Accepted: December 2, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

Ductal adenocarcinoma <strong>of</strong> the pancreas is a lethal <strong>cancer</strong><br />

for which the only chance <strong>of</strong> long-term survival<br />

belongs to the patient with localized disease in whom<br />

a potentially curative resection can be done. Therefore,<br />

biomarkers for early detection and new therapeutic strategies<br />

are urgently needed. miRNAs are a recently discovered<br />

class <strong>of</strong> small endogenous non-coding RNAs <strong>of</strong><br />

about 22 nucleotides that have gained attention for their<br />

role in downregulation <strong>of</strong> mRNA expression at the posttranscriptional<br />

level. miRNAs regulate proteins involved<br />

in critical cellular processes such as differentiation, proliferation,<br />

and apoptosis. Evidence suggests that deregu-<br />

WJG|www.wjgnet.com<br />

817<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 817-827<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

EDITORIAL<br />

lated miRNA expression is involved in carcinogenesis at<br />

many sites, including the pancreas. Aberrant expression<br />

<strong>of</strong> miRNAs may upregulate the expression <strong>of</strong> oncogenes<br />

or downregulate the expression <strong>of</strong> tumor suppressor<br />

genes, as well as play a role in other mechanisms <strong>of</strong> carcinogenesis.<br />

The purpose <strong>of</strong> this review is to summarize<br />

our knowledge <strong>of</strong> deregulated miRNA expression in pancreatic<br />

<strong>cancer</strong> and discuss the implication for potential<br />

translation <strong>of</strong> this knowledge into clinical practice.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: MicroRNAs; Pancreatic <strong>cancer</strong><br />

Peer reviewer: Yoshiharu Motoo, MD, PhD, FACP, FACG,<br />

Pr<strong>of</strong>essor and Chairman, Department <strong>of</strong> Medical Oncology,<br />

Kanazawa Medical University, 1-1 Daigaku, Uchinada,<br />

Ishikawa 920-0293, Japan<br />

Park JY, Helm J, Coppola D, Kim D, Malafa M, Kim SJ. MicroRNAs<br />

in pancreatic ductal adenocarcinoma. <strong>World</strong> J Gastroenterol<br />

2011; 17(7): 817-827 Available from: URL: http://www.<br />

wjgnet.com/1007-9327/full/v17/i7/817.htm DOI: http://dx.doi.<br />

org/10.3748/wjg.v17.i7.817<br />

INTRODUCTION<br />

Pancreatic <strong>cancer</strong> is the fourth leading cause <strong>of</strong> <strong>cancer</strong>-related<br />

mortality in the United States, with 36 800 estimated<br />

deaths in 2010, with the great majority being due to ductal<br />

adenocarcinomas [1] . Due to the asymptomatic onset <strong>of</strong><br />

pancreatic <strong>cancer</strong>, most patients are in advanced or metastatic<br />

condition at the time <strong>of</strong> diagnosis, resulting in poor<br />

prognosis. Most patients found to have pancreatic <strong>cancer</strong><br />

die within 12 mo, and few survive 5 years after diagnosis.<br />

The poor prognosis <strong>of</strong> these patients is due to its late<br />

clinical presentation with symptoms, early and aggressive<br />

local invasion, and high metastatic potential [2] . Advances in<br />

chemo-radiation therapy have been slow over the last few<br />

decades, and the overall prognosis in pancreatic <strong>cancer</strong> has<br />

remained essentially unchanged. The only chance <strong>of</strong> longterm<br />

survival with pancreatic adenocarcinoma belongs to<br />

February 21, 2011|Volume 17|Issue 7|

---

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

Table 1 miRNA deregulation in human pancreatic <strong>cancer</strong><br />

miRNA Lee<br />

et al [49]<br />

Szafranska<br />

et al [50]<br />

Bloomston<br />

et al [51]<br />

Zhang<br />

et al [52]<br />

Other Outcome<br />

let-7 ↓ [53]<br />

let-7d ↑ 1<br />

let-7f-1 ↑<br />

miR-10a ↑ ↑ [54]<br />

miR-10b ↑<br />

miR-15b ↑ ↑<br />

miR-16-1 ↑<br />

miR-18a ↑<br />

miR-21 ↑ ↑<br />

[55, 56]<br />

↑ Poor [55]<br />

miR-23a ↑<br />

miR-23b ↑<br />

miR-24-1,2 ↑<br />

miR-29c ↓<br />

miR-31 ↑<br />

miR-92-1 ↑<br />

miR-93 ↑<br />

miR-95 ↑<br />

miR-96 ↓<br />

miR-99 ↑<br />

miR-100 ↑ ↑<br />

miR-100-1/2 ↑<br />

miR-103-2 ↑<br />

miR-107 ↑ ↑<br />

miR-125a ↑<br />

miR-125b-1 ↑ ↑<br />

miR-130b ↓<br />

miR-139 ↓<br />

miR-141 ↓<br />

miR-142-P ↓<br />

miR-143 ↑ ↑<br />

miR-145 ↑<br />

miR-146 ↑<br />

miR-146a ↑<br />

miR-148a ↓ ↓<br />

miR-148b ↓ ↓<br />

miR-150 ↑<br />

miR-155 ↑ ↑ ↑ Poor [57]<br />

miR-181a ↑ ↑<br />

miR-181b ↑<br />

miR-181b-1 ↑<br />

miR-181b-2 ↑<br />

miR-181c ↑ ↑<br />

miR-181d ↑<br />

miR-186 ↑<br />

miR-190 ↑<br />

miR-196a ↑ ↑ miR-<br />

196a-2;<br />

Poor [51]<br />

miR-196b ↑<br />

miR-199a-1 ↑<br />

miR-199a-2 ↑<br />

miR-200b ↑<br />

miR-203 ↑ Poor [57]<br />

miR-205 ↑ ↑<br />

miR-210 ↑ ↑ Poor [57]<br />

miR-212 ↑<br />

miR-213 ↑<br />

miR-216 ↓<br />

miR-217 ↓<br />

miR-220 ↑<br />

miR-221 ↑ ↑ ↑ ↑<br />

miR-222 ↑ ↑ ↑ Poor [57]<br />

miR-223 ↑ ↑<br />

miR-224 ↑<br />

miR-301 ↑<br />

miR-345 ↓<br />

WJG|www.wjgnet.com<br />

miR-375 ↓ ↓<br />

miR-376a ↑<br />

miR-424 ↑<br />

1 Arrows indicate increased (↑) or decreased (↓) expression <strong>of</strong> the specified<br />

miRNA.<br />

duced at the transcriptional level by transforming growth<br />

factor β/Smad, nuclear factor-κB and activator protein-1<br />

family transcription factors through direct interaction with<br />

the miR-155/BIC promoter [46-48] . Further studies have<br />

shown that miR-155 processing also regulates mature<br />

miR-155 expression levels [36,45] , suggesting that overexpression<br />

<strong>of</strong> miR-155 in <strong>cancer</strong> is due to transcriptional activation<br />

and miRNA processing.<br />

miRNA EXPRESSION PROFILE IN<br />

NORMAL PANCREATIC TISSUE AND<br />

PANCREATIC TUMOR<br />

miRNA expression pr<strong>of</strong>iles in pancreatic tumor tissues<br />

are different from those identified in normal pancreas or<br />

in chronic pancreatitis. Most miRNA expression pr<strong>of</strong>ile<br />

analyses show that miRNAs are deregulated in tumor<br />

tissues as compared to normal pancreas, and that the expression<br />

pattern is tissue specific. Several studies focusing<br />

on miRNA expression pr<strong>of</strong>iles in pancreatic tissues have<br />

identified a number <strong>of</strong> differentially expressed miRNAs.<br />

Table 1 summarizes the aberrantly expressed miRNAs in<br />

human pancreatic <strong>cancer</strong> and their association with patient<br />

survival.<br />

Szafranska et al [50] have performed the first comprehensive<br />

miRNA expression pr<strong>of</strong>ile study in tissues from normal<br />

pancreas (n = 7), chronic pancreatitis (n = 7), PDAC<br />

(n = 10) and 33 human tissues <strong>of</strong> different non-pancreatic<br />

origin, to identify miRNA candidates with a potential for<br />

future clinical application from a pool <strong>of</strong> 377 known and<br />

novel miRNAs. The authors have found that two miR-<br />

NAs, miR-216 and miR-217, are pancreas-specific. These<br />

results were in agreement with those <strong>of</strong> two previous<br />

studies [58,59] . Furthermore, both miR-216 and miR-217 are<br />

absent or only minimally expressed in pancreatic carcinoma<br />

tissues and cell lines. Therefore, miR-216 and miR-217<br />

are potential biomarkers. Based upon clustering analysis,<br />

the three pancreatic tissues types can be classified according<br />

to their respective miRNA expression pr<strong>of</strong>iles. Among<br />

26 miRNAs that have been identified as most prominently<br />

deregulated in PDAC, only miR-217 and miR-196a have<br />

been found to discriminate between normal pancreas,<br />

chronic pancreatitis and tumor tissues. These miRNAs are<br />

also potential biomarkers.<br />

Recently, expression <strong>of</strong> 201 miRNA precursors (representing<br />

222 miRNAs) was pr<strong>of</strong>iled in pancreatic adenocarcinoma,<br />

paired with benign tissue, normal pancreas,<br />

chronic pancreatitis and pancreatic <strong>cancer</strong> cell lines with<br />

the real-time PCR miRNA array [49] . These three cell types<br />

could be classified by the clustering algorithm. One hundred<br />

miRNA precursors have been identified as aberrantly<br />

820 February 21, 2011|Volume 17|Issue 7|

---

expressed miRNAs including known ones in other <strong>cancer</strong>s<br />

and novel ones in pancreatic tumor. A list <strong>of</strong> the top 20<br />

aberrantly expressed miRNA precursors has been proposed<br />

as a signature for pancreatic adenocarcinoma.<br />

Bloomston et al [51] have identified a large global expression<br />

pattern <strong>of</strong> miRNAs that can differentiate PDAC<br />

from chronic pancreatitis with 93% accuracy. Among several<br />

deregulated miRNAs in the pancreatic <strong>cancer</strong>s, most<br />

notably, miR-21 and miR-155 are uniquely overexpressed<br />

in pancreatic tumor, as compared to tissues from normal<br />

pancreas and chronic pancreatitis. Both miR-21 and<br />

miR-155 have been suggested to play an important role in<br />

functioning as a proto-oncogene and have been shown to<br />

be overexpressed in several <strong>cancer</strong>s. These authors have<br />

performed an miRNA microarray pr<strong>of</strong>iling with about<br />

1100 miRNA probes, which included 326 human miR-<br />

NAs, using microdissected pancreatic tumor tissues.<br />

Zhang et al [52] have evaluated 95 miRNAs, selected<br />

from pancreatic <strong>cancer</strong> pr<strong>of</strong>iling, and correlated them<br />

to their potential biological functions related to <strong>cancer</strong><br />

biology, cell development, and apoptosis. Among them,<br />

eight miRNAs (miR-196a, miR-190, miR-186, miR-221,<br />

miR-222, miR-200b, miR-15b, and miR-95) are differentially<br />

expressed in most pancreatic <strong>cancer</strong> tissues and<br />

cell lines. All <strong>of</strong> these eight genes are significantly unregulated,<br />

from 3- to 2018-fold, in pancreatic tumors as<br />

compared with normal control samples.<br />

In summary, these pr<strong>of</strong>iling data may provide novel<br />

insights into the miRNA-driven mechanisms involved<br />

in pancreatic carcinogenesis, and <strong>of</strong>fer new potential<br />

targets for early detection and therapeutic strategies in<br />

pancreatic <strong>cancer</strong>.<br />

miRNAS AS BIOMARKERS FOR<br />

PANCREATIC CANCER DIAGNOSIS<br />

Development <strong>of</strong> biomarkers for pancreatic <strong>cancer</strong> is<br />

especially critical because most patients with this disease<br />

remain asymptomatic until the disease progresses to become<br />

locally advanced or develops distant metastases.<br />

Therefore, most <strong>of</strong> these patients are surgically inoperable<br />

at the time <strong>of</strong> diagnosis. Sensitive and specific biomarkers<br />

for pancreatic <strong>cancer</strong> are urgently needed to <strong>of</strong>fer better<br />

therapeutic options and survival outcome.<br />

Over the years, a number <strong>of</strong> protein- and DNAbased<br />

biomarkers have been proposed as markers <strong>of</strong> early<br />

detection for pancreatic <strong>cancer</strong>. However, most <strong>of</strong> these<br />

markers fail to have clinical potential, and they have not<br />

influenced patients’ survival. Since the first discovery <strong>of</strong><br />

miRNAs by Lee et al [11] in 1993, many researchers have<br />

investigated expression pr<strong>of</strong>iles, biological functions and<br />

targets <strong>of</strong> miRNAs in carcinogenesis and tumor progression,<br />

with the purpose <strong>of</strong> translating the results to clinical<br />

settings.<br />

Endoscopic ultrasound-guided fine-needle aspiration<br />

(EUS-FNA) <strong>of</strong> the pancreas is not likely to be used routinely<br />

for screening for PDAC because <strong>of</strong> its invasive na-<br />

WJG|www.wjgnet.com<br />

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

ture. However, this procedure has recently emerged as a<br />

specific and minimally invasive modality for preoperative<br />

diagnosis and staging <strong>of</strong> pancreatic <strong>cancer</strong>. Furthermore,<br />

EUS-FNA may also be useful for screening high-risk<br />

individuals, as well as for the prognosis and predicting<br />

the response to treatment in cases in which the tumor is<br />

inoperable [60-62] . Szafranska et al [63] have identified potential<br />

miRNA markers in EUS-FNA biopsies <strong>of</strong> pancreatic<br />

tissue. The combination <strong>of</strong> expression pattern <strong>of</strong> miR-<br />

196a and miR-217 can differentiate PDAC cases from<br />

healthy controls and chronic pancreatitis in the FNA<br />

samples. Furthermore, miR-196a expression is likely specific<br />

to PDAC cells and is positively associated with the<br />

progression <strong>of</strong> PDAC.<br />

Carcinogenesis in PDAC develops with a multistep<br />

progression from morphologically distinct non-invasive<br />

precursor lesions within exocrine pancreatic ducts [64] .<br />

These precursors include the intraductal papillary mucinous<br />

neoplasms (IPMNs), the mucinous cystic neoplasms,<br />

and pancreatic intraepithelial neoplasia (PanIN). Two<br />

studies have been carried out to detect expression patterns<br />

<strong>of</strong> miRNA in IPMNs and PanIN. IPMNs are grossly<br />

visible, non-invasive, mucin-producing precursors <strong>of</strong><br />

pancreatic <strong>cancer</strong> within the main pancreatic duct or one<br />

<strong>of</strong> its branches [65,66] . In contrast, PanINs are non-invasive,<br />

microscopic epithelial neoplasms, arising within smaller<br />

pancreatic ducts, < 5 mm in diameter, and characterized<br />

by cytological and architectural atypia [65,67] . Habbe et al [68]<br />

have reported significant overexpression <strong>of</strong> 10 miRNAs<br />

in IPMNs (n = 15). miR-155 and miR-21 show the highest<br />

relative fold-changes in the precursor lesions. These<br />

results have been validated by in situ hybridization analysis.<br />

miR-155 and miR-21 are upregulated in most IPMNs [83%<br />

(53/64) and 81% (52/64)] as compared to normal ducts<br />

[7% (4/54) and 2% (1/54)]. With these promising data,<br />

the potential use <strong>of</strong> these miRNAs as biomarkers has<br />

been evaluated in pancreatic juices. A total <strong>of</strong> 15 pancreatic<br />

juice samples from 10 patients with IPMNs, and five<br />

with other pancreatobiliary disorders obtained at the time<br />

<strong>of</strong> surgical resection were measured for relative levels <strong>of</strong><br />

miR-155 and miR-21 by quantitative real-time RT-PCR.<br />

Upregulation <strong>of</strong> both miR-155 and miR-21 in the subset<br />

<strong>of</strong> IPMN-associated pancreatic juices was observed, as<br />

compared with control samples. These results indicate that<br />

aberrant miRNA expression occurs early in the precursor<br />

lesion during the multiple <strong>stage</strong>s <strong>of</strong> pancreatic <strong>cancer</strong><br />

development, and miRNA pr<strong>of</strong>iles may be assessed with<br />

more accessible clinical samples, such as pancreatic juice,<br />

and could be used as a diagnostic tool.<br />

du Rieu et al [69] have investigated miRNAs in PanIN<br />

tissues from a conditional Kras (G12D) mouse model<br />

(n = 29) and from human origin (n = 38). Expression<br />

<strong>of</strong> miR-21, miR-205 and miR-200 has been found to be<br />

positively associated with PanIN progression in the Kras<br />

(G12D) mouse model. In the human tissues, expression<br />

<strong>of</strong> miR-21, miR-221, miR-222 and let-7a increases with<br />

PanIN grade. The authors, using in situ hybridization<br />

analysis, have observed that miR-21 expression is concen-<br />

821 February 21, 2011|Volume 17|Issue 7|

---

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

Table 2 miRNAs and their targets involved in human pancreatic <strong>cancer</strong><br />

miRNA Function Targets Related cellular events Ref.<br />

let-7 Suppress RAS [71]<br />

Inhibit cell proliferation, KRAS expression, and mitogen-activated protein kinase<br />

activation<br />

let-7, miR-200 Suppress Reverse EMT<br />

Let-7a Suppress RAS Attenuate KRAS expression and radiosensitize tumor cell<br />

miR-10a Oncogenic HOXB1, 3 Promote metastatic behavior<br />

miR-21 Oncogenic Induce cell proliferation, invasion, chemoresistance<br />

miR-21 Oncogenic Potentially associated with cell proliferation<br />

miR-200c Suppress Potentially associated with G0/G1 arrest and increased apoptotic rate<br />

miR-21,<br />

miR-221<br />

trated in the dysplastic ductal epithelial cells. Using PDACderived<br />

cell lines, they also have noted that miR-21 expression<br />

is regulated by Kras (G12D) and epidermal growth<br />

factor receptor (EGFR).<br />

Wang et al [70] have studied plasma samples from patients<br />

with PDAC and have found that four miRNAs<br />

(miR-21, miR-210, miR-155 and miR-196a) are able to differentiate<br />

pancreatic <strong>cancer</strong> patients from healthy controls,<br />

with moderate accuracy (sensitivity: 64%, and specificity:<br />

89%). In summary, these studies suggest a potential value<br />

<strong>of</strong> miRNAs in the clinical setting as a potential diagnostic<br />

tool for PDAC.<br />

miRNAS AS ONCOGENES AND TUMOR<br />

SUPPRESSORS<br />

Oncogenic PTEN, RECK,<br />

CDKN1B<br />

miRNAs are functionally classified into oncogenes or tumor<br />

suppressors based upon their targets, thus binding to<br />

oncogenes or tumor suppressor genes. Therefore, oncogenic<br />

miRNAs are upregulated in tumors, whereas tumor<br />

suppressor miRNAs are downregulated. The functions<br />

and targets <strong>of</strong> a handful <strong>of</strong> miRNAs have been investigated<br />

in pancreatic <strong>cancer</strong> (Table 2).<br />

Torrisani et al [53] have reported that tumor suppressor<br />

let-7 miRNA is expressed in normal acinar pancreatic<br />

cells, but is extensively downregulated in PDAC samples,<br />

as compared with adjacent non-involved tissues. Transfection<br />

<strong>of</strong> pancreatic <strong>cancer</strong> cell lines with let-7 miRNA<br />

inhibits cell proliferation, Kras expression, and mitogenactivated<br />

protein kinase activation. This study has demonstrated<br />

that intracellular restoration <strong>of</strong> let-7 miRNA<br />

reverts neoplastic characteristics <strong>of</strong> PDAC, suggesting<br />

that let-7 miRNA functions as a tumor suppressor in pan-<br />

WJG|www.wjgnet.com<br />

Arrest cell cycle, induce apoptosis, and sensitize the effects <strong>of</strong> gemcitabine with<br />

inhibition <strong>of</strong> miR-21 or -221<br />

miR-22 Suppress SP1, ESR1 Potentially inhibit tumorigenesis<br />

miR-34 Suppress BCL2, NOTCH1/2 Inhibit clonogenic cell growth and invasion, induce apoptosis and G1 and G2/M<br />

arrest in cell cycle, sensitize to chemotherapy and radiation, and potentially inhibit<br />

pancreatic <strong>cancer</strong> stem cells<br />

miR-107 Suppress CDK6 Induce in vitro cell growth downregulation<br />

miR-155 Oncogenic TP53INP1 Inhibit apoptosis<br />

miR-194, miR-200b,<br />

miR-200c, miR-429<br />

Oncogenic EP300 Potentially promote metastatic behavior<br />

miR-224, miR-486 Oncogenic CD40 Potentially associated with invasion and metastasis<br />

BCL2: B-cell CLL/lymphoma 2; CD40: CD40 molecule; CDK6: Cyclin-dependent kinase 6; CDKN1B: Cyclin-dependent kinase inhibitor 1B; EP300: E1A<br />

binding protein p300; ESR1: Estrogen receptor 1; HOXB1, 3: Homeobox B1, 3; KRAS: v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog; NOTCH1/2:<br />

Notch 1/2; PTEN: Phosphatase and tensin homolog; RECK: Reversion-inducing-cysteine-rich protein with kazal motifs; SP1: Sp1 transcription factor;<br />

TP53INP1: Tumor protein p53 inducible nuclear protein 1; EMT: Epithelial-to-mesenchymal transition.<br />

creatic <strong>cancer</strong>. In addition, the results <strong>of</strong> this study suggest<br />

let-7 miRNA as a replacement therapy for pancreatic<br />

<strong>cancer</strong>.<br />

miRNAS AS THERAPEUTIC TARGETS IN<br />

PANCREATIC CANCER<br />

Most epithelial tumors, including pancreatic <strong>cancer</strong>, are<br />

believed to progress toward loss <strong>of</strong> epithelial differentiation<br />

and acquisition <strong>of</strong> a mesenchymal phenotype that<br />

leads to enhanced <strong>cancer</strong> cell invasion and migration [82,83] .<br />

The aggressiveness <strong>of</strong> pancreatic <strong>cancer</strong> is, in part, due to<br />

its drug resistance characteristics, which are also associated<br />

with the epithelial-to-mesenchymal transition (EMT). Several<br />

studies have shown that the events leading to EMT<br />

are regulated by miRNAs [84-89] . Li et al [72] have investigated<br />

the effects <strong>of</strong> let-7 and miR-200 on the morphological<br />

changes <strong>of</strong> EMT in gemcitabine-resistant pancreatic <strong>cancer</strong><br />

cells (GRPCCs). They have found that: (1) the expression<br />

<strong>of</strong> miR-200 and let-7 is significantly downregulated<br />

in GRPCCs, which have EMT characteristics; and (2)<br />

transfection <strong>of</strong> GRPCCs with miR-200 rescues the epithelial<br />

phenotype by upregulating the epithelial marker<br />

E-cadherin and downregulating the mesenchymal markers<br />

ZEB1 and vimentin. These authors also have demonstrated<br />

that tumor cell sensitivity to gemcitabine is increased<br />

after re-expression <strong>of</strong> miR-200b. These results suggest<br />

that EMT could be regulated by miRNAs, and provide a<br />

potential strategy for treatment.<br />

RAS mutations are frequent in human tumors and are<br />

known to be one <strong>of</strong> the responsible factors for radiationinduced<br />

cell death [90,91] . Using transfection <strong>of</strong> Lin28 siR-<br />

NA into pancreatic <strong>cancer</strong> cells harboring Kras mutation,<br />

822 February 21, 2011|Volume 17|Issue 7|<br />

[53]<br />

[72]<br />

[73]<br />

[54]<br />

[56]<br />

[74]<br />

[75]<br />

[76]<br />

[77]<br />

[78]<br />

[79]<br />

[80]<br />

[81]

---

Oh et al [73] have shown that upregulation with let-7a results<br />

in attenuated expression <strong>of</strong> Kras and increased radiosensitization<br />

<strong>of</strong> pancreatic <strong>cancer</strong> cells. This suggests that<br />

miRNA could be used as a valuable therapeutic option in<br />

radioresistant tumors that have Kras mutations.<br />

The main reason for poor survival in pancreatic <strong>cancer</strong><br />

is the presence <strong>of</strong> metastasis at the time <strong>of</strong> diagnosis.<br />

Weiss et al [54] have shown that miR-10a expression promoted<br />

metastasis, and repression <strong>of</strong> miR-10a inhibited<br />

invasion and metastasis in xenotransplantation experiments<br />

using zebrafish embryos. They have further identified<br />

tumor suppressors HOXB1 and HOXB3 as targets<br />

<strong>of</strong> miR-10a, and have reported that retinoic acid receptor<br />

antagonists inhibit miR-10a expression and suppress metastasis.<br />

These data suggest new therapeutic applications<br />

for miRNA in patients with metastatic pancreatic <strong>cancer</strong>.<br />

Several studies have reported significant overexpression<br />

<strong>of</strong> miR-21 in pancreatic tumors [49,51] , suggesting the potential<br />

role <strong>of</strong> miR-21 in pancreatic <strong>cancer</strong>. Moriyama et al [56]<br />

have confirmed that miR-21 is overexpressed in pancreatic<br />

<strong>cancer</strong> cells. They also have observed that miR-21 contributes<br />

to cell proliferation, invasion, and chemoresistance.<br />

They also have found that mRNA expression <strong>of</strong> invasionrelated<br />

genes, matrix metalloproteinase (MMP)-2 and<br />

MMP-9, and vascular endothelial growth factor is positively<br />

correlated with miR-21 expression. The above studies<br />

show that miR-21 functions as an oncogene, and that it is<br />

involved in pancreatic <strong>cancer</strong> chemoresistance. Therefore,<br />

miR-21 could be a target for a therapeutic strategy for patients<br />

with chemoresistant pancreatic <strong>cancer</strong>.<br />

Zhang et al [74] have found that pancreatic <strong>cancer</strong> cells<br />

treated with trichostatin A (TSA), one <strong>of</strong> the common<br />

histone deacetylase inhibitors [92,93] , are arrested in G0/G1<br />

phase, and exhibit an increased in apoptotic rate. The<br />

treatment also induces downregulation <strong>of</strong> miR-21 and<br />

upregulation <strong>of</strong> miR-200c. The data support the oncogenic<br />

function <strong>of</strong> miR-21, and the tumor suppressor<br />

function <strong>of</strong> miR-200, suggesting that epigenetic regulation<br />

<strong>of</strong> miRNAs with histone deacetylase inhibitor could<br />

be used as a therapeutic option in pancreatic <strong>cancer</strong>.<br />

It has been shown that antisense oligonucleotides<br />

(ASOs) can inhibit upregulated miRNAs in tumors [94] .<br />

Park et al [75] have investigated miR-21 and miR-221 biological<br />

function using ASOs in pancreatic <strong>cancer</strong>. ASOs for<br />

miR-21 and miR-221 both reduce proliferation <strong>of</strong> pancreatic<br />

<strong>cancer</strong> cell lines, increase apoptosis by 3-6-fold, and<br />

induced G1 arrest. ASOs also increase the levels <strong>of</strong> the<br />

miR-21 targets PTEN and RECK, and the miR-221 target,<br />

CDKN1B, at the protein level. The authors have found<br />

that ASO targeting <strong>of</strong> miR-21 and miR-221 sensitizes<br />

tumor cells to the effects <strong>of</strong> gemcitabine, and that ASOgemcitabine<br />

combination treatments generate synergistic<br />

antiproliferative effects in pancreatic <strong>cancer</strong> cells. These<br />

results imply that targeting miRNAs with ASOs could be a<br />

potential new therapeutic strategy for pancreatic <strong>cancer</strong>.<br />

In vitro and in vivo studies have reported the anti<strong>cancer</strong><br />

activity, with low toxicity, <strong>of</strong> curcumin (diferuloylmethane)<br />

[95,96] , a naturally occurring flavonoid from the rhizome<br />

<strong>of</strong> Curcuma longa [97,98] . Sun et al [76] have investigated whether<br />

WJG|www.wjgnet.com<br />

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

curcumin affects the expression pr<strong>of</strong>iles <strong>of</strong> miRNAs in<br />

pancreatic <strong>cancer</strong>, and have reported overexpression <strong>of</strong><br />

miR-22 and downregulation <strong>of</strong> miR-199a* in pancreatic<br />

<strong>cancer</strong> cells treated with curcumin. The predicted target<br />

genes <strong>of</strong> miRNA-22 are Sp1 transcription factor (SP1)<br />

and estrogen receptor 1 (ESR1). The expression <strong>of</strong> these<br />

genes (SP1 and ESR1), which are involved in cell growth,<br />

metastasis and apoptosis, is suppressed by upregulation<br />

<strong>of</strong> miR-22. Thus, Sun et al have suggested that one <strong>of</strong> the<br />

important anti<strong>cancer</strong> mechanisms <strong>of</strong> curcumin is modulation<br />

<strong>of</strong> miRNA expression, such as miR-22.<br />

Some <strong>cancer</strong> stem cells are involved in tumor initiation,<br />

self-renewal and survival [99] , and miRNAs have been<br />

shown to have critical roles in <strong>cancer</strong> stem cell differentiation.<br />

Ji et al [77] , using cell sorting <strong>of</strong> CD44 + /CD133 + , have<br />

examined the roles <strong>of</strong> miR-34 in p53-mutant human pancreatic<br />

<strong>cancer</strong> cell lines, to find a potential link between<br />

stem cells and pancreatic <strong>cancer</strong>. These authors have observed<br />

that miR-34 upregulation results in significant inhibition<br />

<strong>of</strong> clonogenic growth and cell invasion, induction<br />

<strong>of</strong> apoptosis, G1 and G2/M cell cycle arrest, and sensitization<br />

<strong>of</strong> the cells to chemotherapy and radiation. They<br />

also have detected an 87% reduction in tumor initiating<br />

cells (or <strong>cancer</strong> stem cells), which was mediated by downregulation<br />

<strong>of</strong> its downstream targets BCL2 and NOTCH.<br />

This study has shown that restoration <strong>of</strong> miR-34 could<br />

have significant promise as a novel molecular therapy for<br />

human pancreatic <strong>cancer</strong> via inhibiting pancreatic <strong>cancer</strong><br />

stem cell differentiation.<br />

Aberrations in epigenetic regulation are common<br />

in human <strong>cancer</strong>s, and tumor suppressor genes are frequently<br />

silenced by this mechanism in nearly all malignancies<br />

[100,101] . Recent studies have shown that subsets <strong>of</strong><br />

miRNAs are also silenced by the same mechanism [102,103] .<br />

For example, Lee et al [78] have shown that miR-107 is<br />

silenced by promoter DNA methylation in pancreatic tumors.<br />

These authors treated human pancreatic <strong>cancer</strong> cell<br />

lines with the demethylating agent, 5-aza-2’-deoxycytidine<br />

or the histone deacetylase inhibitor, TSA, or with a combination<br />

<strong>of</strong> the two, and identified the upregulation <strong>of</strong><br />

14 miRNAs, including miR-107. Retroviral expression <strong>of</strong><br />

miR-107 in pancreatic <strong>cancer</strong> cells downregulates in vitro<br />

cell growth by repressing cyclin-dependent kinase 6, a<br />

putative miR-107 target. This study shows that epigenetic<br />

mechanisms <strong>of</strong> miRNA may be involved in pancreatic<br />

carcinogenesis.<br />

Tumor protein p53 inducible nuclear protein 1 (TP53-<br />

INP1) is a pro-apoptotic stress-induced gene. TP53 is able<br />

to activate TP53INP1 transcription as a target [104,105] . However,<br />

overexpression <strong>of</strong> TP53INP1 induces cell cycle arrest<br />

and apoptosis in vitro, independently from TP53. Gironella<br />

et al [79] have reported that TP53INP1 is expressed<br />

in normal tissues but is markedly downregulated or lost in<br />

early <strong>stage</strong>s <strong>of</strong> pancreatic <strong>cancer</strong> development. TP53INP1<br />

repression by transfection <strong>of</strong> miR-155 causes loss or significant<br />

decrease in expression <strong>of</strong> TP53INP1. These data<br />

suggest that TP53INP1 is an additional potential target <strong>of</strong><br />

miR-155.<br />

Several studies have suggested that EP300 may func-<br />

823 February 21, 2011|Volume 17|Issue 7|

---

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

tion as a tumor suppressor. This gene is located on chromosome<br />

22q; a region known for its frequent loss <strong>of</strong><br />

heterozygosity in different <strong>cancer</strong>s, including pancreatic<br />

<strong>cancer</strong> [106-109] . Mees et al [80] have classified 16 human PDAC<br />

cell lines into three hierarchical groups according to their<br />

metastatic potential, and have pr<strong>of</strong>iled their mRNA and<br />

miRNA expression. The highly metastatic PDAC cell<br />

lines, when compared to the non-metastatic cell lines,<br />

have shown decreased mRNA and protein expression<br />

<strong>of</strong> EP300, which is related to significant upregulation <strong>of</strong><br />

EP300-targeting miRNAs (miR-194, miR-200b, miR-200c<br />

and miR-429). Using the same 16 human PDAC cell lines,<br />

these authors have found markedly reduced expression<br />

<strong>of</strong> CD40 protein, which is involved in the host antitumor<br />

immune response [110,111] . CD40-targeting miR-224<br />

and miR-486 are upregulated in the highly invasive and<br />

metastatic PDAC [81] . These results show that miRNAs are<br />

involved in regulating the metastatic behavior <strong>of</strong> PDAC,<br />

and in modulating metastasis-specific tumor suppressor<br />

genes. Targeting <strong>of</strong> these miRNAs may have potential<br />

therapeutic value in PDAC.<br />

miRNAS AS CLINICAL ASPECTS IN<br />

PANCREATIC CANCER<br />

Most tumors show deregulation <strong>of</strong> miRNAs for the initiation<br />

and progression <strong>of</strong> human <strong>cancer</strong>, therefore, many<br />

researchers have been trying to exploit these miRNAs for<br />

therapeutic applications, and to develop novel therapies<br />

for human <strong>cancer</strong> [112-115] . Thus, oncogenic miRNAs can<br />

be suppressed with ASOs to their precursor or mature<br />

forms [94,116] , and tumor suppressor miRNAs can be upregulated<br />

[53,72] .<br />

Numerous miRNA studies have demonstrated that<br />

miRNA-directed targeting therapy has therapeutic potential<br />

in human <strong>cancer</strong>. Recent studies have further<br />

demonstrated synergistic effects when miRNA-directed<br />

therapy is used in combination with conventional chemotherapy<br />

or radiotherapy for pancreatic <strong>cancer</strong> [73,75] .<br />

However, currently, there is no miRNA that is used in<br />

the clinical setting for treatment <strong>of</strong> <strong>cancer</strong> patients. Significant<br />

work needs to be done before miRNA-directed<br />

therapeutic strategies can be applied. However, current<br />

data have shown encouraging preliminary results to support<br />

their clinical applications in human <strong>cancer</strong>.<br />

Several investigators have attempted to utilize miR-<br />

NA expression pr<strong>of</strong>iles as a diagnostic tool to differentiate<br />

tumors from normal tissues [43,117,118] , and as predictors<br />

<strong>of</strong> clinical outcome. However, there have not been<br />

sufficient studies that have investigated the correlation<br />

between alterations in miRNA expression and patient<br />

outcome in PDAC.<br />

A few miRNA expression patterns have been investigated<br />

to predict prognostic outcome from specimens <strong>of</strong><br />

patients with pancreatic <strong>cancer</strong> [51,55,57] . Bloomston et al [51]<br />

have analyzed the association between survival <strong>of</strong> patients<br />

and miRNA expression patterns. In the subgroup<br />

analysis <strong>of</strong> patients with lymph-node positive disease, a<br />

WJG|www.wjgnet.com<br />

panel <strong>of</strong> six miRNAs (miR-452, miR-105, miR-127, miR-<br />

518a-2, miR-187 and miR-30a-3p) was able to differentiate<br />

between long-term survivors and short-term survivors<br />

who died within 2 years. Furthermore, high expression<br />

<strong>of</strong> miR-196a-2 is associated with poor outcome; patients<br />

with high miR-196a-2 expression have a shorter median<br />

survival <strong>of</strong> 14.3 mo when compared with patients with<br />

low miR-196a-2 expression, who have a median survival<br />

<strong>of</strong> 26.5 mo.<br />

Dillh<strong>of</strong>f et al [55] have performed in situ hybridization<br />

after microdissection and tissue microarray analysis <strong>of</strong> 80<br />

resected pancreatic <strong>cancer</strong> specimens, and found 79% <strong>of</strong><br />

the pancreatic <strong>cancer</strong> samples, 27% <strong>of</strong> the chronic pancreatitis<br />

samples, and 8% <strong>of</strong> the normal pancreatic samples<br />

had positive miR-21 expression. Among the subset <strong>of</strong><br />

patients with node-negative disease, high miR-21 expression<br />

resulted in poorer survival than in patients with low<br />

miR-21 expression (median: 27.7 mo vs 15.2 mo, P = 0.037),<br />

although miR-21 expression did not correlate with tumor<br />

size, differentiation, nodal status, or T <strong>stage</strong>.<br />

Greither et al [57] have measured the levels <strong>of</strong> miR-155,<br />

miR-203, miR-210, miR-216, miR-217 and miR-222,<br />

which are known to be differentially expressed in pancreatic<br />

tumors. From 56 microdissected PDACs, they found<br />

that elevated levels <strong>of</strong> miR-155, miR-203, miR-210 and<br />

miR-222 were associated with poorer overall survival<br />

rates. They further noted that higher expression <strong>of</strong> all<br />

four miRNAs had a 6.2-fold increased risk <strong>of</strong> tumorrelated<br />

death as compared to cases in which the expression<br />

<strong>of</strong> these miRNAs was low.<br />

CONCLUSION<br />

Since the discovery <strong>of</strong> miRNAs, growing evidence has<br />

confirmed a link between miRNAs and malignant diseases,<br />

and has identified their functions and targets that<br />

affect the complex process <strong>of</strong> carcinogenesis. Like other<br />

malignant tumors, PDAC has its unique miRNA expression<br />

patterns, which are different from those <strong>of</strong> other human<br />

tumors, and are able to differentiate normal pancreas<br />

from benign inflammatory pancreatic tissues and pancreatic<br />

<strong>cancer</strong>. At present, several important oncogenic and<br />

tumor suppressor miRNAs, and their molecular targets,<br />

have been identified in PDAC. More importantly, this<br />

information will lead to new development <strong>of</strong> prognostic,<br />

diagnostic, and treatment strategies. However, additional<br />

studies are required to find ways to utilize miRNAs as a<br />

therapeutic target in the clinical setting.<br />

REFERENCES<br />

1 Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA<br />

Cancer J Clin 2010; 60: 277-300<br />

2 Li D, Xie K, Wolff R, Abbruzzese JL. Pancreatic <strong>cancer</strong>. Lancet<br />

2004; 363: 1049-1057<br />

3 Garcea G, Neal CP, Pattenden CJ, Steward WP, Berry DP.<br />

Molecular prognostic markers in pancreatic <strong>cancer</strong>: a systematic<br />

review. Eur J Cancer 2005; 41: 2213-2236<br />

4 Takaori K. Current understanding <strong>of</strong> precursors to pancreatic<br />

<strong>cancer</strong>. J Hepatobiliary Pancreat Surg 2007; 14: 217-223<br />

824 February 21, 2011|Volume 17|Issue 7|

---

5 Bardeesy N, DePinho RA. Pancreatic <strong>cancer</strong> biology and<br />

genetics. Nat Rev Cancer 2002; 2: 897-909<br />

6 Goggins M. Molecular markers <strong>of</strong> early pancreatic <strong>cancer</strong>. J<br />

Clin Oncol 2005; 23: 4524-4531<br />

7 Goggins M, Kern SE, Offerhaus JA, Hruban RH. Progress in<br />

<strong>cancer</strong> genetics: lessons from pancreatic <strong>cancer</strong>. Ann Oncol<br />

1999; 10 Suppl 4: 4-8<br />

8 Sakorafas GH, Tsiotou AG. Multi-step pancreatic carcinogenesis<br />

and its clinical implications. Eur J Surg Oncol 1999;<br />

25: 562-565<br />

9 Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim<br />

LP, Burge CB, Bartel DP. The widespread impact <strong>of</strong> mammalian<br />

MicroRNAs on mRNA repression and evolution.<br />

Science 2005; 310: 1817-1821<br />

10 Ambros V. The functions <strong>of</strong> animal microRNAs. Nature<br />

2004; 431: 350-355<br />

11 Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic<br />

gene lin-4 encodes small RNAs with antisense complementarity<br />

to lin-14. Cell 1993; 75: 843-854<br />

12 Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda<br />

MI, Maller B, Hayward DC, Ball EE, Degnan B, Muller<br />

P, Spring J, Srinivasan A, Fishman M, Finnerty J, Corbo J,<br />

Levine M, Leahy P, Davidson E, Ruvkun G. Conservation <strong>of</strong><br />

the sequence and temporal expression <strong>of</strong> let-7 heterochronic<br />

regulatory RNA. Nature 2000; 408: 86-89<br />

13 Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad<br />

O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y,<br />

Bentwich Z. Identification <strong>of</strong> hundreds <strong>of</strong> conserved and nonconserved<br />

human microRNAs. Nat Genet 2005; 37: 766-770<br />

14 Sanger. Sanger miRBase. 2010 [cited April 2010]. Available<br />

from: URL: http://www.mirbase.org/index.shtml<br />

15 Cai X, Hagedorn CH, Cullen BR. Human microRNAs are<br />

processed from capped, polyadenylated transcripts that can<br />

also function as mRNAs. RNA 2004; 10: 1957-1966<br />

16 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P,<br />

Radmark O, Kim S, Kim VN. The nuclear RNase III Drosha<br />

initiates microRNA processing. Nature 2003; 425: 415-419<br />

17 Han J, Lee Y, Yeom KH, Kim YK, Jin H, Kim VN. The<br />

Drosha-DGCR8 complex in primary microRNA processing.<br />

Genes Dev 2004; 18: 3016-3027<br />

18 Tang G. siRNA and miRNA: an insight into RISCs. Trends<br />

Biochem Sci 2005; 30: 106-114<br />

19 Lewis BP, Burge CB, Bartel DP. Conserved seed pairing,<br />

<strong>of</strong>ten flanked by adenosines, indicates that thousands <strong>of</strong> human<br />

genes are microRNA targets. Cell 2005; 120: 15-20<br />

20 Muckstein U, Tafer H, Hackermuller J, Bernhart SH, Stadler<br />

PF, H<strong>of</strong>acker IL. Thermodynamics <strong>of</strong> RNA-RNA binding.<br />

Bioinformatics 2006; 22: 1177-1182<br />

21 Negrini M, Ferracin M, Sabbioni S, Croce CM. MicroRNAs<br />

in human <strong>cancer</strong>: from research to therapy. J Cell Sci 2007;<br />

120: 1833-1840<br />

22 Shomron N. MicroRNAs and their antagonists as novel<br />

therapeutics. Eur J Cancer 2009; 45 Suppl 1: 388-390<br />

23 Didiano D, Hobert O. Perfect seed pairing is not a generally<br />

reliable predictor for miRNA-target interactions. Nat Struct<br />

Mol Biol 2006; 13: 849-851<br />

24 Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim<br />

LP, Bartel DP. MicroRNA targeting specificity in mammals:<br />

determinants beyond seed pairing. Mol Cell 2007; 27: 91-105<br />

25 Long D, Lee R, Williams P, Chan CY, Ambros V, Ding Y.<br />

Potent effect <strong>of</strong> target structure on microRNA function. Nat<br />

Struct Mol Biol 2007; 14: 287-294<br />

26 Kertesz M, Iovino N, Unnerstall U, Gaul U, Segal E. The<br />

role <strong>of</strong> site accessibility in microRNA target recognition. Nat<br />

Genet 2007; 39: 1278-1284<br />

27 Huang JC, Babak T, Corson TW, Chua G, Khan S, Gallie BL,<br />

Hughes TR, Blencowe BJ, Frey BJ, Morris QD. Using expression<br />

pr<strong>of</strong>iling data to identify human microRNA targets.<br />

Nat Methods 2007; 4: 1045-1049<br />

28 Gottwein E, Mukherjee N, Sachse C, Frenzel C, Majoros<br />

WJG|www.wjgnet.com<br />

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

WH, Chi JT, Braich R, Manoharan M, Soutschek J, Ohler U,<br />

Cullen BR. A viral microRNA functions as an orthologue <strong>of</strong><br />

cellular miR-155. Nature 2007; 450: 1096-1099<br />

29 Skalsky RL, Samols MA, Plaisance KB, Boss IW, Riva A,<br />

Lopez MC, Baker HV, Renne R. Kaposi's sarcoma-associated<br />

herpesvirus encodes an ortholog <strong>of</strong> miR-155. J Virol 2007; 81:<br />

12836-12845<br />

30 Tavazoie SF, Alarcón C, Oskarsson T, Padua D, Wang Q, Bos<br />

PD, Gerald WL, Massagué J. Endogenous human microR-<br />

NAs that suppress breast <strong>cancer</strong> metastasis. Nature 2008; 451:<br />

147-152<br />

31 Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D,<br />

Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing<br />

JR, Jacks T, Horvitz HR, Golub TR. MicroRNA expression<br />

pr<strong>of</strong>iles classify human <strong>cancer</strong>s. Nature 2005; 435: 834-838<br />

32 Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch<br />

E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps<br />

T, Negrini M, Bullrich F, Croce CM. Frequent deletions and<br />

down-regulation <strong>of</strong> micro- RNA genes miR15 and miR16 at<br />

13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci<br />

USA 2002; 99: 15524-15529<br />

33 Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu<br />

M, Wojcik SE, Aqeilan RI, Zupo S, Dono M, Rassenti L,<br />

Alder H, Volinia S, Liu CG, Kipps TJ, Negrini M, Croce CM.<br />

miR-15 and miR-16 induce apoptosis by targeting BCL2.<br />

Proc Natl Acad Sci USA 2005; 102: 13944-13949<br />

34 Metzler M, Wilda M, Busch K, Viehmann S, Borkhardt A.<br />

High expression <strong>of</strong> precursor microRNA-155/BIC RNA in<br />

children with Burkitt lymphoma. Genes Chromosomes Cancer<br />

2004; 39: 167-169<br />

35 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H,<br />

Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, Mitsudomi<br />

T, Takahashi T. Reduced expression <strong>of</strong> the let-7 microR-<br />

NAs in human lung <strong>cancer</strong>s in association with shortened<br />

postoperative survival. Cancer Res 2004; 64: 3753-3756<br />

36 Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund<br />

E, Dahlberg JE. Accumulation <strong>of</strong> miR-155 and BIC RNA in<br />

human B cell lymphomas. Proc Natl Acad Sci USA 2005; 102:<br />

3627-3632<br />

37 He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D,<br />

Goodson S, Powers S, Cordon-Cardo C, Lowe SW, Hannon<br />

GJ, Hammond SM. A microRNA polycistron as a potential<br />

human oncogene. Nature 2005; 435: 828-833<br />

38 Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni<br />

S, Magri E, Pedriali M, Fabbri M, Campiglio M, Ménard<br />

S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I,<br />

Calin GA, Querzoli P, Negrini M, Croce CM. MicroRNA<br />

gene expression deregulation in human breast <strong>cancer</strong>. Cancer<br />

Res 2005; 65: 7065-7070<br />

39 Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K,<br />

Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin<br />

GA, Liu CG, Croce CM, Harris CC. Unique microRNA molecular<br />

pr<strong>of</strong>iles in lung <strong>cancer</strong> diagnosis and prognosis. Cancer<br />

Cell 2006; 9: 189-198<br />

40 Calin GA, Croce CM. MicroRNA signatures in human <strong>cancer</strong>s.<br />

Nat Rev Cancer 2006; 6: 857-866<br />

41 Cummins JM, Velculescu VE. Implications <strong>of</strong> micro-RNA<br />

pr<strong>of</strong>iling for <strong>cancer</strong> diagnosis. Oncogene 2006; 25: 6220-6227<br />

42 Dalmay T, Edwards DR. MicroRNAs and the hallmarks <strong>of</strong><br />

<strong>cancer</strong>. Oncogene 2006; 25: 6170-6175<br />

43 Tricoli JV, Jacobson JW. MicroRNA: Potential for Cancer<br />

Detection, Diagnosis, and Prognosis. Cancer Res 2007; 67:<br />

4553-4555<br />

44 Deng S, Calin GA, Croce CM, Coukos G, Zhang L. Mechanisms<br />

<strong>of</strong> microRNA deregulation in human <strong>cancer</strong>. Cell Cycle<br />

2008; 7: 2643-2646<br />

45 Kluiver J, van den Berg A, de Jong D, Blokzijl T, Harms<br />

G, Bouwman E, Jacobs S, Poppema S, Kroesen BJ. Regulation<br />

<strong>of</strong> pri-microRNA BIC transcription and processing in<br />

Burkitt lymphoma. Oncogene 2007; 26: 3769-3776<br />

825 February 21, 2011|Volume 17|Issue 7|

---

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

46 O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore<br />

D. MicroRNA-155 is induced during the macrophage<br />

inflammatory response. Proc Natl Acad Sci USA 2007; 104:<br />

1604-1609<br />

47 Kong W, Yang H, He L, Zhao JJ, Coppola D, Dalton WS,<br />

Cheng JQ. MicroRNA-155 is regulated by the transforming<br />

growth factor beta/Smad pathway and contributes to epithelial<br />

cell plasticity by targeting RhoA. Mol Cell Biol 2008;<br />

28: 6773-6784<br />

48 Yin Q, Wang X, McBride J, Fewell C, Flemington E. B-cell<br />

receptor activation induces BIC/miR-155 expression through<br />

a conserved AP-1 element. J Biol Chem 2008; 283: 2654-2662<br />

49 Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel<br />

WL, Morgan DL, Postier RG, Brackett DJ, Schmittgen TD.<br />

Expression pr<strong>of</strong>iling identifies microRNA signature in pancreatic<br />

<strong>cancer</strong>. Int J Cancer 2007; 120: 1046-1054<br />

50 Szafranska AE, Davison TS, John J, Cannon T, Sipos B,<br />

Maghnouj A, Labourier E, Hahn SA. MicroRNA expression<br />

alterations are linked to tumorigenesis and non-neoplastic<br />

processes in pancreatic ductal adenocarcinoma. Oncogene<br />

2007; 26: 4442-4452<br />

51 Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H,<br />

Hagan JP, Liu CG, Bhatt D, Taccioli C, Croce CM. MicroR-<br />

NA expression patterns to differentiate pancreatic adenocarcinoma<br />

from normal pancreas and chronic pancreatitis.<br />

JAMA 2007; 297: 1901-1908<br />

52 Zhang Y, Li M, Wang H, Fisher WE, Lin PH, Yao Q, Chen<br />

C. Pr<strong>of</strong>iling <strong>of</strong> 95 microRNAs in pancreatic <strong>cancer</strong> cell lines<br />

and surgical specimens by real-time PCR analysis. <strong>World</strong> J<br />

Surg 2009; 33: 698-709<br />

53 Torrisani J, Bournet B, du Rieu MC, Bouisson M, Souque A,<br />

Escourrou J, Buscail L, Cordelier P. let-7 MicroRNA transfer<br />

in pancreatic <strong>cancer</strong>-derived cells inhibits in vitro cell proliferation<br />

but fails to alter tumor progression. Hum Gene Ther<br />

2009; 20: 831-844<br />

54 Weiss FU, Marques IJ, Woltering JM, Vlecken DH, Aghdassi<br />

A, Partecke LI, Heidecke CD, Lerch MM, Bagowski<br />

CP. Retinoic acid receptor antagonists inhibit miR-10a expression<br />

and block metastatic behavior <strong>of</strong> pancreatic <strong>cancer</strong>.<br />

Gastroenterology 2009; 137: 2136-2145.e1-7<br />

55 Dillh<strong>of</strong>f M, Liu J, Frankel W, Croce C, Bloomston M. MicroR-<br />

NA-21 is overexpressed in pancreatic <strong>cancer</strong> and a potential<br />

predictor <strong>of</strong> survival. J Gastrointest Surg 2008; 12: 2171-2176<br />

56 Moriyama T, Ohuchida K, Mizumoto K, Yu J, Sato N, Nabae<br />

T, Takahata S, Toma H, Nagai E, Tanaka M. MicroR-<br />

NA-21 modulates biological functions <strong>of</strong> pancreatic <strong>cancer</strong><br />

cells including their proliferation, invasion, and chemoresistance.<br />

Mol Cancer Ther 2009; 8: 1067-1074<br />

57 Greither T, Grochola LF, Udelnow A, Lautenschläger C,<br />

Würl P, Taubert H. Elevated expression <strong>of</strong> microRNAs 155,<br />

203, 210 and 222 in pancreatic tumors is associated with<br />

poorer survival. Int J Cancer 2010; 126: 73-80<br />

58 Sood P, Krek A, Zavolan M, Macino G, Rajewsky N. Celltype-specific<br />

signatures <strong>of</strong> microRNAs on target mRNA<br />

expression. Proc Natl Acad Sci USA 2006; 103: 2746-2751<br />

59 Baskerville S, Bartel DP. Microarray pr<strong>of</strong>iling <strong>of</strong> microR-<br />

NAs reveals frequent coexpression with neighboring miR-<br />

NAs and host genes. RNA 2005; 11: 241-247<br />

60 Eloubeidi MA, Jhala D, Chhieng DC, Chen VK, Eltoum I,<br />

Vickers S, Mel Wilcox C, Jhala N. Yield <strong>of</strong> endoscopic ultrasound-guided<br />

fine-needle aspiration biopsy in patients with<br />

suspected pancreatic carcinoma. Cancer 2003; 99: 285-292<br />

61 Jhala NC, Jhala D, Eltoum I, Vickers SM, Wilcox CM,<br />

Chhieng DC, Eloubeidi MA. Endoscopic ultrasound-guided<br />

fine-needle aspiration biopsy: a powerful tool to obtain<br />

samples from small lesions. Cancer 2004; 102: 239-246<br />

62 Chen Y, Zheng B, Robbins DH, Lewin DN, Mikhitarian K,<br />

Graham A, Rumpp L, Glenn T, Gillanders WE, Cole DJ, Lu<br />

X, H<strong>of</strong>fman BJ, Mitas M. Accurate discrimination <strong>of</strong> pancreatic<br />

ductal adenocarcinoma and chronic pancreatitis using<br />

WJG|www.wjgnet.com<br />

multimarker expression data and samples obtained by minimally<br />

invasive fine needle aspiration. Int J Cancer 2007; 120:<br />

1511-1517<br />

63 Szafranska AE, Doleshal M, Edmunds HS, Gordon S, Luttges<br />

J, Munding JB, Barth RJ Jr, Gutmann EJ, Suriawinata AA,<br />

Marc Pipas J, Tannapfel A, Korc M, Hahn SA, Labourier<br />

E, Tsongalis GJ. Analysis <strong>of</strong> microRNAs in pancreatic fineneedle<br />

aspirates can classify benign and malignant tissues.<br />

Clin Chem 2008; 54: 1716-1724<br />

64 Hruban RH, Maitra A, Kern SE, Goggins M. Precursors<br />

to pancreatic <strong>cancer</strong>. Gastroenterol Clin North Am 2007; 36:<br />

831-849, vi<br />

65 Hruban RH, Takaori K, Klimstra DS, Adsay NV, Albores-<br />

Saavedra J, Biankin AV, Biankin SA, Compton C, Fukushima<br />

N, Furukawa T, Goggins M, Kato Y, Klöppel G, Longnecker<br />

DS, Lüttges J, Maitra A, Offerhaus GJ, Shimizu M,<br />

Yonezawa S. An illustrated consensus on the classification<br />

<strong>of</strong> pancreatic intraepithelial neoplasia and intraductal papillary<br />

mucinous neoplasms. Am J Surg Pathol 2004; 28: 977-987<br />

66 Adsay NV. Cystic neoplasia <strong>of</strong> the pancreas: pathology and<br />

biology. J Gastrointest Surg 2008; 12: 401-404<br />

67 Takaori K, Hruban RH, Maitra A, Tanigawa N. Pancreatic<br />

intraepithelial neoplasia. Pancreas 2004; 28: 257-262<br />

68 Habbe N, Koorstra JB, Mendell JT, Offerhaus GJ, Ryu JK,<br />

Feldmann G, Mullendore ME, Goggins MG, Hong SM, Maitra<br />

A. MicroRNA miR-155 is a biomarker <strong>of</strong> early pancreatic<br />

neoplasia. Cancer Biol Ther 2009; 8: 340-346<br />

69 du Rieu MC, Torrisani J, Selves J, Al Saati T, Souque A, Dufresne<br />

M, Tsongalis GJ, Suriawinata AA, Carrère N, Buscail<br />

L, Cordelier P. MicroRNA-21 is induced early in pancreatic<br />

ductal adenocarcinoma precursor lesions. Clin Chem 2010; 56:<br />

603-612<br />

70 Wang J, Chen J, Chang P, LeBlanc A, Li D, Abbruzzesse JL,<br />

Frazier ML, Killary AM, Sen S. MicroRNAs in plasma <strong>of</strong> pancreatic<br />

ductal adenocarcinoma patients as novel blood-based<br />

biomarkers <strong>of</strong> disease. Cancer Prev Res (Phila) 2009; 2: 807-813<br />

71 Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R,<br />

Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. RAS<br />

is regulated by the let-7 microRNA family. Cell 2005; 120:<br />

635-647<br />

72 Li Y, VandenBoom TG 2nd, Kong D, Wang Z, Ali S, Philip<br />

PA, Sarkar FH. Up-regulation <strong>of</strong> miR-200 and let-7 by natural<br />

agents leads to the reversal <strong>of</strong> epithelial-to-mesenchymal<br />

transition in gemcitabine-resistant pancreatic <strong>cancer</strong> cells.<br />

Cancer Res 2009; 69: 6704-6712<br />

73 Oh JS, Kim JJ, Byun JY, Kim IA. Lin28-let7 modulates radiosensitivity<br />

<strong>of</strong> human <strong>cancer</strong> cells with activation <strong>of</strong> K-Ras.<br />

Int J Radiat Oncol Biol Phys 2010; 76: 5-8<br />

74 Zhang S, Cai X, Huang F, Zhong W, Yu Z. Effect <strong>of</strong> trichostatin<br />

a on viability and microRNA expression in human<br />

pancreatic <strong>cancer</strong> cell line BxPC-3. Exp Oncol 2008; 30: 265-268<br />

75 Park JK, Lee EJ, Esau C, Schmittgen TD. Antisense inhibition<br />

<strong>of</strong> microRNA-21 or -221 arrests cell cycle, induces apoptosis,<br />

and sensitizes the effects <strong>of</strong> gemcitabine in pancreatic<br />

adenocarcinoma. Pancreas 2009; 38: e190-e199<br />

76 Sun M, Estrov Z, Ji Y, Coombes KR, Harris DH, Kurzrock R.<br />

Curcumin (diferuloylmethane) alters the expression pr<strong>of</strong>iles<br />

<strong>of</strong> microRNAs in human pancreatic <strong>cancer</strong> cells. Mol Cancer<br />

Ther 2008; 7: 464-473<br />

77 Ji Q, Hao X, Zhang M, Tang W, Yang M, Li L, Xiang D, Desano<br />

JT, Bommer GT, Fan D, Fearon ER, Lawrence TS, Xu L.<br />

MicroRNA miR-34 inhibits human pancreatic <strong>cancer</strong> tumorinitiating<br />

cells. PLoS One 2009; 4: e6816<br />

78 Lee KH, Lotterman C, Karikari C, Omura N, Feldmann G,<br />

Habbe N, Goggins MG, Mendell JT, Maitra A. Epigenetic<br />

silencing <strong>of</strong> MicroRNA miR-107 regulates cyclin-dependent<br />

kinase 6 expression in pancreatic <strong>cancer</strong>. Pancreatology 2009;<br />

9: 293-301<br />

79 Gironella M, Seux M, Xie MJ, Cano C, Tomasini R, Gommeaux<br />

J, Garcia S, Nowak J, Yeung ML, Jeang KT, Chaix A,<br />

826 February 21, 2011|Volume 17|Issue 7|

---

Fazli L, Motoo Y, Wang Q, Rocchi P, Russo A, Gleave M,<br />

Dagorn JC, Iovanna JL, Carrier A, Pébusque MJ, Dusetti NJ.<br />

Tumor protein 53-induced nuclear protein 1 expression is<br />

repressed by miR-155, and its restoration inhibits pancreatic<br />

tumor development. Proc Natl Acad Sci USA 2007; 104:<br />

16170-16175<br />

80 Mees ST, Mardin WA, Wendel C, Baeumer N, Willscher E,<br />

Senninger N, Schleicher C, Colombo-Benkmann M, Haier J.<br />

EP300--a miRNA-regulated metastasis suppressor gene in<br />

ductal adenocarcinomas <strong>of</strong> the pancreas. Int J Cancer 2010;<br />

126: 114-124<br />

81 Mees ST, Mardin WA, Sielker S, Willscher E, Senninger N,<br />

Schleicher C, Colombo-Benkmann M, Haier J. Involvement<br />

<strong>of</strong> CD40 targeting miR-224 and miR-486 on the progression<br />

<strong>of</strong> pancreatic ductal adenocarcinomas. Ann Surg Oncol 2009;<br />

16: 2339-2350<br />

82 Thiery JP. Epithelial-mesenchymal transitions in tumour<br />

progression. Nat Rev Cancer 2002; 2: 442-454<br />

83 Sabbah M, Emami S, Redeuilh G, Julien S, Prévost G, Zimber<br />

A, Ouelaa R, Bracke M, De Wever O, Gespach C. Molecular<br />

signature and therapeutic perspective <strong>of</strong> the epithelialto-mesenchymal<br />

transitions in epithelial <strong>cancer</strong>s. Drug Resist<br />

Updat 2008; 11: 123-151<br />

84 Korpal M, Kang Y. The emerging role <strong>of</strong> miR-200 family <strong>of</strong><br />

microRNAs in epithelial-mesenchymal transition and <strong>cancer</strong><br />

metastasis. RNA Biol 2008; 5: 115-119<br />

85 Gregory PA, Bracken CP, Bert AG, Goodall GJ. MicroRNAs<br />

as regulators <strong>of</strong> epithelial-mesenchymal transition. Cell<br />

Cycle 2008; 7: 3112-3118<br />

86 Wellner U, Schubert J, Burk UC, Schmalh<strong>of</strong>er O, Zhu F,<br />

Sonntag A, Waldvogel B, Vannier C, Darling D, zur Hausen A,<br />

Brunton VG, Morton J, Sansom O, Schüler J, Stemmler MP,<br />

Herzberger C, Hopt U, Keck T, Brabletz S, Brabletz T. The<br />

EMT-activator ZEB1 promotes tumorigenicity by repressing<br />

stemness-inhibiting microRNAs. Nat Cell Biol 2009; 11:<br />

1487-1495<br />

87 Iliopoulos D, Polytarchou C, Hatziapostolou M, Kottakis F,<br />

Maroulakou IG, Struhl K, Tsichlis PN. MicroRNAs differentially<br />

regulated by Akt is<strong>of</strong>orms control EMT and stem cell<br />

renewal in <strong>cancer</strong> cells. Sci Signal 2009; 2: ra62<br />

88 Wright JA, Richer JK, Goodall GJ. microRNAs and EMT in<br />

mammary cells and breast <strong>cancer</strong>. J Mammary Gland Biol<br />

Neoplasia 2010; 15: 213-223<br />

89 Braun J, Hoang-Vu C, Dralle H, Hüttelmaier S. Downregulation<br />

<strong>of</strong> microRNAs directs the EMT and invasive potential<br />

<strong>of</strong> anaplastic thyroid carcinomas. Oncogene 2010; 29:<br />

4237-4244<br />

90 Downward J. Targeting RAS signalling pathways in <strong>cancer</strong><br />

therapy. Nat Rev Cancer 2003; 3: 11-22<br />

91 Kim IA, Bae SS, Fernandes A, Wu J, Muschel RJ, McKenna<br />

WG, Birnbaum MJ, Bernhard EJ. Selective inhibition <strong>of</strong> Ras,<br />

phosphoinositide 3 kinase, and Akt is<strong>of</strong>orms increases the<br />

radiosensitivity <strong>of</strong> human carcinoma cell lines. Cancer Res<br />

2005; 65: 7902-7910<br />

92 Egger G, Liang G, Aparicio A, Jones PA. Epigenetics in human<br />

disease and prospects for epigenetic therapy. Nature<br />

2004; 429: 457-463<br />

93 Lane AA, Chabner BA. Histone deacetylase inhibitors in<br />

<strong>cancer</strong> therapy. J Clin Oncol 2009; 27: 5459-5468<br />

94 Esau CC. Inhibition <strong>of</strong> microRNA with antisense oligonucleotides.<br />

Methods 2008; 44: 55-60<br />

95 Li L, Aggarwal BB, Shishodia S, Abbruzzese J, Kurzrock R.<br />

Nuclear factor-kappaB and IkappaB kinase are constitutively<br />

active in human pancreatic cells, and their down-regulation<br />

by curcumin (diferuloylmethane) is associated with the suppression<br />

<strong>of</strong> proliferation and the induction <strong>of</strong> apoptosis. Cancer<br />

2004; 101: 2351-2362<br />

WJG|www.wjgnet.com<br />

Park JY et al . MicroRNAs in pancreatic <strong>cancer</strong><br />

96 Li L, Braiteh FS, Kurzrock R. Liposome-encapsulated curcumin:<br />

in vitro and in vivo effects on proliferation, apoptosis,<br />

signaling, and angiogenesis. Cancer 2005; 104: 1322-1331<br />

97 Aggarwal BB, Kumar A, Bharti AC. Anti<strong>cancer</strong> potential<br />

<strong>of</strong> curcumin: preclinical and clinical studies. Anti<strong>cancer</strong> Res<br />

2003; 23: 363-398<br />

98 Dhillon N, Aggarwal BB, Newman RA, Wolff RA, Kunnumakkara<br />

AB, Abbruzzese JL, Ng CS, Badmaev V, Kurzrock<br />

R. Phase II trial <strong>of</strong> curcumin in patients with advanced pancreatic<br />

<strong>cancer</strong>. Clin Cancer Res 2008; 14: 4491-4499<br />

99 Frank NY, Schatton T, Frank MH. The therapeutic promise<br />

<strong>of</strong> the <strong>cancer</strong> stem cell concept. J Clin Invest 2010; 120: 41-50<br />

100 Jones PA, Baylin SB. The epigenomics <strong>of</strong> <strong>cancer</strong>. Cell 2007;<br />

128: 683-692<br />

101 Sharma S, Kelly TK, Jones PA. Epigenetics in <strong>cancer</strong>. Carcinogenesis<br />

2010; 31: 27-36<br />

102 Han L, Witmer PD, Casey E, Valle D, Sukumar S. DNA<br />

methylation regulates MicroRNA expression. Cancer Biol<br />

Ther 2007; 6: 1284-1288<br />

103 Davalos V, Esteller M. MicroRNAs and <strong>cancer</strong> epigenetics:<br />

a macrorevolution. Curr Opin Oncol 2010; 22: 35-45<br />

104 Tomasini R, Samir AA, Vaccaro MI, Pebusque MJ, Dagorn<br />

JC, Iovanna JL, Dusetti NJ. Molecular and functional characterization<br />

<strong>of</strong> the stress-induced protein (SIP) gene and<br />

its two transcripts generated by alternative splicing. SIP<br />

induced by stress and promotes cell death. J Biol Chem 2001;<br />

276: 44185-44192<br />

105 Tomasini R, Samir AA, Pebusque MJ, Calvo EL, Totaro S,<br />

Dagorn JC, Dusetti NJ, Iovanna JL. P53-dependent expression<br />

<strong>of</strong> the stress-induced protein (SIP). Eur J Cell Biol 2002;<br />

81: 294-301<br />

106 Zhou CZ, Peng ZH, Zhang F, Qiu GQ, He L. Loss <strong>of</strong> heterozygosity<br />

on long arm <strong>of</strong> chromosome 22 in sporadic colo<strong>rectal</strong><br />

carcinoma. <strong>World</strong> J Gastroenterol 2002; 8: 668-673<br />

107 Wild A, Langer P, Celik I, Chaloupka B, Bartsch DK. Chromosome<br />

22q in pancreatic endocrine tumors: identification<br />

<strong>of</strong> a homozygous deletion and potential prognostic associations<br />

<strong>of</strong> allelic deletions. Eur J Endocrinol 2002; 147: 507-513<br />

108 Muraoka M, Konishi M, Kikuchi-Yanoshita R, Tanaka K,<br />

Shitara N, Chong JM, Iwama T, Miyaki M. p300 gene alterations<br />

in colo<strong>rectal</strong> and gastric carcinomas. Oncogene 1996;<br />

12: 1565-1569<br />

109 Iyer NG, Ozdag H, Caldas C. p300/CBP and <strong>cancer</strong>. Oncogene<br />

2004; 23: 4225-4231<br />

110 Melief CJ. Cancer immunotherapy by dendritic cells. Immunity<br />

2008; 29: 372-383<br />

111 Loskog AS, Eliopoulos AG. The Janus faces <strong>of</strong> CD40 in <strong>cancer</strong>.<br />

Semin Immunol 2009; 21: 301-307<br />

112 Sassen S, Miska EA, Caldas C. MicroRNA: implications for<br />

<strong>cancer</strong>. Virchows Arch 2008; 452: 1-10<br />

113 Garzon R, Calin GA, Croce CM. MicroRNAs in Cancer.<br />

Annu Rev Med 2009; 60: 167-179<br />

114 Iorio MV, Croce CM. MicroRNAs in <strong>cancer</strong>: small molecules<br />

with a huge impact. J Clin Oncol 2009; 27: 5848-5856<br />

115 Mirnezami AH, Pickard K, Zhang L, Primrose JN, Packham<br />

G. MicroRNAs: key players in carcinogenesis and novel<br />

therapeutic targets. Eur J Surg Oncol 2009; 35: 339-347<br />

116 Davis S, Propp S, Freier SM, Jones LE, Serra MJ, Kinberger<br />

G, Bhat B, Swayze EE, Bennett CF, Esau C. Potent inhibition<br />

<strong>of</strong> microRNA in vivo without degradation. Nucleic Acids Res<br />

2009; 37: 70-77<br />

117 Jay C, Nemunaitis J, Chen P, Fulgham P, Tong AW. miRNA<br />

pr<strong>of</strong>iling for diagnosis and prognosis <strong>of</strong> human <strong>cancer</strong>.<br />

DNA Cell Biol 2007; 26: 293-300<br />

118 Yang N, Coukos G, Zhang L. MicroRNA epigenetic alterations<br />

in human <strong>cancer</strong>: one step forward in diagnosis and<br />

treatment. Int J Cancer 2008; 122: 963-968<br />

S- Editor Sun H L- Editor Kerr C E- Editor Ma WH<br />

827 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.828<br />

Imran Hassan, MD, Assistant Pr<strong>of</strong>essor, Series Editor<br />

Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

Abdus Samee, Chelliah Ramachandran Selvasekar<br />

Abdus Samee, Department <strong>of</strong> Surgery, Princess Royal Hospital,<br />

Telford, Shropshire, United Kingdom<br />

Chelliah Ramachandran Selvasekar, Department <strong>of</strong> Surgery,<br />

Mid Cheshire Hospitals NHS Foundation Trust, Crewe,<br />

United Kingdom<br />

Author contributions: Selvasekar CR designed the study;<br />

Samee A and Selvasekar CR were literature search and drafting<br />

the article; Samee A and Selvasekar CR revised the critically.<br />

Correspondence to: Chelliah Ramachandran Selvasekar,<br />

MD, FRCS, Consultant Colo<strong>rectal</strong> Surgeon, Department <strong>of</strong><br />

Surgery, Mid Cheshire Hospitals NHS Foundation Trust, Crewe,<br />

United Kingdom. crselvasekar@aol.com<br />

Telephone: +44-1270-612046 Fax: +44-1270-612494<br />

Received: August 30, 2010 Revised: November 12, 2010<br />

Accepted: November 19, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

<strong>Management</strong> <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> has evolved over the years.<br />

In this condition preoperative investigations assist in deciding<br />

the optimal treatment. The relation <strong>of</strong> the tumor<br />

edge to the circumferential margin (CRM) is an important<br />

factor in deciding the need for neoadjuvant treatment<br />

and determines the prognosis. Those with threatened or<br />

involved margins are <strong>of</strong>fered long course chemoradiation<br />

to enable R0 surgical resection. Endoanal ultrasound<br />

(EUS) is useful for tumor (T) staging; hence EUS is a<br />

useful imaging modality for early <strong>rectal</strong> <strong>cancer</strong>. Magnetic<br />

resonance imaging (MRI) is useful for assessing the<br />

mesorectum and the meso<strong>rectal</strong> fascia which has useful<br />

prognostic significance and for early identification <strong>of</strong> local<br />

recurrence. Computerized tomography (CT) <strong>of</strong> the chest,<br />

abdomen and pelvis is used to rule out distant metastasis.<br />

Identification <strong>of</strong> the malignant nodes using EUS, CT<br />

and MRI is based on the size, morphology and internal<br />

characteristics but has drawbacks. Most <strong>of</strong> the common<br />

imaging techniques are suboptimal for imaging following<br />

chemoradiation as they struggle to differentiate fibrotic<br />

changes and tumor. In this situation, EUS and MRI may<br />

provide complementary information to decide further<br />

treatment. Functional imaging using positron emission<br />

WJG|www.wjgnet.com<br />

828<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 828-834<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

tomography (PET) is useful, particularly PET/CT fusion<br />

scans to identify areas <strong>of</strong> the functionally hot spots. In<br />

the current state, imaging has enabled the multidisciplinary<br />

team <strong>of</strong> surgeons, oncologists, radiologists and<br />

pathologists to decide on the patient centered management<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. In future, functional imaging may<br />

play an active role in identifying patients with lymph<br />

node metastasis and those with residual and recurrent<br />

disease following neoadjuvant chemoradiotherapy.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Rectal <strong>cancer</strong>; Staging; Investigations;<br />

Magnetic resonance imaging; Ultrasound; Endoanal ultrasound;<br />

Positron emission tomography; Computerized<br />

tomography<br />

Peer reviewer: Christopher Mantyh, MD, Associate Pr<strong>of</strong>essor,<br />

Department <strong>of</strong> Surgery, Duke University Medical Center, Box<br />

3117, Durham, NC 2771, United States<br />

Samee A, Selvasekar CR. Current trends in staging <strong>rectal</strong> <strong>cancer</strong>.<br />

<strong>World</strong> J Gastroenterol 2011; 17(7): 828-834 Available from:<br />

URL: http://www.wjgnet.com/1007-9327/full/v17/i7/828.htm<br />

DOI: http://dx.doi.org/10.3748/wjg.v17.i7.828<br />

INTRODUCTION<br />

TOPIC HIGHLIGHT<br />

Nearly one million patients are diagnosed with colo<strong>rectal</strong><br />

<strong>cancer</strong>s (CRC) annually in the world [1] . The incidence <strong>of</strong><br />

CRC is highest in the western world where it is the second<br />

commonest cause <strong>of</strong> <strong>cancer</strong> death and fourth commonest<br />

cause <strong>of</strong> death from <strong>cancer</strong> worldwide [2] . In the western<br />

world there is a life time risk <strong>of</strong> CRC <strong>of</strong> 5%. Overall the 5<br />

year survival has improved in the UK (55% in males and<br />

51% in females) but to a lesser extent than in the USA and<br />

Europe [3] .<br />

Around 30%-40% <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> is defined to<br />

arise from the rectum which is defined as the distal margin<br />

<strong>of</strong> tumor within 15 cm <strong>of</strong> the anal verge [4,5] .<br />

Colonoscopy and biopsy is considered as the gold<br />

February 21, 2011|Volume 17|Issue 7|

---

standard investigation to confirm the diagnosis <strong>of</strong> <strong>rectal</strong><br />

<strong>cancer</strong> and to exclude synchronous lesions. Patients are<br />

then <strong>stage</strong>d to assess the extent <strong>of</strong> local disease and to<br />

identify the distant spread.<br />

Traditional <strong>rectal</strong> <strong>cancer</strong> surgery is associated with high<br />

rates <strong>of</strong> local recurrence <strong>of</strong> 5%-20% [6] . However, with the<br />

combination <strong>of</strong> high quality surgery using total meso<strong>rectal</strong><br />

excision [7] along with use <strong>of</strong> neoadjuvant and adjuvant<br />

treatment there has been a significant reduction in local<br />

recurrence and improved survival [8] . The surgeon aims to<br />

achieve a microscopic tumor free (R0) resection. Despite<br />

this, there is a risk <strong>of</strong> local failure. Careful preoperative<br />

assessment <strong>of</strong> the pelvis identifies high risk patients in<br />

whom the resection margins are either involved or within<br />

1 mm <strong>of</strong> the meso<strong>rectal</strong> fascia. Involvement or threatened<br />

CRM (tumors within 1 mm <strong>of</strong> the meso<strong>rectal</strong> fascia) have<br />

a reduced chance <strong>of</strong> obtaining complete clearance. Thus,<br />

the status <strong>of</strong> the CRM has become more important than<br />

the TNM staging. In Europe and the UK, patients with<br />

involved CRM/threatened CRM are considered for long<br />

course chemoradiation prior to surgery.<br />

IMPORTANCE OF PREOPERATIVE<br />

STAGING IN RECTAL CANCER<br />

Accurate pre-operative staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> is crucial<br />

in planning the surgical treatment and is the strongest predictor<br />

for recurrence [9] . The staging helps us to formulate<br />

a structured multidisciplinary management care plan and<br />

assess the prognosis. It is also used to compare the results<br />

<strong>of</strong> hospitals <strong>of</strong>fering <strong>rectal</strong> <strong>cancer</strong> treatment and to define<br />

the role <strong>of</strong> different treatment modalities.<br />

Preoperative staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> can be divided<br />

into either local or distant staging. Local staging incorporates<br />

the assessment <strong>of</strong> mural wall invasion, circumferential<br />

resection margin involvement, and the nodal status for<br />

metastasis. Distant staging assesses for evidence <strong>of</strong> metastatic<br />

disease.<br />

Rectal <strong>cancer</strong> is palpable in 40%-80% <strong>of</strong> cases [10] . Digital<br />

<strong>rectal</strong> examination helps in documentation <strong>of</strong> the size,<br />

location, distance from the anal verge, and fixity. Lesions<br />

felt by digital <strong>rectal</strong> examination can be visualized using a<br />

rigid proctoscope. The procedure allows an accurate localization<br />

and assessment <strong>of</strong> the tumor including fixity. Biopsies<br />

can be carried out where necessary. Rectal examination<br />

using proctoscopy may be considered as an important<br />

tool for newly diagnosed <strong>rectal</strong> <strong>cancer</strong>s. Painful local perineal<br />

and anal conditions such as fissures or abscesses can<br />

restrict the use <strong>of</strong> this excellent tool. A trial comparing<br />

the use <strong>of</strong> CT virtual proctoscopy with <strong>rectal</strong> ultrasound<br />

examination in determining the <strong>stage</strong> <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> is<br />

being conducted in the USA and its results are awaited<br />

(http://clinical trials.gov/ct2/show/NCT00585728).<br />

Currently, several modalities exist for the preoperative<br />

staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. A combination <strong>of</strong> modalities involving<br />

use <strong>of</strong> computed tomography (CT), magnetic resonance<br />

imaging (MRI), and/or endo<strong>rectal</strong> ultrasonography<br />

(EUS) is used to precisely assess the extent <strong>of</strong> spread<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. The choice <strong>of</strong> investigations performed,<br />

WJG|www.wjgnet.com<br />

Samee A et al . Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

however, is influenced by local expertise, guidelines and<br />

availability. Imaging in <strong>rectal</strong> <strong>cancer</strong> plays a crucial role in<br />

optimizing radiotherapy target definition to avoid adjacent<br />

vital structures [11] . EUS and MRI <strong>of</strong> the pelvis are used<br />

to assess the local spread while CT is the main modality<br />

to assess systemic spread. PET is indicated when there is<br />

clinical, biochemical or radiological suspicion <strong>of</strong> local recurrence<br />

or systemic disease.<br />

Computerized tomography and computerized<br />

tomography colonography or virtual colonoscopy<br />

CT scan <strong>of</strong> the entire chest, abdomen and pelvis is used<br />

for the detection <strong>of</strong> metastatic disease. CT is widely<br />

available and has faster acquisition times. However, it<br />

is not considered as the investigation <strong>of</strong> choice when it<br />

comes to assessing the layers <strong>of</strong> the <strong>rectal</strong> wall; hence<br />

it is not useful for local staging in <strong>rectal</strong> <strong>cancer</strong> and certainly<br />

is poor at evaluating superficial <strong>rectal</strong> <strong>cancer</strong>s. The<br />

accuracy <strong>of</strong> CT to assess the tumor has been reported<br />

to be between 80%-95% in patients with advanced local<br />

disease [12] . The accuracy, however, decreased to around<br />

63% when a broader spectrum <strong>of</strong> tumor sizes was analyzed.<br />

Sensitivity to pick up nodal disease has been found<br />

to be between 55%-70% [13] . In a meta-analysis involving<br />

5000 patients, CT showed an accuracy for T staging <strong>of</strong><br />

73% and for nodal staging <strong>of</strong> 22%-73% [14] .<br />

The use <strong>of</strong> contrast enhanced multidetector CT colonography<br />

has improved the staging accuracy [15] , by achieving<br />

superior spatial resolution and visualizing pictures in a<br />

variety <strong>of</strong> planes. However, its role in staging remains to<br />

be determined and currently it is used mainly to assess the<br />

distant metastatic disease (Figure 1A and B).<br />

Virtual colonoscopy or CT colonogram (CTC) has<br />

been reported to be safer than colonoscopy [16] while being<br />

more sensitive than barium enema, and appears to<br />

be more acceptable to patients than either <strong>of</strong> the other<br />

tests [17] . The procedure can be performed by technicians<br />

thus saving clinicians time. In principle the data could be<br />

analysed by computer-assistance thus accelerating diagnosis<br />

time [18] . The results <strong>of</strong> the SIGGAR trial evaluating<br />

CTC versus colonoscopy or barium enema in symptomatic<br />

elderly patients are awaited [19] . CTC is the best<br />

radiological imaging for assessing the colon and rectum<br />

and at the same time identifies nodal disease and distant<br />

metastasis. The diagnosis <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> still needs to<br />

be confirmed by colonoscopy and biopsy.<br />

Magnetic resonance imaging<br />

Magnetic resonance imaging (MRI) is routinely used for<br />

preoperative staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> as it provides an accurate<br />

assessment <strong>of</strong> the tumor and the surrounding meso<strong>rectal</strong><br />

fascia. It identifies patients at risk <strong>of</strong> local recurrence<br />

and those likely to benefit from neoadjuvant therapy.<br />

When compared with CT and ultrasound, MRI is more<br />

reliable for the evaluation <strong>of</strong> the extent <strong>of</strong> locoregional<br />

disease, planning radiation therapy, assessing postoperative<br />

changes and pelvic recurrence. The evaluation <strong>of</strong> nodal<br />

metastases remains a challenge with MRI (Figure 2).<br />

Earlier MRI studies used body coils which lacked the<br />

829 February 21, 2011|Volume 17|Issue 7|

---

A<br />

B<br />

Samee A et al . Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

Figure 1 Computerized tomography. A: Computerized tomography (CT) abdomen<br />

showing a patient with <strong>rectal</strong> <strong>cancer</strong> having liver metastasis and ascites;<br />

B: CT Chest showing a patient with <strong>rectal</strong> <strong>cancer</strong> having lung metastasis.<br />

Figure 2 Coronal magnetic resonance imaging (arrow) showing possible<br />

lymph node or early vascular involvement.<br />

resolution to differentiate the different layers <strong>of</strong> the <strong>rectal</strong><br />

wall and added no advantage to conventional CT [20] .<br />

Subsequent use <strong>of</strong> phased-array coils permitted reliable<br />

identification <strong>of</strong> the meso<strong>rectal</strong> fascia which is crucial in<br />

the management <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> [21] . Initial studies suggested<br />

a histological clearance <strong>of</strong> at least 10 mm could be<br />

accurately predicted when the radiological clearance from<br />

the meso<strong>rectal</strong> fascia and critical structure was at least<br />

5 mm [22] . Subsequent single centre study showed 92% accuracy<br />

in prediction <strong>of</strong> CRM involvement when the CRM<br />

cut<strong>of</strong>f <strong>of</strong> 1 mm was used and this is now confirmed from<br />

the multicentre European MERCURY study [21,23] . In Europe,<br />

MRI is now routinely used in the preoperative investigation<br />

for <strong>rectal</strong> <strong>cancer</strong>. Techniques for obtaining optimal<br />

WJG|www.wjgnet.com<br />

Figure 3 Magnetic resonance imaging (arrow) showing possible extension<br />

beyond the muscularis propria, radiologically <strong>stage</strong>d as early T3.<br />

Figure 4 Coronal T2 W magnetic resonance imaging (arrow) showing<br />

the intact muscularis propria in a patient with <strong>rectal</strong> <strong>cancer</strong>. Radiologically<br />

<strong>stage</strong>d as T1 or T2.<br />

MRI images are described in the literature [24] . An axial picture<br />

enables identification <strong>of</strong> the distance <strong>of</strong> the CRM to<br />

the tumor. Coronal sections are useful in low <strong>rectal</strong> tumors<br />

to identify the relation to anal sphincter complex, pelvic<br />

floor, and pelvic side wall [25] . High signal intensity <strong>of</strong> the<br />

tumor on T2 w images suggest the presence <strong>of</strong> mucinous<br />

carcinoma which has poor prognosis compared to nonmucinous<br />

carcinoma [26] . The standard phased array MRI<br />

produces good quality images with good contrast resolution<br />

and a relatively large field <strong>of</strong> view. Routine use <strong>of</strong> intravenous<br />

contrast does not appear to improve the accuracy [27] .<br />

MRI cannot differentiate between T2 and early T3 lesions;<br />

a nodular or rounded advancing margin at the interface between<br />

muscularis propria and peri<strong>rectal</strong> fat is suggestive <strong>of</strong><br />

T3 (Figure 3). Sometimes spiculations in the peri<strong>rectal</strong> fat<br />

are considered as T3 when in fact they are T2 with desmoplastic<br />

reaction [22,28] . MRI certainly cannot differentiate between<br />

a T1 and T2 <strong>cancer</strong> (Figure 4). Another area <strong>of</strong> drawback<br />

is restaging following long course chemoradiotherapy.<br />

Studies by Chen and H<strong>of</strong>fmann found T staging accuracy<br />

was 52% and 54% when compared to histology [29] . This is<br />

due to the inability to distinguish fibrosis from tumor with<br />

MRI similar to EUS. In low anterior tumors where the meso<strong>rectal</strong><br />

fascia is close to the muscularis propria early T3 can<br />

still infiltrate the meso<strong>rectal</strong> fascia [24] . Extramural vascular<br />

invasion is known to be an independent predictor <strong>of</strong> local<br />

recurrence [30,31] . The presence <strong>of</strong> a tubular structure in<br />

830 February 21, 2011|Volume 17|Issue 7|

---

proximity to a T3 tumor or nodules with an irregular margin<br />

probably represents vascular invasion [21,32] . Recently there<br />

has been interest in the use <strong>of</strong> functional imaging such as<br />

diffusion weighted MRI imaging (DWI) and CT/PET to<br />

distinguish fibrosis from tumor [33] .<br />

MRI has been found to be useful in more advanced<br />

disease by providing clearer definition <strong>of</strong> the mesorectum<br />

and meso<strong>rectal</strong> fascia and seems to be a promising tool in<br />

assessing the locally advanced disease. With the advent <strong>of</strong><br />

endo<strong>rectal</strong> coils, the T staging accuracy has been reported<br />

to be between 70%-90% [34] . However, this technique has<br />

its limitations specially when evaluating the surrounding<br />

tissue, owing to signal attenuation at a short distance from<br />

the coil. Patient’s compliance, limited availability and cost<br />

also contribute to its less wide application. Obstructing<br />

or nearly obstructing lesions can be difficult to negotiate<br />

as are high <strong>rectal</strong> <strong>cancer</strong>s leading to failed/improper coil<br />

insertion in approximately 40% <strong>of</strong> patients [34] .<br />

Nodal accuracy has also been found to be variable although<br />

use <strong>of</strong> superparamagnetic iron oxide particles appears<br />

to be promising [35] as evidenced by studies in head,<br />

neck and urological <strong>cancer</strong>s.<br />

Ultrasound<br />

Abdominal ultrasound (USS) is used to evaluate liver for<br />

metastasis, ascites, adenopathy, and for omental cake. The<br />

false negative rate is reported to be around 8% [36] . The<br />

technique, although inexpensive and widely available, is<br />

operator dependent. Intraoperative USS is rarely used<br />

apart from when synchronous <strong>rectal</strong> and liver resections<br />

are planned. Rapid advancement in imaging modalities has<br />

made USS a less favoured imaging modality in <strong>rectal</strong> <strong>cancer</strong><br />

staging [37] .<br />

Endo<strong>rectal</strong> ultrasound<br />

Endo<strong>rectal</strong> ultrasound (EUS) is sensitive for early <strong>rectal</strong> <strong>cancer</strong>s<br />

(T1 and T2 lesions) with an accuracy <strong>of</strong> 69%-97% [38-43]<br />

and is useful in the surveillance following post transanal surgery.<br />

The standard technique involves a transanal probe enclosed<br />

in a water filled balloon introduced into the rectum to<br />

allow radial visualization <strong>of</strong> the rectum. High resolution allows<br />

the assessment <strong>of</strong> the <strong>rectal</strong> wall but the assessment <strong>of</strong><br />

the meso<strong>rectal</strong> fascia is not possible and the assessment <strong>of</strong><br />

the lymph nodes can be an issue and overstating has been a<br />

concern. Peritumor inflammation and artifacts due to faeces<br />

may lead to an ultrasound appearance which can be misinterpreted<br />

as tumor. These drawbacks can be exaggerated between<br />

the muscle layer and the surrounding fat which makes<br />

T2 and T3 lesions difficult to distinguish [44] . The accuracy <strong>of</strong><br />

the T <strong>stage</strong> evaluation varies from 62%-92% [45] . In a metaanalysis<br />

<strong>of</strong> 11 studies it has been shown that sensitivities for<br />

superficial tumors are better than advanced lesions [46] . A 20<br />

year (1984-2004) systematic review looking at studies with<br />

a minimum <strong>of</strong> 50 patients, evaluating the use <strong>of</strong> endo<strong>rectal</strong><br />

ultrasound and magnetic resonance imaging (MRI) in the<br />

local staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>, have found a complementary<br />

role for these imaging modalities in the assessment <strong>of</strong> tumor<br />

depth. Ultrasound was found to be highly accurate in<br />

early lesions (T1, 2, 40%-100%; T3, 4, 25%-100%, overall 82%).<br />

WJG|www.wjgnet.com<br />

Samee A et al . Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

The review also found a similar accuracy in the assessment<br />

<strong>of</strong> nodal metastases [47] . Two meta-analyses in literature have<br />

shown that the sensitivity is affected by T <strong>stage</strong> [48] . A metaanalysis<br />

including 84 studies found EUS to be slightly superior<br />

in assessing the local involvement such as lymph nodes,<br />

however, no significant differences were noted when compared<br />

to other imaging modalities such as MRI. The results<br />

suggest that none <strong>of</strong> the current imaging modalities enable<br />

reliable detection <strong>of</strong> metastatic nodal disease [49] .<br />

EUS however, has its limitations as it cannot reliably<br />

distinguish an irregular outer <strong>rectal</strong> wall due to peritumoral<br />

inflammation or transmural tumor extension. Obstructing<br />

lesions may be difficult to scan especially with rigid probes<br />

leading to suboptimal staging. The scanning, although less<br />

expensive and portable, is operator dependent and has a<br />

steep learning curve. Bulky, high, stenotic, advanced (T3)<br />

lesions or post-neoadjuvant therapy down<strong>stage</strong>d tumors<br />

can be a challenge [50-52] .<br />

EUS nodal staging accuracy is around 75% [53] . Morphologic<br />

characteristics suggestive <strong>of</strong> malignant involvement<br />

include hypoechoic appearance, round shape, peritumoral<br />

location, and size > 5 mm [45,46,51-53] . The locoregional<br />

tumor assessment using three-dimensional EUS<br />

consists <strong>of</strong> transverse, coronal and sagital scan and has<br />

been found to be superior to CT and two-dimensional<br />

EUS. The 3D-reconstructed image shows tumor protrusion<br />

infiltrating into adjacent structures, thus, allowing<br />

for improved T and N staging [54] . Further, EUS-guided<br />

fine-needle aspiration can be carried out at the same time<br />

from the lesion or suspiciously looking lymph nodes.<br />

Positron emission tomography<br />

The principle <strong>of</strong> positron emission tomography (PET)<br />

is based on the differential metabolic pr<strong>of</strong>ile <strong>of</strong> tumors<br />

compared to normal tissue. Fluoro-deoxy-glucose (FDG)<br />

is the most common PET tracer used. Due to increased<br />

metabolic activity, and change in the tumor biology,<br />

tumors preferentially show an increased uptake which<br />

results in radiolabelling [55] . Although selective, FDG accumulates<br />

in areas <strong>of</strong> infection, inflammation, in organs <strong>of</strong><br />

increased metabolic activity such as brain, myocardium,<br />

liver or kidneys leading to false positive results [55] . FDG<br />

uptake is also influenced by the presence <strong>of</strong> mucin. PET<br />

is useful in identifying non-mucinous tumors compared to<br />

mucinous tumors. FDG/PET is mainly useful in the assessment<br />

<strong>of</strong> local recurrence and metastatic disease when<br />

conventional imaging is not helpful [56,57] . Currently it is not<br />

used as a primary staging modality in <strong>rectal</strong> <strong>cancer</strong>s. Interpretation<br />

<strong>of</strong> PET without anatomic correlation poses difficulties<br />

hence PET-CT fusion scans where the pictures <strong>of</strong><br />

both investigations are fused using s<strong>of</strong>tware is used. This<br />

<strong>of</strong>fers a detailed anatomical and functional imaging and is<br />

gaining rapid popularity and acceptance. The combination<br />

provides additional value to localize the hot spots. There<br />

are some technical limitations with this combination imaging<br />

and with the false positive rates due to other disease<br />

and physiological processes. The role <strong>of</strong> PET CT fusion<br />

scan has not changed compared to PET scans.<br />

However, a recent study has found preoperative PET<br />

831 February 21, 2011|Volume 17|Issue 7|

---

Samee A et al . Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

changed the management in 17% <strong>of</strong> patients [58] with improved<br />

staging accuracy in combination with CT [56] . Another<br />

study carried by Gearhart in 37 patients reported an<br />

altered management plan for 27% <strong>of</strong> patients using FDG-<br />

PET/CT imaging modality for low <strong>rectal</strong> <strong>cancer</strong> [59] .<br />

Staging accuracy post-neoadjuvant therapy<br />

With the increasing use <strong>of</strong> pre-operative neoadjuvant<br />

therapy, <strong>rectal</strong> tumor re-staging is increasingly performed<br />

prior to curative resection.<br />

A reduction in staging accuracy has been noted which<br />

may be as a result <strong>of</strong> effects <strong>of</strong> neoadjuvant treatment due to<br />

post-radiation edema, inflammation, fibrosis, and necrosis [60] .<br />

A recent study <strong>of</strong> 29 patients undergoing neoadjuvant<br />

therapy and pretreatment and post-treatment staging<br />

with CT, MRI, and PET showed that PET was 100%<br />

sensitive in predicting response to therapy (compared<br />

with 54% for CT and 71% for MRI). Corresponding<br />

specificity for predicting tumor response to treatment<br />

was 60%, 80%, and 67% for PET, CT, and MRI, respectively<br />

[61] , thus suggesting a further possible role <strong>of</strong> PET<br />

in predicting response to neoadjuvant therapy.<br />

Tumor re-staging following post-neoadjuvant therapy<br />

remains problematic and it is hoped that a combination<br />

<strong>of</strong> imaging technique (CT, MRI, and EUS) and functional<br />

(PET) imaging may improve staging accuracy.<br />

Suggested investigations for tumor staging <strong>of</strong> <strong>rectal</strong><br />

<strong>cancer</strong><br />

On review <strong>of</strong> the literature, phased array MRI and EUS<br />

should be considered as the initial modalities to <strong>stage</strong> the<br />

local tumor. A fixed, locally advanced <strong>rectal</strong> <strong>cancer</strong> may be<br />

imaged better by MRI (Figure 5), whereas EUS is more<br />

appropriate for an early mobile <strong>rectal</strong> tumor (T1-T2 lesions).<br />

MRI has been shown to be highly accurate in predicting<br />

a clear circumferential resection margin in patients<br />

undergoing TME. Although both MRI and EUS provide<br />

a comparable overall T- and N-staging, use <strong>of</strong> these modalities<br />

is limited by issues such as availability, costs and<br />

technical expertise. CT scanning, although still the current<br />

standard for distant staging, may not be an effective tool<br />

to <strong>stage</strong> the local disease. A combination <strong>of</strong> CT and PET<br />

<strong>of</strong>fering a detailed anatomical and functional imaging,<br />

however, seem to be promising and gaining popularity<br />

and acceptance for recurrent <strong>rectal</strong> <strong>cancer</strong>s.<br />

Suggested investigation for nodal staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong><br />

The accuracy <strong>of</strong> MRI, CT and EUS for identifying malignant<br />

nodes is poor. Current criteria are based on size,<br />

shape and morphology. Any node <strong>of</strong> 1 cm and over is<br />

taken as significant [62] . The enlarged lymph node can be<br />

as a result <strong>of</strong> the inflammatory process but normal size<br />

nodes can have micrometastases. Brown et al [54] found<br />

58% <strong>of</strong> positive malignant nodes were less than 5 mm.<br />

Morphological characteristics such as round shape, irregular<br />

borders and heterogenous signal intensity suggest<br />

nodal involvement [63] .<br />

Nodal accuracy has also been found to be variable,<br />

although use <strong>of</strong> superparamagnetic iron oxide particles<br />

WJG|www.wjgnet.com<br />

A<br />

B<br />

Figure 5 Magnetic resonance imaging. A: Magnetic resonance imaging<br />

(MRI) (arrow) showing the <strong>rectal</strong> <strong>cancer</strong> involving the circumferential resection<br />

margin; B: MRI (arrow) showing the <strong>rectal</strong> <strong>cancer</strong> invading the ischio<strong>rectal</strong> fat<br />

on the right (T4).<br />

(SPIO) seem to be promising as evidenced by studies in<br />

head, neck and urological <strong>cancer</strong>s. The technique involves<br />

use <strong>of</strong> a contrast media containing SPIO which accumulates<br />

in normal lymph nodes, whereas due to defective<br />

phagocytosis, the uptake is poor or absent in malignant<br />

nodes. Hence by using T2 weighted imaging, these nodes<br />

can be identified. Initial studies are promising but further<br />

research is needed [35] .<br />

CHOOSING THE CORRECT<br />

MANAGEMENT BASED ON STAGING IN<br />

THE ELDERLY<br />

Over the age <strong>of</strong> 80, there is 10% mortality with <strong>rectal</strong> <strong>cancer</strong><br />

surgery [64] . Studies from Brazil have shown a complete<br />

pathological response with chemoradiation [65] and it is well<br />

known that the elderly respond better to radiotherapy.<br />

Hence in a selected group <strong>of</strong> patients, imaging with<br />

EUS and MRI can identify patients who can be treated<br />

with neoadjuvant treatment and those with a complete<br />

radiological response can be followed by active surveillance<br />

with an intensive imaging protocol to identify those<br />

who recur to be considered for standard salvage surgical<br />

treatment or for local excision, thereby avoiding the risks<br />

associated with major <strong>rectal</strong> <strong>cancer</strong> surgery and possibly<br />

avoiding the need for permanent stoma and enabling organ<br />

preservation. This is possible only with high quality<br />

imaging techniques to assess the loco-regional disease.<br />

832 February 21, 2011|Volume 17|Issue 7|

---

CONCLUSION<br />

Imaging in <strong>rectal</strong> <strong>cancer</strong> helps in deciding the treatment and<br />

determining the prognosis. The newer techniques help in<br />

superior image resolution, three-dimensional viewing, with<br />

decreased image acquisition times, minimal bowel preparation,<br />

and sometimes with functional qualities. This may be<br />

important following neo-adjuvant treatment. The most accurate<br />

method <strong>of</strong> <strong>rectal</strong> wall staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> is endo<strong>rectal</strong><br />

ultrasound and MRI but accurate staging <strong>of</strong> meso<strong>rectal</strong><br />

fascia and lymph nodes is by phased array MRI. The<br />

management <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> is based on the proximity <strong>of</strong><br />

the tumor to the meso<strong>rectal</strong> fascia. Hence the phased array<br />

MRI is the best overall technique for local staging <strong>of</strong> <strong>rectal</strong><br />

<strong>cancer</strong>. Neoadjuvant treatment is not without risks; hence<br />

careful staging is important in obtaining good oncological<br />

and functional results and improving patient experience in<br />

the management <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. In symptomatic patients<br />

local excision is beneficial in only 5% and this is the group<br />

which benefits most from EUS. With the introduction <strong>of</strong><br />

colo<strong>rectal</strong> screening it is felt nearly 50% <strong>of</strong> <strong>cancer</strong>s may be<br />

<strong>of</strong> early <strong>stage</strong> disease which can be identified by EUS and<br />

managed by organ preserving intervention. Hence the role<br />

<strong>of</strong> EUS is likely to increase as part <strong>of</strong> the staging investigations<br />

in future and all these investigations are complementary<br />

in the management <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>.<br />

ACKNOWLEDGMENTS<br />

The authors would like to thank Dr. M Tee, Consultant<br />

Radiologist, Mid Cheshire Hospitals NHS Foundation<br />

Trust for providing the images used in this manuscript.<br />

REFERENCES<br />

1 WHO, Cancer, fact sheet number 297, <strong>World</strong> Health Organization,<br />

Geneva. 2009<br />

2 Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics,<br />

2009. CA Cancer J Clin 2009; 59: 225-249<br />

3 Cancer Research UK, By <strong>stage</strong> at diagnosis, Cancer Research<br />

UK, London. 2009<br />

4 Hayne D, Brown RS, McCormack M, Quinn MJ, Payne HA,<br />

Babb P. Current trends in colo<strong>rectal</strong> <strong>cancer</strong>: site, incidence,<br />

mortality and survival in England and Wales. Clin Oncol (R<br />

Coll Radiol) 2001; 13: 448-452<br />

5 Salerno G, Daniels IR, Moran BJ, Wotherspoon A, Brown G.<br />

Clarifying margins in the multidisciplinary management <strong>of</strong><br />

<strong>rectal</strong> <strong>cancer</strong>: the MERCURY experience. Clin Radiol 2006; 61:<br />

916-923<br />

6 Phillips RK, Hittinger R, Blesovsky L, Fry JS, Fielding LP.<br />

Local recurrence following 'curative' surgery for large bowel<br />

<strong>cancer</strong>: II. The rectum and rectosigmoid. Br J Surg 1984; 71:<br />

17-20<br />

7 Heald RJ. The 'Holy Plane' <strong>of</strong> <strong>rectal</strong> surgery. J R Soc Med<br />

1988; 81: 503-508<br />

8 Hospers GA, Punt CJ, Tesselaar ME, Cats A, Havenga K,<br />

Leer JW, Marijnen CA, Jansen EP, Van Krieken HH, Wiggers<br />

T, Van de Velde CJ, Mulder NH. Preoperative chemoradiotherapy<br />

with capecitabine and oxaliplatin in locally advanced<br />

<strong>rectal</strong> <strong>cancer</strong>. A phase I-II multicenter study <strong>of</strong> the Dutch<br />

Colo<strong>rectal</strong> Cancer Group. Ann Surg Oncol 2007; 14: 2773-2779<br />

9 Smith N, Brown G. Preoperative staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. Acta<br />

Oncol 2008; 47: 20-31<br />

10 McSherry CK, Cornell GN, Glenn F. Carcinoma <strong>of</strong> the colon<br />

WJG|www.wjgnet.com<br />

Samee A et al . Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

and rectum. Ann Surg 1969; 169: 502-509<br />

11 Tho LM, Glegg M, Paterson J, Yap C, MacLeod A, McCabe M,<br />

McDonald AC. Acute small bowel toxicity and preoperative<br />

chemoradiotherapy for <strong>rectal</strong> <strong>cancer</strong>: investigating dose-volume<br />

relationships and role for inverse planning. Int J Radiat<br />

Oncol Biol Phys 2006; 66: 505-513<br />

12 Beets-Tan RG, Beets GL, Borstlap AC, Oei TK, Teune TM,<br />

von Meyenfeldt MF, van Engelshoven JM. Preoperative assessment<br />

<strong>of</strong> local tumor extent in advanced <strong>rectal</strong> <strong>cancer</strong>: CT<br />

or high-resolution MRI? Abdom Imaging 2000; 25: 533-541<br />

13 Rifkin MD, Ehrlich SM, Marks G. Staging <strong>of</strong> <strong>rectal</strong> carcinoma:<br />

prospective comparison <strong>of</strong> endo<strong>rectal</strong> US and CT. Radiology<br />

1989; 170: 319-322<br />

14 Kwok H, Bissett IP, Hill GL. Preoperative staging <strong>of</strong> <strong>rectal</strong><br />

<strong>cancer</strong>. Int J Colo<strong>rectal</strong> Dis 2000; 15: 9-20<br />

15 Maizlin ZV, Brown JA, So G, Brown C, Phang TP, Walker<br />

ML, Kirby JM, Vora P, Tiwari P. Can CT replace MRI in preoperative<br />

assessment <strong>of</strong> the circumferential resection margin<br />

in <strong>rectal</strong> <strong>cancer</strong>? Dis Colon Rectum 2010; 53: 308-314<br />

16 Burling D. CT colonography standards. Clin Radiol 2010; 65:<br />

474-480<br />

17 Rosman AS, Korsten MA. Meta-analysis comparing CT colonography,<br />

air contrast barium enema, and colonoscopy. Am J<br />

Med 2007; 120: 203-210.e4<br />

18 Taylor SA, Robinson C, Boone D, Honeyfield L, Halligan S.<br />

Polyp characteristics correctly annotated by computer-aided<br />

detection s<strong>of</strong>tware but ignored by reporting radiologists during<br />

CT colonography. Radiology 2009; 253: 715-723<br />

19 Halligan S, Lilford RJ, Wardle J, Morton D, Rogers P,<br />

Wooldrage K, Edwards R, Kanani R, Shah U, Atkin W. Design<br />

<strong>of</strong> a multicentre randomized trial to evaluate CT colonography<br />

versus colonoscopy or barium enema for diagnosis<br />

<strong>of</strong> colonic <strong>cancer</strong> in older symptomatic patients: the SIGGAR<br />

study. Trials 2007; 8: 32<br />

20 Guinet C, Buy JN, Ghossain MA, Sézeur A, Mallet A, Bigot<br />

JM, Vadrot D, Ecoiffier J. Comparison <strong>of</strong> magnetic resonance<br />

imaging and computed tomography in the preoperative staging<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. Arch Surg 1990; 125: 385-388<br />

21 Brown G, Radcliffe AG, Newcombe RG, Dallimore NS,<br />

Bourne MW, Williams GT. Preoperative assessment <strong>of</strong> prognostic<br />

factors in <strong>rectal</strong> <strong>cancer</strong> using high-resolution magnetic<br />

resonance imaging. Br J Surg 2003; 90: 355-364<br />

22 Beets-Tan RG, Beets GL, Vliegen RF, Kessels AG, Van Boven<br />

H, De Bruine A, von Meyenfeldt MF, Baeten CG, van Engelshoven<br />

JM. Accuracy <strong>of</strong> magnetic resonance imaging in<br />

prediction <strong>of</strong> tumour-free resection margin in <strong>rectal</strong> <strong>cancer</strong><br />

surgery. Lancet 2001; 357: 497-504<br />

23 Diagnostic accuracy <strong>of</strong> preoperative magnetic resonance<br />

imaging in predicting curative resection <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>: prospective<br />

observational study. BMJ 2006; 333: 779<br />

24 Brown G. Thin section MRI in multidisciplinary pre-operative<br />

decision making for patients with <strong>rectal</strong> <strong>cancer</strong>. Br J Radiol<br />

2005; 78 Spec No 2: S117-S127<br />

25 Taylor FG, Swift RI, Blomqvist L, Brown G. A systematic approach<br />

to the interpretation <strong>of</strong> preoperative staging MRI for<br />

<strong>rectal</strong> <strong>cancer</strong>. AJR Am J Roentgenol 2008; 191: 1827-1835<br />

26 Hussain SM, Outwater EK, Siegelman ES. Mucinous versus<br />

nonmucinous <strong>rectal</strong> carcinomas: differentiation with MR imaging.<br />

Radiology 1999; 213: 79-85<br />

27 Vliegen RF, Beets GL, von Meyenfeldt MF, Kessels AG, Lemaire<br />

EE, van Engelshoven JM, Beets-Tan RG. Rectal <strong>cancer</strong>:<br />

MR imaging in local staging--is gadolinium-based contrast<br />

material helpful? Radiology 2005; 234: 179-188<br />

28 Brown G, Richards CJ, Newcombe RG, Dallimore NS, Radcliffe<br />

AG, Carey DP, Bourne MW, Williams GT. Rectal carcinoma:<br />

thin-section MR imaging for staging in 28 patients.<br />

Radiology 1999; 211: 215-222<br />

29 Chen CC, Lee RC, Lin JK, Wang LW, Yang SH. How accurate<br />

is magnetic resonance imaging in restaging <strong>rectal</strong> <strong>cancer</strong> in<br />

patients receiving preoperative combined chemoradiotherapy?<br />

Dis Colon Rectum 2005; 48: 722-728<br />

30 Ross A, Rusnak C, Weinerman B, Kuechler P, Hayashi A,<br />

833 February 21, 2011|Volume 17|Issue 7|

---

Samee A et al . Current trends in staging <strong>rectal</strong> <strong>cancer</strong><br />

MacLachlan G, Frew E, Dunlop W. Recurrence and survival<br />

after surgical management <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. Am J Surg 1999;<br />

177: 392-395<br />

31 Talbot IC, Ritchie S, Leighton MH, Hughes AO, Bussey HJ,<br />

Morson BC. The clinical significance <strong>of</strong> invasion <strong>of</strong> veins by<br />

<strong>rectal</strong> <strong>cancer</strong>. Br J Surg 1980; 67: 439-442<br />

32 Smith NJ, Shihab O, Arnaout A, Swift RI, Brown G. MRI for<br />

detection <strong>of</strong> extramural vascular invasion in <strong>rectal</strong> <strong>cancer</strong>.<br />

AJR Am J Roentgenol 2008; 191: 1517-1522<br />

33 Dzik-Jurasz A, Domenig C, George M, Wolber J, Padhani A,<br />

Brown G, Doran S. Diffusion MRI for prediction <strong>of</strong> response<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> to chemoradiation. Lancet 2002; 360: 307-308<br />

34 Hünerbein M, Pegios W, Rau B, Vogl TJ, Felix R, Schlag PM.<br />

Prospective comparison <strong>of</strong> endo<strong>rectal</strong> ultrasound, three-dimensional<br />

endo<strong>rectal</strong> ultrasound, and endo<strong>rectal</strong> MRI in the<br />

preoperative evaluation <strong>of</strong> <strong>rectal</strong> tumors. Preliminary results.<br />

Surg Endosc 2000; 14: 1005-1009<br />

35 Koh DM, Brown G, Temple L, Raja A, Toomey P, Bett N,<br />

Norman AR, Husband JE. Rectal <strong>cancer</strong>: meso<strong>rectal</strong> lymph<br />

nodes at MR imaging with USPIO versus histopathologic<br />

findings--initial observations. Radiology 2004; 231: 91-99<br />

36 Grace RH, Hale M, Mackie G, Marks CG, Bloomberg TJ,<br />

Walker WJ. Role <strong>of</strong> ultrasound in the diagnosis <strong>of</strong> liver metastases<br />

before surgery for large bowel <strong>cancer</strong>. Br J Surg 1987;<br />

74: 480-481<br />

37 Rafaelsen SR, Kronborg O, Larsen C, Fenger C. Intraoperative<br />

ultrasonography in detection <strong>of</strong> hepatic metastases from<br />

colo<strong>rectal</strong> <strong>cancer</strong>. Dis Colon Rectum 1995; 38: 355-360<br />

38 Akasu T, Kondo H, Moriya Y, Sugihara K, Gotoda T, Fujita<br />

S, Muto T, Kakizoe T. Endo<strong>rectal</strong> ultrasonography and<br />

treatment <strong>of</strong> early <strong>stage</strong> <strong>rectal</strong> <strong>cancer</strong>. <strong>World</strong> J Surg 2000; 24:<br />

1061-1068<br />

39 Garcia-Aguilar J, Pollack J, Lee SH, Hernandez de Anda E,<br />

Mellgren A, Wong WD, Finne CO, Rothenberger DA, Mad<strong>of</strong>f<br />

RD. Accuracy <strong>of</strong> endo<strong>rectal</strong> ultrasonography in preoperative<br />

staging <strong>of</strong> <strong>rectal</strong> tumors. Dis Colon Rectum 2002; 45: 10-15<br />

40 Gualdi GF, Casciani E, Guadalaxara A, d'Orta C, Polettini E,<br />

Pappalardo G. Local staging <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> with trans<strong>rectal</strong><br />

ultrasound and endo<strong>rectal</strong> magnetic resonance imaging:<br />

comparison with histologic findings. Dis Colon Rectum 2000;<br />

43: 338-345<br />

41 Hulsmans FJ, Tio TL, Fockens P, Bosma A, Tytgat GN. Assessment<br />

<strong>of</strong> tumor infiltration depth in <strong>rectal</strong> <strong>cancer</strong> with<br />

trans<strong>rectal</strong> sonography: caution is necessary. Radiology 1994;<br />

190: 715-720<br />

42 Rifkin MD, Ehrlich SM, Marks G. Staging <strong>of</strong> <strong>rectal</strong> carcinoma:<br />

prospective comparison <strong>of</strong> endo<strong>rectal</strong> US and CT. Radiology<br />

1989; 170: 319-322<br />

43 Bipat S, Glas AS, Slors FJ, Zwinderman AH, Bossuyt PM,<br />

Stoker J. Rectal <strong>cancer</strong>: local staging and assessment <strong>of</strong> lymph<br />

node involvement with endoluminal US, CT, and MR imaging--a<br />

meta-analysis. Radiology 2004; 232: 773-783<br />

44 Mackay SG, Pager CK, Joseph D, Stewart PJ, Solomon MJ.<br />

Assessment <strong>of</strong> the accuracy <strong>of</strong> trans<strong>rectal</strong> ultrasonography in<br />

ano<strong>rectal</strong> neoplasia. Br J Surg 2003; 90: 346-350<br />

45 Schaffzin DM, Wong WD. Endo<strong>rectal</strong> ultrasound in the<br />

preoperative evaluation <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. Clin Colo<strong>rectal</strong> Cancer<br />

2004; 4: 124-132<br />

46 Solomon MJ, McLeod RS. Endoluminal trans<strong>rectal</strong> ultrasonography:<br />

accuracy, reliability, and validity. Dis Colon Rectum<br />

1993; 36: 200-205<br />

47 Skandarajah AR, Tjandra JJ. Preoperative loco-regional imaging<br />

in <strong>rectal</strong> <strong>cancer</strong>. ANZ J Surg 2006; 76: 497-504<br />

48 Bipat S, Glas AS, Slors FJ, Zwinderman AH, Bossuyt PM,<br />

Stoker J. Rectal <strong>cancer</strong>: local staging and assessment <strong>of</strong> lymph<br />

node involvement with endoluminal US, CT, and MR imaging--a<br />

meta-analysis. Radiology 2004; 232: 773-783<br />

WJG|www.wjgnet.com<br />

49 Lahaye MJ, Engelen SM, Nelemans PJ, Beets GL, van de<br />

Velde CJ, van Engelshoven JM, Beets-Tan RG. Imaging for<br />

predicting the risk factors--the circumferential resection margin<br />

and nodal disease--<strong>of</strong> local recurrence in <strong>rectal</strong> <strong>cancer</strong>: a<br />

meta-analysis. Semin Ultrasound CT MR 2005; 26: 259-268<br />

50 Garcia-Aguilar J, Pollack J, Lee SH, Hernandez de Anda E,<br />

Mellgren A, Wong WD, Finne CO, Rothenberger DA, Mad<strong>of</strong>f<br />

RD. Accuracy <strong>of</strong> endo<strong>rectal</strong> ultrasonography in preoperative<br />

staging <strong>of</strong> <strong>rectal</strong> tumors. Dis Colon Rectum 2002; 45: 10-15<br />

51 Rieger N, Tjandra J, Solomon M. Endoanal and endo<strong>rectal</strong> ultrasound:<br />

applications in colo<strong>rectal</strong> surgery. ANZ J Surg 2004;<br />

74: 671-675<br />

52 Zammit M, Jenkins JT, Urie A, O'Dwyer PJ, Molloy RG. A<br />

technically difficult endo<strong>rectal</strong> ultrasound is more likely to be<br />

inaccurate. Colo<strong>rectal</strong> Dis 2005; 7: 486-491<br />

53 Akasu T, Sugihara K, Moriya Y, Fujita S. Limitations and<br />

pitfalls <strong>of</strong> trans<strong>rectal</strong> ultrasonography for staging <strong>of</strong> <strong>rectal</strong><br />

<strong>cancer</strong>. Dis Colon Rectum 1997; 40: S10-S15<br />

54 Saftoiu A, Gheonea DI. Tridimensional (3D) endoscopic ultrasound<br />

- a pictorial review. J Gastrointestin Liver Dis 2009;<br />

18: 501-505<br />

55 Strauss LG. Fluorine-18 deoxyglucose and false-positive<br />

results: a major problem in the diagnostics <strong>of</strong> oncological patients.<br />

Eur J Nucl Med 1996; 23: 1409-1415<br />

56 Cho YB, Chun HK, Kim MJ, Choi JY, Park CM, Kim BT, Lee<br />

SJ, Yun SH, Kim HC, Lee WY. Accuracy <strong>of</strong> MRI and 18F-FDG<br />

PET/CT for restaging after preoperative concurrent chemoradiotherapy<br />

for <strong>rectal</strong> <strong>cancer</strong>. <strong>World</strong> J Surg 2009; 33: 2688-2694<br />

57 Joyce DL, Wahl RL, Patel PV, Schulick RD, Gearhart SL,<br />

Choti MA. Preoperative positron emission tomography to<br />

evaluate potentially resectable hepatic colo<strong>rectal</strong> metastases.<br />

Arch Surg 2006; 141: 1220-1226; discussion 1227<br />

58 Heriot AG, Hicks RJ, Drummond EG, Keck J, Mackay J, Chen<br />

F, Kalff V. Does positron emission tomography change management<br />

in primary <strong>rectal</strong> <strong>cancer</strong>? A prospective assessment.<br />

Dis Colon Rectum 2004; 47: 451-458<br />

59 Gearhart SL, Frassica D, Rosen R, Choti M, Schulick R, Wahl<br />

R. Improved staging with pretreatment positron emission tomography/computed<br />

tomography in low <strong>rectal</strong> <strong>cancer</strong>. Ann<br />

Surg Oncol 2006; 13: 397-404<br />

60 Maor Y, Nadler M, Barshack I, Zmora O, Koller M, Kundel Y,<br />

Fidder H, Bar-Meir S, Avidan B. Endoscopic ultrasound staging<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>: diagnostic value before and following<br />

chemoradiation. J Gastroenterol Hepatol 2006; 21: 454-458<br />

61 Denecke T, Rau B, H<strong>of</strong>fmann KT, Hildebrandt B, Ruf J, Gutberlet<br />

M, Hünerbein M, Felix R, Wust P, Amthauer H. Comparison<br />

<strong>of</strong> CT, MRI and FDG-PET in response prediction <strong>of</strong><br />

patients with locally advanced <strong>rectal</strong> <strong>cancer</strong> after multimodal<br />

preoperative therapy: is there a benefit in using functional<br />

imaging? Eur Radiol 2005; 15: 1658-1666<br />

62 Kim JH, Beets GL, Kim MJ, Kessels AG, Beets-Tan RG. Highresolution<br />

MR imaging for nodal staging in <strong>rectal</strong> <strong>cancer</strong>: are<br />

there any criteria in addition to the size? Eur J Radiol 2004; 52:<br />

78-83<br />

63 Brown G, Richards CJ, Bourne MW, Newcombe RG, Radcliffe<br />

AG, Dallimore NS, Williams GT. Morphologic predictors<br />

<strong>of</strong> lymph node status in <strong>rectal</strong> <strong>cancer</strong> with use <strong>of</strong> highspatial-resolution<br />

MR imaging with histopathologic comparison.<br />

Radiology 2003; 227: 371-377<br />

64 O'Neill BD, Brown G, Heald RJ, Cunningham D, Tait DM.<br />

Non-operative treatment after neoadjuvant chemoradiotherapy<br />

for <strong>rectal</strong> <strong>cancer</strong>. Lancet Oncol 2007; 8: 625-633<br />

65 Habr-Gama A, Perez RO, Nadalin W, Sabbaga J, Ribeiro U Jr,<br />

Silva e Sousa AH Jr, Campos FG, Kiss DR, Gama-Rodrigues<br />

J. Operative versus nonoperative treatment for <strong>stage</strong> 0 distal<br />

<strong>rectal</strong> <strong>cancer</strong> following chemoradiation therapy: long-term<br />

results. Ann Surg 2004; 240: 711-717; discussion 717-718<br />

S- Editor Sun H L- Editor O’Neill M E- Editor Ma WH<br />

834 February 21, 2011|Volume 17|Issue 7|

---

Ronnekleiv-Kelly SM et al . Palliation in <strong>rectal</strong> <strong>cancer</strong><br />

aggressive operative intervention is warranted can ensure<br />

the most appropriate treatment strategy is devised. The<br />

goals in palliation should include the alleviation <strong>of</strong> symptoms,<br />

enhancing quality <strong>of</strong> life and improving comfort [5] .<br />

Herein, we review the current relevant literature on various<br />

treatment strategies as they are related to the palliative<br />

treatment <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>.<br />

EVALUATION<br />

Rectal <strong>cancer</strong> is defined as a malignant lesion within 15 cm<br />

<strong>of</strong> the anal verge as seen by rigid proctoscopy [6-8] . Subsequent<br />

to histological confirmation <strong>of</strong> diagnosis via tumor<br />

biopsy, initial work-up <strong>of</strong> the extent <strong>of</strong> disease guides<br />

subsequent treatment [4,9] . Proper staging is essential as decisions<br />

regarding neoadjuvant versus adjuvant therapy and<br />

operative versus palliative surgical intent will be based on<br />

clinical <strong>stage</strong>. The patient should undergo proctoscopy to<br />

determine distance from anal verge, as well as colonoscopy<br />

to interrogate the entire colon for synchronous lesions.<br />

Cross-sectional imaging <strong>of</strong> the chest, abdomen and pelvis<br />

in conjunction with endoscopic ultrasound (EUS) can<br />

assess depth <strong>of</strong> tumor penetration or invasion <strong>of</strong> local<br />

structures, lymph node status, and presence <strong>of</strong> metastatic<br />

disease [9,10] . Although EUS has appropriate sensitivity and<br />

specificity for differentiating muscularis propria invasion<br />

(94% and 86%), as well as peri<strong>rectal</strong> tissue invasion (90%<br />

and 75%), magnetic resonance imaging (MRI) has proven<br />

to be an important adjunct for accurate staging <strong>of</strong> <strong>rectal</strong><br />

<strong>cancer</strong> as well [9,11,12] . MRI has been found to have an 85%<br />

diagnostic accuracy for T-<strong>stage</strong> with 57%-85% accuracy for<br />

correctly identifying spread to lymph nodes; furthermore,<br />

the relationship to meso<strong>rectal</strong> fascia in conjunction with detection<br />

<strong>of</strong> adjacent organ invasion is superior utilizing MRI<br />

versus EUS [13-18] . In addition to imaging, a preoperative<br />

carcinoembryonic antigen level combined with basic laboratory<br />

values, comprehensive history and complete physical<br />

examination to assess performance status and comorbidity<br />

play important roles in the preoperative workup, because<br />

these factor significantly for choice <strong>of</strong> intervention [19] .<br />

When the pretreatment evaluation has determined a<br />

patient to no longer be appropriate for curative intent due<br />

to the presence <strong>of</strong> distant metastases or local invasion<br />

precluding a margin-negative resection, quality <strong>of</strong> life and<br />

symptom relief must become the main focus. In general,<br />

findings indicative <strong>of</strong> unresectability are utilized to predict<br />

the ability to achieve resection with negative margins. In<br />

those situations presented in Table 1, negative margins<br />

are obtained in 6%-36% <strong>of</strong> cases and surgical extirpation<br />

can result in significant postoperative disability [20] . However,<br />

resectability <strong>of</strong> the disease should be assessed by an<br />

experienced surgeon. In a study by Mathis et al [21] , patients<br />

who were initially deemed locally unresectable, secondary<br />

to advanced primary colon and <strong>rectal</strong> <strong>cancer</strong>, were<br />

treated with aggressive multimodal therapy and found to<br />

have median survival <strong>of</strong> 3.7 years. Conversely, decision<br />

stratification must be influenced by expected survival in<br />

those patients evaluated properly and determined not to<br />

be candidates for aggressive resection. Consideration <strong>of</strong><br />

WJG|www.wjgnet.com<br />

Table 1 Contraindications to resective operative intervention<br />

Sciatic nerve pain<br />

Bilateral ureteral obstruction<br />

Extensive fixation to lateral pelvic side wall (CT/MRI or trial dissection)<br />

Sacral involvement above S2 (resection produces spinal instability or<br />

post-operative complications)<br />

Bilateral lymphedema or bilateral venous thrombosis (indicating<br />

encasement <strong>of</strong> major vascular structures)<br />

Multiple peritoneal metastasis or metastasis fixed to or invading vital<br />

structures<br />

CT: Computed tomography; MRI: Magnetic resonance imaging.<br />

operative interventions is more appropriately included in<br />

the conversation <strong>of</strong> palliative treatment for patients with<br />

expected outcomes exceeding 6 mo [19,22-25] .<br />

Approximately 50% <strong>of</strong> patients either present with<br />

distant metastases or develop distant metastases after primary<br />

treatment. Those that cannot be treated curatively<br />

should have care guided by patient wishes, functional<br />

status, expected life duration, and extent <strong>of</strong> disease and<br />

debilitating symptoms. In a study by Law et al [26] , the most<br />

common presenting symptoms <strong>of</strong> patients undergoing<br />

palliative intervention for colo<strong>rectal</strong> <strong>cancer</strong> were intestinal<br />

obstruction and <strong>rectal</strong> bleeding. In another study, 42% <strong>of</strong><br />

patients presenting for palliative treatment were obstructed,<br />

37% <strong>of</strong> patients experienced <strong>rectal</strong> bleeding, and 5%<br />

were asymptomatic, with the remainder (16%) experiencing<br />

pain or <strong>rectal</strong> discharge [27] . Taking into consideration<br />

the presenting symptoms and the underlying condition<br />

<strong>of</strong> the patient, palliative management can be divided into<br />

operative versus non-operative treatment.<br />

CLINICAL SCENARIOS AND<br />

MANAGEMENT OPTIONS<br />

Obstruction<br />

Patients with <strong>rectal</strong> <strong>cancer</strong> can present with any number<br />

<strong>of</strong> symptoms that prompt evaluation (e.g. bleeding,<br />

perforation, abdominal pain, anemia, hematochezia,<br />

tenesmus, and malaise) and 10%-25% <strong>of</strong> patients present<br />

with obstructive symptoms [19,22,26,28] . Such a clinical<br />

scenario requires expedient yet thorough evaluation <strong>of</strong><br />

the patient for resectability and potential for cure, because<br />

these patients <strong>of</strong>ten necessitate urgent, if not emergency,<br />

surgical intervention [28] . Rosen retrospectively analyzed<br />

116 patients initially presenting with <strong>stage</strong> IV colo<strong>rectal</strong><br />

<strong>cancer</strong> and found that 26% presented with obstructive<br />

symptoms [22] . In another study, although the most common<br />

symptom precipitating medical evaluation in advanced<br />

colo<strong>rectal</strong> <strong>cancer</strong> was bleeding (24%), Law et al [26]<br />

found that obstruction (23%) in conjunction with change<br />

in bowel habits (15%) comprised a significant proportion<br />

<strong>of</strong> patient presentations. Phang et al [29] found that nearly<br />

10% <strong>of</strong> patients with <strong>rectal</strong> <strong>cancer</strong> presented with a bowel<br />

obstruction and required some emergency intervention.<br />

In that series, patients who underwent primary resection<br />

<strong>of</strong> the tumor at the time <strong>of</strong> emergency surgery had<br />

836 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.848<br />

Imran Hassan, MD, Assistant Pr<strong>of</strong>essor, Series Editor<br />

Neoadjuvant vs adjuvant pelvic radiotherapy for locally<br />

advanced <strong>rectal</strong> <strong>cancer</strong>: Which is superior?<br />

Sarah Popek, Vassiliki Liana Tsikitis<br />

Sarah Popek, Vassiliki Liana Tsikitis, Department <strong>of</strong> Surgery,<br />

University <strong>of</strong> Arizona, Tucson, AZ 85724, United States<br />

Author contributions: All authors contributed equally to this<br />

work; all authors analyzed the data and wrote the paper.<br />

Correspondence to: Vassiliki Liana Tsikitis, MD, Assistant<br />

Pr<strong>of</strong>essor, Department <strong>of</strong> Surgery, University <strong>of</strong> Arizona, 1515<br />

N Campbell Ave, Tucson, AZ 85724,<br />

United States. ltsikitis@surgery.arizona.edu<br />

Telephone: +1-520-6266788 Fax: +1-520-6262191<br />

Received: August 30, 2010 Revised: September 29, 2010<br />

Accepted: October 6, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

The treatment <strong>of</strong> locally advanced <strong>rectal</strong> <strong>cancer</strong> including<br />

timing and dosage <strong>of</strong> radiotherapy, degree <strong>of</strong><br />

sphincter preservation with neoadjuvant radiotherapy,<br />

and short and long term effects <strong>of</strong> radiotherapy are controversial<br />

topics. The MEDLINE, Cochrane Library databases,<br />

and meeting proceedings from the American Society<br />

<strong>of</strong> Clinical Oncology, were searched for reports <strong>of</strong><br />

randomized controlled trials and meta-analyses comparing<br />

neoadjuvant and adjuvant radiotherapy with surgery<br />

to surgery alone for <strong>rectal</strong> <strong>cancer</strong>. Neoadjuvant radiotherapy<br />

shows superior results in terms <strong>of</strong> local control<br />

compared to adjuvant radiotherapy. Neither adjuvant<br />

or neoadjuvant radiotherapy impacts overall survival.<br />

Short course versus long course neoadjuvant radiotherapy<br />

remains controversial. There is insufficient data<br />

to conclude that neoadjuvant therapy improves rates<br />

<strong>of</strong> sphincter preserving surgery. Radiation significantly<br />

impacts ano<strong>rectal</strong> and sexual function and includes both<br />

acute and long term toxicity. Data demonstrate that<br />

neoadjuvant radiation causes less toxicity compared<br />

to adjuvant radiotherapy, and specifically short course<br />

neoadjuvant radiation results in less toxicity than long<br />

course neoadjuvant radiation. Neoadjuvant radiotherapy<br />

is the preferred modality for administering radiation in<br />

WJG|www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 848-854<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

locally advanced <strong>rectal</strong> <strong>cancer</strong>. There are significant side<br />

effects from radiation, including ano<strong>rectal</strong> and sexual<br />

dysfunction, which may be less with short course neoadjuvant<br />

radiation.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Locally advanced <strong>rectal</strong> <strong>cancer</strong>; Neoadjuvant<br />

radiation; Adjuvant radiation; Rectal neoplasm;<br />

Chemoradiotherapy; Neoadjuvant chemoradiotherapy<br />

Peer reviewer: Paul E Sijens, PhD, Associate Pr<strong>of</strong>essor, Radiology,<br />

UMCG, Hanzeplein 1, 9713GZ Groningen, The Netherlands<br />

Popek S, Tsikitis VL. Neoadjuvant vs adjuvant pelvic radiotherapy<br />

for locally advanced <strong>rectal</strong> <strong>cancer</strong>: Which is superior?<br />

<strong>World</strong> J Gastroenterol 2011; 17(7): 848-854 Available from:<br />

URL: http://www.wjgnet.com/1007-9327/full/v17/i7/848.htm<br />

DOI: http://dx.doi.org/10.3748/wjg.v17.i7.848<br />

INTRODUCTION<br />

TOPIC HIGHLIGHT<br />

Colo<strong>rectal</strong> <strong>cancer</strong> is the third most frequent <strong>cancer</strong> in men<br />

and women. In 2009, in the United States 40 000 new cases<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> alone were diagnosed [1] . The past 2 decades<br />

have seen many advances in the treatment <strong>of</strong> patients with<br />

<strong>rectal</strong> <strong>cancer</strong>. Surgery remains the mainstay. The standard <strong>of</strong><br />

surgical care now includes total meso<strong>rectal</strong> excision (TME),<br />

which was shown to significantly decrease local recurrence<br />

rates [2] . Evolution <strong>of</strong> Combined Modality Treatment<br />

(CMT) revolutionized care <strong>of</strong> locally advanced <strong>rectal</strong> <strong>cancer</strong><br />

with the most considerable change the introduction<br />

<strong>of</strong> pelvic radiation. Improvements in preoperative staging<br />

with endo<strong>rectal</strong> ultrasound and magnetic resonance imaging<br />

have allowed experimentation with different regimens<br />

<strong>of</strong> neoadjuvant (preoperative) and adjuvant (postoperative)<br />

radiotherapy (RT).<br />

The goals <strong>of</strong> this review are to provide a critical over-<br />

848 February 21, 2011|Volume 17|Issue 7|

---

Popek S et al . Neoadjuvant vs adjuvant radiotherapy for <strong>rectal</strong> <strong>cancer</strong><br />

61% <strong>of</strong> patients in the RT arm and 58% in the CMT arm<br />

underwent sphincter-preserving surgery (P = 0.57). In<br />

conclusion, although short-course RT improves local control,<br />

no strong evidence exists that it also improves rates<br />

<strong>of</strong> sphincter-preserving surgery indicating short-course<br />

neoadjuvant RT does not have a significant effect on preoperative<br />

tumor downsizing or downstaging.<br />

A significant benefit <strong>of</strong> neoadjuvant RT is patient compliance<br />

with treatment. Adjuvant RT has been associated<br />

with higher rates <strong>of</strong> treatment interruption. Lebwohl et al [25]<br />

assessed for principle factors associated with treatment interruption<br />

in 113 RT patients. Patients in the adjuvant arm<br />

had a significantly increased chance <strong>of</strong> RT interruption, as<br />

compared with the neoadjuvant RT arm (OR, 14.08, CI:<br />

1.55-127.87). Development <strong>of</strong> an adverse event was also<br />

significantly correlated with RT interruption (OR, 20.66,<br />

CI: 1.76-242).<br />

ANORECTAL FUNCTION OUTCOMES<br />

One <strong>of</strong> the most important variables evaluating quality<br />

<strong>of</strong> life in <strong>rectal</strong> <strong>cancer</strong> is ano<strong>rectal</strong> function, specifically<br />

bowel function and sexual function [26] . This is affected by<br />

both chemoradiation and surgical technique. The Dutch<br />

colo<strong>rectal</strong> group assessed ano<strong>rectal</strong> functional outcomes<br />

after short-course preoperative RT and TME and found<br />

significant differences between patients who did vs did<br />

not undergo RT [27] . RT patients had higher rates <strong>of</strong> fecal<br />

incontinence (62% with RT vs 38% without, P < 0.001),<br />

pad wearing as a result <strong>of</strong> incontinence (56% vs 33%, P<br />

< 0.001), and anal blood loss (11% vs 3%, P = 0.004). RT<br />

patients also reported significantly lower satisfaction with<br />

bowel function.<br />

A second prospective study randomized 316 patients to<br />

(1) short-course neoadjuvant RT or (2) long-course neoadjuvant<br />

chemoradiation [26] . The goal was to evaluate ano<strong>rectal</strong><br />

and sexual dysfunction and quality <strong>of</strong> life. Early complications<br />

were more common in the chemoradiation arm, but<br />

no significant differences were found in the degree <strong>of</strong> ano<strong>rectal</strong><br />

and sexual function or in quality <strong>of</strong> life.<br />

In addition to bowel and sexual dysfunction, RT patients<br />

may experience acute and late RT toxicity, including<br />

nausea/vomiting, postoperative hernia, femoral neck<br />

fracture, skin problems (nonhealing perineal wounds), ileus,<br />

anastomotic stricture, and fistula. The Dutch colo<strong>rectal</strong><br />

group assessed RT toxicity, intraoperative and postoperative<br />

complications, and other variables in patients who<br />

underwent short-course neoadjuvant RT vs TME alone [27] .<br />

No differences were found in operative time, intraoperative<br />

complications, or hospital stay; however, the amount<br />

<strong>of</strong> intraoperative blood loss was higher in the RT arm<br />

(P < 0.001). Rates <strong>of</strong> perineal complications were also<br />

higher (29% with RT vs 18% with TME alone, P = 0.008).<br />

But no significant differences were found in the rate <strong>of</strong><br />

abdominal wound complications (4.0% with RT vs 3.3%<br />

with TME alone) or in the overall postoperative mortality<br />

rate.<br />

Frykholm et al [28] looked at long-term complications<br />

WJG|www.wjgnet.com<br />

(minimum follow-up time, 5 years) after either neoadjuvant<br />

short-course RT (n = 255) or adjuvant long-course<br />

RT (n = 127), as compared with surgery alone (control<br />

group, n = 82). Long-term complications (defined as occurring<br />

at least 6 mo postoperatively) included recurrent<br />

abdominal pain, diarrhea, fecal incontinence, ileus, cystitis,<br />

paresthesias, delayed wound healing, and any neurologic<br />

dysfunction. The percentage <strong>of</strong> patients with small bowel<br />

obstruction did not significantly differ between the neoadjuvant<br />

RT group and control group. In the adjuvant<br />

RT group, the risk <strong>of</strong> developing a small bowel obstruction<br />

was significantly higher (P < 0.01). Overall, the frequency<br />

<strong>of</strong> complications possibly related to RT in the<br />

neoadjuvant group was 20%; in the adjuvant group, 41%.<br />

However, in the control group, the percentage <strong>of</strong> similar<br />

complications was 23%. In addition to finding a significant<br />

decrease in local recurrence after neoadjuvant shortcourse<br />

RT (13% in the neoadjuvant group vs 22% in the<br />

adjuvant group, P = 0.02), the cumulative risk <strong>of</strong> bowel<br />

obstruction was significantly higher in the adjuvant group.<br />

Minsky et al [29] also demonstrated significantly lower<br />

rates <strong>of</strong> adverse events and improved compliance in patients<br />

treated with neoadjuvant CMT compared to patients<br />

treated with adjuvant CMT. Despite receiving higher doses<br />

<strong>of</strong> chemotherapy, the neoadjuvant arm experienced a<br />

13% incidence <strong>of</strong> acute grade 3 or 4 toxicity compared to<br />

a 48% incidence in the adjuvant arm (P = 0.045). A metaanalysis<br />

by Birgisson et al [30] found that the most common<br />

late adverse effects <strong>of</strong> RT were bowel obstruction, bowel<br />

dysfunction (fecal incontinence), and sexual dysfunction.<br />

Several different RT regimens were included in the metaanalysis,<br />

<strong>of</strong>fering some insight into how complications<br />

correlated with dosage. Overall, in the more recent studies<br />

which used lower doses and better techniques, the rates<br />

<strong>of</strong> adverse events were lower. Unfortunately, to date, no<br />

specific markers have been identified that might help predict<br />

which patients have a higher risk <strong>of</strong> acute RT toxicity.<br />

Further work is needed in this important area <strong>of</strong> ongoing<br />

research.<br />

CONCLUSION<br />

Patients with locally advanced <strong>rectal</strong> <strong>cancer</strong> clearly benefit,<br />

in terms <strong>of</strong> locoregional control, from both neoadjuvant<br />

and adjuvant RT; and patient compliance is better with<br />

neoadjuvant RT. No definitive evidence demonstrates the<br />

superiority <strong>of</strong> using short vs long-course RT.<br />

The current standard treatment for patients with locally<br />

advanced <strong>rectal</strong> <strong>cancer</strong> in the United States consists <strong>of</strong><br />

neoadjuvant radiation (45 to 55 Gy administered over 5 to<br />

6 wk), followed by neoadjuvant chemotherapy (5-FU-based<br />

infusion + leucovorin), surgery 6 to 8 wk after completion<br />

<strong>of</strong> chemotherapy, and additional adjuvant chemotherapy<br />

after surgery [31] . In contrast, the standard regimen in most<br />

<strong>of</strong> Europe is now neoadjuvant short-course RT. The<br />

most recent European Rectal Cancer Consensus Conference<br />

concluded that neoadjuvant short-course RT (25 Gy<br />

administered over 1 wk), especially when combined with<br />

852 February 21, 2011|Volume 17|Issue 7|

---

Popek S et al . Neoadjuvant vs adjuvant radiotherapy for <strong>rectal</strong> <strong>cancer</strong><br />

Oncol 2007; 84: 217-225<br />

27 Peeters KC, van de Velde CJ, Leer JW, Martijn H, Junggeburt<br />

JM, Kranenbarg EK, Steup WH, Wiggers T, Rutten HJ, Marijnen<br />

CA. Late side effects <strong>of</strong> short-course preoperative radiotherapy<br />

combined with total meso<strong>rectal</strong> excision for <strong>rectal</strong><br />

<strong>cancer</strong>: increased bowel dysfunction in irradiated patients-<br />

-a Dutch colo<strong>rectal</strong> <strong>cancer</strong> group study. J Clin Oncol 2005; 23:<br />

6199-6206<br />

28 Frykholm GJ, Glimelius B, Påhlman L. Preoperative or postoperative<br />

irradiation in adenocarcinoma <strong>of</strong> the rectum: final<br />

treatment results <strong>of</strong> a randomized trial and an evaluation <strong>of</strong><br />

late secondary effects. Dis Colon Rectum 1993; 36: 564-572<br />

29 Minsky BD, Cohen AM, Kemeny N, Enker WE, Kelsen DP,<br />

Reichman B, Saltz L, Sigurdson ER, Frankel J. Combined modality<br />

therapy <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>: decreased acute toxicity with<br />

WJG|www.wjgnet.com<br />

the preoperative approach. J Clin Oncol 1992; 10: 1218-1224<br />

30 Birgisson H, Påhlman L, Gunnarsson U, Glimelius B. Late<br />

adverse effects <strong>of</strong> radiation therapy for <strong>rectal</strong> <strong>cancer</strong> - a systematic<br />

overview. Acta Oncol 2007; 46: 504-516<br />

31 Wong RK, Tandan V, De Silva S, Figueredo A. Pre-operative<br />

radiotherapy and curative surgery for the management <strong>of</strong><br />

localized <strong>rectal</strong> carcinoma. Cochrane Database Syst Rev 2007;<br />

CD002102<br />

32 Valentini V, Aristei C, Glimelius B, Minsky BD, Beets-Tan R,<br />

Borras JM, Haustermans K, Maingon P, Overgaard J, Pahlman<br />

L, Quirke P, Schmoll HJ, Sebag-Montefiore D, Taylor I,<br />

Van Cutsem E, Van de Velde C, Cellini N, Latini P. Multidisciplinary<br />

Rectal Cancer <strong>Management</strong>: 2nd European Rectal<br />

Cancer Consensus Conference (EURECA-CC2). Radiother<br />

Oncol 2009; 92: 148-163<br />

S- Editor Sun H L- Editor O’Neill M E- Editor Zheng XM<br />

854 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.855<br />

Imran Hassan, MD, Assistant Pr<strong>of</strong>essor, Series Editor<br />

Sphincter preservation for distal <strong>rectal</strong> <strong>cancer</strong> - a goal<br />

worth achieving at all costs?<br />

Jürgen Mulsow, Des C Winter<br />

Jürgen Mulsow, Des C Winter, Institute for Clinical Outcomes<br />

Research and Education, St. Vincent’s University Hospital,<br />

Elm Park, Dublin 4, Ireland<br />

Author contributions: Mulsow J and Winter DC both contributed<br />

to the literature review and drafting <strong>of</strong> manuscript.<br />

Correspondence to: Des C Winter, Pr<strong>of</strong>essor, Institute for<br />

Clinical Outcomes Research and Education, St. Vincent’s University<br />

Hospital, Elm Park, Dublin 4, Ireland. winterd@indigo.ie<br />

Telephone: +353-1-2695033 Fax: +353-1-2609249<br />

Received: August 30, 2010 Revised: January 18, 2011<br />

Accepted: January 25, 2011<br />

Published online: February 21, 2011<br />

Abstract<br />

To assess the merits <strong>of</strong> currently available treatment<br />

options in the management <strong>of</strong> patients with low <strong>rectal</strong><br />

<strong>cancer</strong>, a review <strong>of</strong> the medical literature pertaining to<br />

the operative and non-operative management <strong>of</strong> low<br />

<strong>rectal</strong> <strong>cancer</strong> was performed, with particular emphasis<br />

on sphincter preservation, oncological outcome,<br />

functional outcome, morbidity, quality <strong>of</strong> life, and patient<br />

preference. Low anterior resection (AR) is technically<br />

feasible in an increasing proportion <strong>of</strong> patients with<br />

low <strong>rectal</strong> <strong>cancer</strong>. The cost <strong>of</strong> sphincter preservation<br />

is the risk <strong>of</strong> morbidity and poor functional outcome<br />

in a significant proportion <strong>of</strong> patients. Transanal and<br />

endoscopic surgery are attractive options in selected<br />

patients that can provide satisfactory oncological<br />

outcomes while avoiding the morbidity and functional<br />

sequelae <strong>of</strong> open total meso<strong>rectal</strong> excision. In complete<br />

responders to neo-adjuvant chemoradiotherapy, a<br />

non-operative approach may prove to be an option.<br />

Abdominoperineal excision (APE) imposes a permanent<br />

stoma and is associated with significant incidence <strong>of</strong><br />

perineal morbidity but avoids the risk <strong>of</strong> poor functional<br />

outcome following AR. Quality <strong>of</strong> life following AR and<br />

APE is comparable. Given the choice, most patients will<br />

choose AR over APE, however patients following APE<br />

positively appraise this option. In striving toward sphinc-<br />

WJG|www.wjgnet.com<br />

855<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 855-861<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

ter preservation the challenge is not only to achieve the<br />

best possible oncological outcome, but also to ensure<br />

that patients with low <strong>rectal</strong> <strong>cancer</strong> have realistic and<br />

accurate expectations <strong>of</strong> their treatment choice so that<br />

the best possible overall outcome can be obtained by<br />

each individual.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Rectal <strong>cancer</strong>; Survival; Local recurrence;<br />

Morbidity; Ano<strong>rectal</strong> function; Quality <strong>of</strong> life; Patient<br />

preference<br />

Peer reviewer: Hiroki Yamaue, MD, PhD, Department <strong>of</strong> Surgery,<br />

Wakayama Medical University, School <strong>of</strong> Medicine, 811-1<br />

Kimiidera, Wakayama 641-8510, Japan<br />

Mulsow J, Winter DC. Sphincter preservation for distal <strong>rectal</strong><br />

<strong>cancer</strong> - a goal worth achieving at all costs? <strong>World</strong> J Gastroenterol<br />

2011; 17(7): 855-861 Available from: URL: http://www.<br />

wjgnet.com/1007-9327/full/v17/i7/855.htm DOI: http://<br />

dx.doi.org/10.3748/wjg.v17.i7.855<br />

INTRODUCTION<br />

TOPIC HIGHLIGHT<br />

In the management <strong>of</strong> patients with <strong>rectal</strong> <strong>cancer</strong>, sphincter<br />

preservation is a priority and regarded a marker <strong>of</strong><br />

surgical quality. Technical and technological advances have<br />

led to an increase in sphincter preserving surgery and a<br />

fall in the rate <strong>of</strong> abdominoperineal excision (APE) [1] .<br />

Furthermore, the recognition <strong>of</strong> the oncological importance<br />

<strong>of</strong> the circumferential, rather than distal resection<br />

margin, has allowed an increasingly aggressive surgical<br />

approach. The knowledge that a distal margin <strong>of</strong> 1 cm<br />

will safely allow complete tumor removal affords an ever<br />

greater proportion <strong>of</strong> patients the opportunity <strong>of</strong> sphincter<br />

preserving surgery for low <strong>rectal</strong> <strong>cancer</strong> [2] . In addition,<br />

our ever increasing understanding <strong>of</strong> tumor behaviour<br />

gives patients new options in the form <strong>of</strong> non-operative<br />

February 21, 2011|Volume 17|Issue 7|

---

Mulsow J et al . Treatment options and their outcomes in the management <strong>of</strong> distal <strong>rectal</strong> <strong>cancer</strong><br />

treatment (following complete response to neo-adjuvant<br />

treatment), or transanal excision in selected circumstances.<br />

On the other hand, tumor down-staging following neoadjuvant<br />

chemoradiotherapy has not led to the expected<br />

increase in sphincter preserving surgery.<br />

Thus, for patients with low <strong>rectal</strong> tumors, and for<br />

whom APE would formerly have been the only option,<br />

a number <strong>of</strong> sphincter preserving options are now available.<br />

However, while it may be technically possible to reconstruct<br />

(or avoid radical surgery altogether) an increasing<br />

majority <strong>of</strong> patients with <strong>rectal</strong> <strong>cancer</strong>, we should<br />

pause to consider the overall merits <strong>of</strong> this approach<br />

and consider the patient’s overall outcome (both oncological<br />

and functional), while remembering that there<br />

remain acceptable non-reconstructive alternatives (APE<br />

or low Hartmann’s procedure). In doing so, a number <strong>of</strong><br />

factors must be considered and the ‘costs’ <strong>of</strong> sphincter<br />

preservation evaluated.<br />

ONCOLOGICAL OUTCOME IN THE<br />

TREATMENT OF RECTAL CANCER<br />

The oncological outcome is <strong>of</strong> paramount importance<br />

whether anterior resection (AR), APE, transanal excision,<br />

or a non-operative approach is adopted in the treatment<br />

<strong>of</strong> low <strong>rectal</strong> <strong>cancer</strong>.<br />

High rates <strong>of</strong> circumferential resection margin (CRM)<br />

positivity (up to 40%) following APE in some series<br />

and consequent high local recurrence rates have led to<br />

suggestions that the outcome following APE is inherently<br />

worse than that following AR. It does appear that <strong>rectal</strong><br />

tumors in patients who undergo APE are <strong>of</strong>ten more<br />

locally advanced, more poorly differentiated, and show<br />

a lesser response to neo-adjuvant chemoradiotherapy [3] .<br />

However, with meticulous surgery and the avoidance <strong>of</strong><br />

tumor perforation and margin positivity, results following<br />

APE can be similar to those after AR [4] . Indeed, local<br />

recurrence rates in the order <strong>of</strong> 5% can be achieved<br />

following the application <strong>of</strong> a standardised approach [5,6] .<br />

Undoubtedly the technique <strong>of</strong> APE has drifted<br />

from that originally described by Miles [7] in which a wide<br />

dissection <strong>of</strong> the rectum was performed to produce a<br />

cylindrical specimen. Application <strong>of</strong> TME principles and<br />

evolution in technique have resulted in an APE in which<br />

the specimen tapers (Morson’s waist) at the level <strong>of</strong> the<br />

pelvic floor with a consequent narrow circumferential<br />

resection margin and risk <strong>of</strong> CRM positivity and tumor<br />

perforation. Recourse to originally described principles<br />

via an extra-levator approach avoids “waisting” <strong>of</strong> the<br />

specimen [8] and reduces the rate <strong>of</strong> CRM involvement [9] .<br />

Nonetheless, rates <strong>of</strong> CRM involvement may still lag<br />

behind those seen in AR [10] and there remains a need to<br />

further examine surgical technique in APE and develop a<br />

standardised approach with appropriate training if needed.<br />

Inter-sphincteric resection represents the most extreme<br />

form <strong>of</strong> sphincter preserving surgery in which part, or<br />

all, <strong>of</strong> the internal sphincter is resected. This approach<br />

may be applied to tumors within 2 cm <strong>of</strong> the sphincter<br />

WJG|www.wjgnet.com<br />

complex and is made feasible by the recognition that distal<br />

intramural tumor spread beyond 1 cm is uncommon.<br />

Thus, inter-sphincteric resection becomes an option<br />

for patients with tumors within 2 cm <strong>of</strong> the sphincter<br />

complex, in whom pre-operative continence is intact, and<br />

for whom the tumor, at least in its distal part, is confined<br />

to the <strong>rectal</strong> wall. Follow-up suggests that local (6.6%)<br />

and distant (8.8%) recurrence rates [11] are comparable to<br />

those in published series <strong>of</strong> APE. Patients with locally<br />

advanced (T3-T4) tumors may become candidates for<br />

inter-sphincteric resection if a favourable down-staging<br />

response to neo-adjuvant chemoradiotherapy is<br />

demonstrated [3] . Those who are not suitable for intersphincteric<br />

resection and require APE are likely to selfselect<br />

as they have locally advanced tumors, that are poorly<br />

differentiated and show poor response to neo-adjuvant<br />

treatment [3] .<br />

Laparoscopy is increasingly employed as a less invasive<br />

approach in the management <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. While the<br />

initial results from the UK MRC CLASSIC trial highlighted<br />

increased rates <strong>of</strong> margin positivity following laparoscopic<br />

<strong>rectal</strong> <strong>cancer</strong> surgery (when compared to conventional,<br />

open TME) [12] , the long-term oncological outcomes<br />

do not appear to be compromised [13,14] . This study remains<br />

the only randomised controlled trial to assess the role <strong>of</strong><br />

laparoscopy in <strong>rectal</strong> <strong>cancer</strong>, however results from prospective<br />

series <strong>of</strong> laparoscopic resection have also demonstrated<br />

similar oncological outcomes to those reported<br />

following open TME [15] .<br />

Transanal surgery for <strong>rectal</strong> <strong>cancer</strong> represents an attractive<br />

approach that may allow the morbidity and functional<br />

sequelae <strong>of</strong> total meso<strong>rectal</strong> excision (TME) to be<br />

avoided. Better surgical results with lower margin positivity<br />

are achieved following transanal endoscopic microsurgery<br />

(TEMS) than conventional transanal (TA) excision<br />

(2% vs 16%) [16] , however outcomes are generally inferior to<br />

those following radical resection with a 3-5 fold increased<br />

local recurrence risk [17] . TEMS appears to be a reasonable<br />

option (LR < 5%) in selected patients with favourable<br />

pathological features (pT1 Sm1; well or moderately differentiated;<br />

< 3 cm diameter; no lymphovascular invasion) [18] .<br />

For tumors with less favourable features, the oncological<br />

result following TEMS is inferior to that seen after TME.<br />

Difficulty in reliably predicting the T-<strong>stage</strong> pre-operatively<br />

remains an obstacle to patient selection. Likewise, prediction<br />

<strong>of</strong> N-<strong>stage</strong> is problematic as up to 18% <strong>of</strong> T1 tumors<br />

will have associated nodal disease. However, in patients<br />

with adverse pathological features after TEMS, subsequent<br />

conversion to radical surgery does not appear to<br />

be associated with significantly increased LR rates [18] . In<br />

reality, the decision to adopt a transanal approach is frequently<br />

based upon the fitness <strong>of</strong> the patient.<br />

One-fifth to one-quarter <strong>of</strong> patients following neo-adjuvant<br />

chemoradiotherapy will show a complete pathological<br />

response. Predicting those likely to respond and those<br />

who have had a complete pathological response remains<br />

difficult - up to 40% <strong>of</strong> patients who appear to have had a<br />

complete clinical response have residual disease following<br />

856 February 21, 2011|Volume 17|Issue 7|

---

esection [19] . Conversely, approximately 10% <strong>of</strong> patients<br />

who have an incomplete clinical response will show a<br />

complete pathological response [20] . Observation alone<br />

may be a viable alternative in selected patients who show<br />

a complete clinical response to neo-adjuvant therapy [20] .<br />

Local recurrence has been reported in 11% <strong>of</strong> those who<br />

had a sustained complete clinical response. These patients<br />

appear amenable to salvage therapy without adverse oncological<br />

outcome in the event <strong>of</strong> local recurrence [21] .<br />

There may also be a role for full thickness transanal<br />

excision <strong>of</strong> tumor in selected patients with T3 tumors<br />

who show an excellent response to neo-adjuvant chemoradiotherapy<br />

and who are deemed unfit for or refuse<br />

TME, or who had a perceived complete response to neoadjuvant<br />

treatment. The limited available data point to<br />

local recurrence and survival figures that are comparable<br />

to those achieved with radical surgery [22] . This approach<br />

requires further validation.<br />

Finally, endoscopic submucosal dissection is an evolving<br />

technique that may represent an alternative sphincter<br />

preserving approach in the management <strong>of</strong> <strong>rectal</strong> tumors.<br />

This technique has been reported with low complication<br />

rates and in patients in whom complete resection is<br />

achieved (approximately 70%) recurrence rates at shortterm<br />

follow-up are low [23] . Further studies are required to<br />

establish the role <strong>of</strong> this technique.<br />

FUNCTIONAL OUTCOME AND QUALITY<br />

OF LIFE FOLLOWING SURGERY FOR<br />

RECTAL CANCER<br />

Mulsow J et al . Treatment options and their outcomes in the management <strong>of</strong> distal <strong>rectal</strong> <strong>cancer</strong><br />

Functional outcome<br />

Frequency, urgency, and soiling (anterior resection syndrome)<br />

are common problems after anterior resection<br />

that reflect loss <strong>of</strong> the capacitance and compliance <strong>of</strong> the<br />

<strong>rectal</strong> reservoir. Approximately 60% <strong>of</strong> patients experience<br />

some degree <strong>of</strong> incontinence, while one-third experience<br />

frequent symptoms <strong>of</strong> urgency and frequency. Postoperative<br />

studies suggest that ano<strong>rectal</strong> dysfunction after<br />

low anterior resection is more a factor <strong>of</strong> reduced compliance<br />

and capacity, than diminished sphincter function [24,25] .<br />

Furthermore, reflexes <strong>of</strong> the anal sphincter that help to<br />

maintain continence are preserved after low anterior resection<br />

[26] .<br />

Patients undergoing inter-sphincteric resection have the<br />

additional insult <strong>of</strong> reduced internal sphincter function [24] .<br />

Inter-sphincteric resection is associated with a fall in resting<br />

anal canal pressures [27] and continence when compared<br />

to conventional anastomosis, but not with a worsening <strong>of</strong><br />

stool frequency (typically averaging 2/24 h [28] ) and urgency<br />

[29] . Long-term satisfactory continence rates are achievable<br />

in 75% <strong>of</strong> patients [11] . Outcomes, particularly in the<br />

first post-operative year, can be improved by performing<br />

only a partial or subtotal resection <strong>of</strong> the internal sphincter<br />

and through construction <strong>of</strong> a colonic J-pouch [27,30-32] . Preoperative<br />

radiotherapy significantly worsens the functional<br />

outcome following inter-sphincteric resection [11] .<br />

Following straight anastomosis progressive dilatation<br />

WJG|www.wjgnet.com<br />

<strong>of</strong> the neorectum can allow some improvement in compliance<br />

[33] and function over time. Colonic reservoirs (J-pouch<br />

or coloplasty) may allow early preservation <strong>of</strong> function by<br />

providing a neorectum functionally comparable to the resected<br />

rectum. It is technically possible to create a J-pouch<br />

in the majority <strong>of</strong> patients (95%) [34] . With optimum pouch<br />

size (5 cm) [35,36] and level <strong>of</strong> anastomosis (< 8 cm from the<br />

anal verge) [37] , there appear to be functional advantages<br />

to the creation <strong>of</strong> a colonic J-pouch. Patients undergoing<br />

low anterior resection with J-pouch reconstruction have<br />

less stool frequency and urgency when compared to those<br />

with a straight anastomosis, however this benefit is not<br />

maintained beyond two years [34] . Surprisingly, this functional<br />

gain may not impact positively on quality <strong>of</strong> life<br />

after surgery [38] . Evidence would suggest that there is no<br />

significant advantage to coloplasty over straight anastomosis<br />

[38] . Side-to-end anastomosis using a short side limb may<br />

represent an alternative to colonic pouch with the limited<br />

available data suggesting comparable functional and surgical<br />

outcomes, however further studies are needed [39-41] .<br />

The benefits <strong>of</strong> the colonic pouch may not be attributable<br />

to an increased capacity when compared to straight<br />

anastomosis, but rather due to the interruption <strong>of</strong> normal<br />

propulsive motility [42,43] .<br />

Pre- or post-operative irradiation has a significant negative<br />

impact on function following anterior resection. In the<br />

Dutch TME study, pre-operative radiotherapy was associated<br />

with a significant increase in bowel frequency and incontinence<br />

(62% vs 38% for surgery alone) and this had a<br />

significant negative impact on patient satisfaction and daily<br />

activity [44] . Incontinence was worst in patients with lower<br />

tumors [44] . These findings have been replicated in other<br />

studies with long-term follow-up showing an approximate<br />

doubling <strong>of</strong> symptoms <strong>of</strong> faecal incontinence, soiling and<br />

bowel frequency when compared to patients treated with<br />

surgery alone [45] . Ano<strong>rectal</strong> manometry has shown irradiated<br />

patients to have significantly lower resting and squeeze<br />

pressure, while endoanal ultrasound has shown increased<br />

scarring <strong>of</strong> the anal sphincter when compared to nonirradiated<br />

patients [24,45] . Short course pre-operative radiotherapy<br />

and pre-operative long-course chemoradiotherapy<br />

appear to impact similarly on ano<strong>rectal</strong> function [46] . The<br />

functional outcome following post-operative radiotherapy<br />

is worse than following pre-operative treatment with patients<br />

experiencing increased frequency <strong>of</strong> defecation and<br />

clustering [47] .<br />

While reduced following pre-operative radiotherapy,<br />

the functional result in patients undergoing low anterior<br />

resection with colo-anal anastomosis appears to better<br />

with a colonic J-pouch rather than straight anastomosis<br />

or coloplasty at 24 mo follow-up [48] .<br />

Despite increased tumor down-staging, pre-operative<br />

conventionally fractionated radiotherapy does not appear<br />

to confer an advantage with respect to sphincter preservation<br />

over short-course radiotherapy [49] .<br />

Extended pelvic lymphadenectomy is frequently performed<br />

in Japan as an adjunct to TME, and <strong>of</strong>ten without<br />

neo-adjuvant treatment. This approach does not appear<br />

to confer an oncological advantage when compared to<br />

857 February 21, 2011|Volume 17|Issue 7|

---

Mulsow J et al . Treatment options and their outcomes in the management <strong>of</strong> distal <strong>rectal</strong> <strong>cancer</strong><br />

TME alone (with neoadjuvant treatment) and is associated<br />

with an increased incidence <strong>of</strong> urinary and sexual<br />

dysfunction [50-52] .<br />

Quality <strong>of</strong> life<br />

There is an absence <strong>of</strong> randomised studies comparing<br />

outcomes following APE and AR for low <strong>rectal</strong> tumors<br />

(due to presumption that AR is superior). As a result, inferences<br />

as to their comparative quality <strong>of</strong> life outcomes<br />

can only be drawn from individual studies. None-theless,<br />

the available data challenges the presumption that<br />

a permanent stoma automatically renders an inferior<br />

quality <strong>of</strong> life outcome when compared to that following<br />

restorative surgery. A meta-analysis <strong>of</strong> over 1400 patients<br />

from 11 studies showed no difference in general quality<br />

<strong>of</strong> life scores between patients who underwent APE and<br />

AR. While APE was associated with better emotional and<br />

cognitive function scores and superior future perspectives<br />

(patients’ understanding <strong>of</strong> disease <strong>stage</strong>), vitality and sexual<br />

function scored better in patients undergoing AR [53] .<br />

These findings were consistent with those <strong>of</strong> an earlier<br />

meta-analysis [54] , however, their interpretation must be<br />

tempered by the poor quality <strong>of</strong> a number <strong>of</strong> individual<br />

studies, and the limited follow-up duration which fails to<br />

allow for the progressive functional improvement patients<br />

<strong>of</strong>ten experience following AR.<br />

MORBIDITY<br />

The argument in favour <strong>of</strong> observation (and/or transanal<br />

excision) in complete responders to neo-adjuvant<br />

treatment is the avoidance <strong>of</strong> the morbidity and functional<br />

loss associated with TME, with or without a<br />

temporary or permanent stoma. Ano<strong>rectal</strong> dysfunction,<br />

sexual dysfunction, difficulty voiding, and urinary incontinence<br />

are seen in up to one-third <strong>of</strong> patients following<br />

TME. Furthermore, these problems are exacerbated by<br />

pre-operative radiotherapy. Post-operative morbidity following<br />

laparoscopic and open <strong>rectal</strong> resection appears<br />

to be similar [12] , while a benefit to the laparoscopic approach<br />

with respect to long-term complications such as<br />

adhesion small bowel obstruction and incisional hernia<br />

remains to be proven [55] . Laparoscopic resection appears<br />

to impact similarly on bladder function when compared<br />

to open TME, but may be associated with a worse outcome<br />

with regard to male sexual function [56] .<br />

For patients undergoing TME, larger studies have<br />

shown overall rates <strong>of</strong> early morbidity <strong>of</strong> approximately<br />

40%. This figure increases to almost 50% following preoperative<br />

radiotherapy. Of patients undergoing APE,<br />

approximately one-fifth develop perineal wound problems<br />

[57] . The incidence <strong>of</strong> perineal wound problems rises<br />

to 30% following radiotherapy [57] and doubles following<br />

extralevator APE (38%) [10] . Eleven percent <strong>of</strong> patients<br />

undergoing AR developed clinical anastomotic leaks in<br />

the Dutch TME trial. The leak rate was not affected by<br />

pre-operative radiotherapy, but was reduced with proximal<br />

defunctioning stoma (8% vs 16%) [57] . The mortality rate<br />

for non-irradiated patients was 3.3% in the same study.<br />

WJG|www.wjgnet.com<br />

Again, from the Dutch study we know that approximately<br />

50% <strong>of</strong> patients undergoing AR will have a defunctioning<br />

stoma. It is worth noting that at long-term<br />

follow-up (median 48 mo) 21% <strong>of</strong> patients in one study<br />

who had undergone sphincter preserving surgery still<br />

had a stoma [58] . Loop ileostomy closure is associated with<br />

17% morbidity, however the majority (80%) <strong>of</strong> patients<br />

can be managed non-operatively [59] .<br />

PATIENT PREFERENCE<br />

The limited available evidence suggests that a majority<br />

(65%) <strong>of</strong> patients with <strong>rectal</strong> <strong>cancer</strong> are willing to defer<br />

decision making about their surgery to their surgeon [60] .<br />

What is not known, unlike for breast <strong>cancer</strong>, is the<br />

role that patients with <strong>rectal</strong> <strong>cancer</strong> would like to adopt<br />

in decision making, and how their given role influences<br />

their satisfaction with decision making and outcomes.<br />

We do know however that the relative importance that<br />

surgeons place on various outcomes such as permanent<br />

stoma and incontinence is <strong>of</strong>ten not matched by their<br />

patients [61] . Surgeons may in particular underestimate<br />

their patients’ concerns. Furthermore, surgeon’s choices<br />

may frequently be at odds with their patient’s inherent<br />

and perhaps unrecognised true preference [62] . Patients,<br />

for example, express a stronger desire to avoid chemotherapy<br />

than to avoid permanent stoma, while doctors<br />

express the opposite view.<br />

Multimedia decision aids (incorporating patient values<br />

into evidence based data) have been used to assess<br />

and quantify the relative importance patients with <strong>rectal</strong><br />

<strong>cancer</strong> place on different quality <strong>of</strong> life outcomes. Patients<br />

who have had surgery place greater emphasis on<br />

the avoidance <strong>of</strong> incontinence post-operatively than the<br />

avoidance <strong>of</strong> a permanent stoma [61] .<br />

Trade-<strong>of</strong>f techniques are another useful means <strong>of</strong><br />

gauging patient’s true preferences and will <strong>of</strong>ten highlight<br />

disparity between patients’ preferences and those<br />

<strong>of</strong> their physicians [62] . Using this technique, the strength<br />

<strong>of</strong> a preference is measured by determining the degree<br />

<strong>of</strong> risk <strong>of</strong> a particular (poor) outcome that the patient<br />

would be willing to accept in order to have the treatment.<br />

When patient preferences are assessed using time-trade<br />

methods, patients strongly express a desire to avoid a<br />

stoma with 65% willing to trade a mean <strong>of</strong> 34% <strong>of</strong> their<br />

life expectancy to avoid this outcome [63] . Furthermore,<br />

patients expressed a stronger desire to avoid the option<br />

<strong>of</strong> APE and thus permanent stoma than their treating<br />

physicians. Again, in patients who have had surgery for<br />

<strong>rectal</strong> <strong>cancer</strong>, the majority <strong>of</strong> those without a stoma<br />

would be willing to trade frequent (monthly) episodes<br />

<strong>of</strong> incontinence in order to avoid a permanent stoma [64] .<br />

APE patients would however hypothetically trade fewer<br />

years <strong>of</strong> remaining life to be without a stoma, than AR<br />

patients would to be without incontinence [65] .<br />

While patients may <strong>of</strong>ten be happy to defer decisions<br />

as to the type <strong>of</strong> surgery to their surgeons, the majority<br />

<strong>of</strong> those patients who do choose, would favour AR over<br />

APE [60] . More patients who have had AR would choose<br />

858 February 21, 2011|Volume 17|Issue 7|

---

that option again, than patients who have had APE (69%<br />

vs 46%) [60] . Interestingly, at longer term follow-up 80% <strong>of</strong><br />

patients who had APE indicate that they would choose<br />

the same option given the benefit <strong>of</strong> their experience [60] .<br />

CONCLUSION<br />

Sphincter preservation in <strong>rectal</strong> <strong>cancer</strong> - a goal worth<br />

achieving at all costs? The answer must be no. While we<br />

should strive toward sphincter preserving options, we<br />

must recognize the limitations <strong>of</strong> currently available approaches<br />

and accept that sphincter preservation may not<br />

be the best overall option for each individual patient.<br />

Oncological outcomes following AR and APE should<br />

be equivalent, however there remains room to uniformly<br />

improve and standardise approaches and outcomes in<br />

APE. If equivalence for oncological outcome is achieved,<br />

then functional outcome, quality <strong>of</strong> life, and ultimately<br />

patient preference become <strong>of</strong> paramount importance in<br />

decision making for the treatment <strong>of</strong> low <strong>rectal</strong> <strong>cancer</strong>.<br />

Ano<strong>rectal</strong> dysfunction and poor functional outcome are<br />

common following AR. The alternative <strong>of</strong> APE or low<br />

Hartmann’s procedure imposes a permanent stoma. Quality<br />

<strong>of</strong> life following APE appears to be similar to that<br />

following AR. Given the choice, most patients would<br />

choose AR over APE. It is doubtful however that patients<br />

appreciate fully the functional outcome following AR, and<br />

also likely that patients harbour excessively negative misconceptions<br />

about life with a permanent stoma. Patients<br />

must be informed that function may not be as good as<br />

they expect after AR, and also that patients who have undergone<br />

APE positively appraise this option at follow-up.<br />

The morbidity associated with stoma reversal (following<br />

AR), and the significant risk <strong>of</strong> perineal wound problems<br />

following APE must also be considered. Non-radical and<br />

even non-operative approaches are increasingly an option<br />

in the management <strong>of</strong> selected patients with low <strong>rectal</strong><br />

<strong>cancer</strong> that obviate the morbidity and outcomes following<br />

TME. Ultimately we must ensure that patients with low<br />

<strong>rectal</strong> <strong>cancer</strong> have realistic expectations <strong>of</strong> their treatment<br />

options and that their decisions are truly informed.<br />

REFERENCES<br />

Mulsow J et al . Treatment options and their outcomes in the management <strong>of</strong> distal <strong>rectal</strong> <strong>cancer</strong><br />

1 Tilney HS, Heriot AG, Purkayastha S, Antoniou A, Aylin P,<br />

Darzi AW, Tekkis PP. A national perspective on the decline<br />

<strong>of</strong> abdominoperineal resection for <strong>rectal</strong> <strong>cancer</strong>. Ann Surg<br />

2008; 247: 77-84<br />

2 Guillem JG, Chessin DB, Shia J, Suriawinata A, Riedel E,<br />

Moore HG, Minsky BD, Wong WD. A prospective pathologic<br />

analysis using whole-mount sections <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong><br />

following preoperative combined modality therapy: implications<br />

for sphincter preservation. Ann Surg 2007; 245: 88-93<br />

3 Weiser MR, Quah HM, Shia J, Guillem JG, Paty PB, Temple<br />

LK, Goodman KA, Minsky BD, Wong WD. Sphincter preservation<br />

in low <strong>rectal</strong> <strong>cancer</strong> is facilitated by preoperative<br />

chemoradiation and intersphincteric dissection. Ann Surg<br />

2009; 249: 236-242<br />

4 Wibe A, Syse A, Andersen E, Tretli S, Myrvold HE, Søreide<br />

O. Oncological outcomes after total meso<strong>rectal</strong> excision for<br />

cure for <strong>cancer</strong> <strong>of</strong> the lower rectum: anterior vs. abdomino-<br />

WJG|www.wjgnet.com<br />

perineal resection. Dis Colon Rectum 2004; 47: 48-58<br />

5 Chuwa EW, Seow-Choen F. Outcomes for abdominoperineal<br />

resections are not worse than those <strong>of</strong> anterior resections.<br />

Dis Colon Rectum 2006; 49: 41-49<br />

6 Davies M, Harris D, Hirst G, Beynon R, Morgan AR, Carr<br />

ND, Beynon J. Local recurrence after abdomino-perineal<br />

resection. Colo<strong>rectal</strong> Dis 2009; 11: 39-43<br />

7 Miles WE. A method <strong>of</strong> performing abdomino-perineal excision<br />

for carcinoma <strong>of</strong> the rectum and <strong>of</strong> the terminal portion<br />

<strong>of</strong> the pelvic colon (1908). CA Cancer J Clin 1971; 21: 361-364<br />

8 Holm T, Ljung A, Häggmark T, Jurell G, Lagergren J. Extended<br />

abdominoperineal resection with gluteus maximus<br />

flap reconstruction <strong>of</strong> the pelvic floor for <strong>rectal</strong> <strong>cancer</strong>. Br J<br />

Surg 2007; 94: 232-238<br />

9 West NP, Finan PJ, Anderin C, Lindholm J, Holm T, Quirke<br />

P. Evidence <strong>of</strong> the oncologic superiority <strong>of</strong> cylindrical abdominoperineal<br />

excision for low <strong>rectal</strong> <strong>cancer</strong>. J Clin Oncol<br />

2008; 26: 3517-3522<br />

10 West NP, Anderin C, Smith KJ, Holm T, Quirke P. Multicentre<br />

experience with extralevator abdominoperineal excision<br />

for low <strong>rectal</strong> <strong>cancer</strong>. Br J Surg 2010; 97: 588-599<br />

11 Chamlou R, Parc Y, Simon T, Bennis M, Dehni N, Parc R,<br />

Tiret E. Long-term results <strong>of</strong> intersphincteric resection for<br />

low <strong>rectal</strong> <strong>cancer</strong>. Ann Surg 2007; 246: 916-921; discussion<br />

921-922<br />

12 Guillou PJ, Quirke P, Thorpe H, Walker J, Jayne DG, Smith<br />

AM, Heath RM, Brown JM. Short-term endpoints <strong>of</strong> conventional<br />

versus laparoscopic-assisted surgery in patients<br />

with colo<strong>rectal</strong> <strong>cancer</strong> (MRC CLASICC trial): multicentre,<br />

randomised controlled trial. Lancet 2005; 365: 1718-1726<br />

13 Jayne DG, Guillou PJ, Thorpe H, Quirke P, Copeland J,<br />

Smith AM, Heath RM, Brown JM. Randomized trial <strong>of</strong> laparoscopic-assisted<br />

resection <strong>of</strong> colo<strong>rectal</strong> carcinoma: 3-year<br />

results <strong>of</strong> the UK MRC CLASICC Trial Group. J Clin Oncol<br />

2007; 25: 3061-3068<br />

14 Jayne DG, Thorpe HC, Copeland J, Quirke P, Brown JM,<br />

Guillou PJ. Five-year follow-up <strong>of</strong> the Medical Research<br />

Council CLASICC trial <strong>of</strong> laparoscopically assisted versus<br />

open surgery for colo<strong>rectal</strong> <strong>cancer</strong>. Br J Surg 2010; 97:<br />

1638-1645<br />

15 Tsang WW, Chung CC, Kwok SY, Li MK. Laparoscopic<br />

sphincter-preserving total meso<strong>rectal</strong> excision with colonic<br />

J-pouch reconstruction: five-year results. Ann Surg 2006;<br />

243: 353-358<br />

16 Christ<strong>of</strong>oridis D, Cho HM, Dixon MR, Mellgren AF,<br />

Mad<strong>of</strong>f RD, Finne CO. Transanal endoscopic microsurgery<br />

versus conventional transanal excision for patients with<br />

early <strong>rectal</strong> <strong>cancer</strong>. Ann Surg 2009; 249: 776-782<br />

17 Bentrem DJ, Okabe S, Wong WD, Guillem JG, Weiser MR,<br />

Temple LK, Ben-Porat LS, Minsky BD, Cohen AM, Paty PB.<br />

T1 adenocarcinoma <strong>of</strong> the rectum: transanal excision or radical<br />

surgery? Ann Surg 2005; 242: 472-477; discussion 477-479<br />

18 Bach SP, Hill J, Monson JR, Simson JN, Lane L, Merrie A,<br />

Warren B, Mortensen NJ. A predictive model for local recurrence<br />

after transanal endoscopic microsurgery for <strong>rectal</strong><br />

<strong>cancer</strong>. Br J Surg 2009; 96: 280-290<br />

19 Bedrosian I, Rodriguez-Bigas MA, Feig B, Hunt KK, Ellis<br />

L, Curley SA, Vauthey JN, Delclos M, Crane C, Janjan N,<br />

Skibber JM. Predicting the node-negative mesorectum after<br />

preoperative chemoradiation for locally advanced <strong>rectal</strong> carcinoma.<br />

J Gastrointest Surg 2004; 8: 56-62; discussion 62-63<br />

20 Habr-Gama A, Perez RO, Nadalin W, Sabbaga J, Ribeiro U Jr,<br />

Silva e Sousa AH Jr, Campos FG, Kiss DR, Gama-Rodrigues<br />

J. Operative versus nonoperative treatment for <strong>stage</strong> 0 distal<br />

<strong>rectal</strong> <strong>cancer</strong> following chemoradiation therapy: long-term<br />

results. Ann Surg 2004; 240: 711-717; discussion 717-718<br />

21 Habr-Gama A, Perez RO. Non-operative management <strong>of</strong><br />

<strong>rectal</strong> <strong>cancer</strong> after neoadjuvant chemoradiation. Br J Surg<br />

2009; 96: 125-127<br />

22 Callender GG, Das P, Rodriguez-Bigas MA, Skibber JM,<br />

859 February 21, 2011|Volume 17|Issue 7|

---

Mulsow J et al . Treatment options and their outcomes in the management <strong>of</strong> distal <strong>rectal</strong> <strong>cancer</strong><br />

Crane CH, Krishnan S, Delclos ME, Feig BW. Local excision<br />

after preoperative chemoradiation results in an equivalent<br />

outcome to total meso<strong>rectal</strong> excision in selected patients<br />

with T3 <strong>rectal</strong> <strong>cancer</strong>. Ann Surg Oncol 2010; 17: 441-447<br />

23 Onozato Y, Kakizaki S, Ishihara H, Iizuka H, Sohara N,<br />

Okamura S, Mori M, Itoh H. Endoscopic submucosal dissection<br />

for <strong>rectal</strong> tumors. Endoscopy 2007; 39: 423-427<br />

24 Matzel KE, Bittorf B, Günther K, Stadelmaier U, Hohenberger<br />

W. Rectal resection with low anastomosis: functional<br />

outcome. Colo<strong>rectal</strong> Dis 2003; 5: 458-464<br />

25 Nesbakken A, Nygaard K, Lunde OC. Meso<strong>rectal</strong> excision<br />

for <strong>rectal</strong> <strong>cancer</strong>: functional outcome after low anterior<br />

resection and colo<strong>rectal</strong> anastomosis without a reservoir.<br />

Colo<strong>rectal</strong> Dis 2002; 4: 172-176<br />

26 Lane RH, Parks AG. Function <strong>of</strong> the anal sphincters following<br />

colo-anal anastomosis. Br J Surg 1977; 64: 596-599<br />

27 Yamada K, Ogata S, Saiki Y, Fukunaga M, Tsuji Y, Takano M.<br />

Functional results <strong>of</strong> intersphincteric resection for low <strong>rectal</strong><br />

<strong>cancer</strong>. Br J Surg 2007; 94: 1272-1277<br />

28 Tilney HS, Tekkis PP. Extending the horizons <strong>of</strong> restorative<br />

<strong>rectal</strong> surgery: intersphincteric resection for low <strong>rectal</strong> <strong>cancer</strong>.<br />

Colo<strong>rectal</strong> Dis 2008; 10: 3-15; discussion 15-16<br />

29 Bretagnol F, Rullier E, Laurent C, Zerbib F, Gontier R, Saric J.<br />

Comparison <strong>of</strong> functional results and quality <strong>of</strong> life between<br />

intersphincteric resection and conventional coloanal anastomosis<br />

for low <strong>rectal</strong> <strong>cancer</strong>. Dis Colon Rectum 2004; 47: 832-838<br />

30 Willis S, Kasperk R, Braun J, Schumpelick V. Comparison<br />

<strong>of</strong> colonic J-pouch reconstruction and straight coloanal anastomosis<br />

after intersphincteric <strong>rectal</strong> resection. Langenbecks<br />

Arch Surg 2001; 386: 193-199<br />

31 Park JG, Lee MR, Lim SB, Hong CW, Yoon SN, Kang SB,<br />

Heo SC, Jeong SY, Park KJ. Colonic J-pouch anal anastomosis<br />

after ultralow anterior resection with upper sphincter excision<br />

for low-lying <strong>rectal</strong> <strong>cancer</strong>. <strong>World</strong> J Gastroenterol 2005;<br />

11: 2570-2573<br />

32 Bittorf B, Stadelmaier U, Göhl J, Hohenberger W, Matzel<br />

KE. Functional outcome after intersphincteric resection <strong>of</strong><br />

the rectum with coloanal anastomosis in low <strong>rectal</strong> <strong>cancer</strong>.<br />

Eur J Surg Oncol 2004; 30: 260-265<br />

33 Pedersen IK, Christiansen J, Hint K, Jensen P, Olsen J,<br />

Mortensen PE. Ano<strong>rectal</strong> function after low anterior resection<br />

for carcinoma. Ann Surg 1986; 204: 133-135<br />

34 Heriot AG, Tekkis PP, Constantinides V, Paraskevas P,<br />

Nicholls RJ, Darzi A, Fazio VW. Meta-analysis <strong>of</strong> colonic<br />

reservoirs versus straight coloanal anastomosis after anterior<br />

resection. Br J Surg 2006; 93: 19-32<br />

35 Hida J, Yasutomi M, Fujimoto K, Okuno K, Ieda S, Machidera<br />

N, Kubo R, Shindo K, Koh K. Functional outcome<br />

after low anterior resection with low anastomosis for <strong>rectal</strong><br />

<strong>cancer</strong> using the colonic J-pouch. Prospective randomized<br />

study for determination <strong>of</strong> optimum pouch size. Dis Colon<br />

Rectum 1996; 39: 986-991<br />

36 Lazorthes F, Gamagami R, Chiotasso P, Istvan G, Muhammad<br />

S. Prospective, randomized study comparing clinical<br />

results between small and large colonic J-pouch following<br />

coloanal anastomosis. Dis Colon Rectum 1997; 40: 1409-1413<br />

37 Hida J, Yasutomi M, Maruyama T, Fujimoto K, Nakajima<br />

A, Uchida T, Wakano T, Tokoro T, Kubo R, Shindo K. Indications<br />

for colonic J-pouch reconstruction after anterior<br />

resection for <strong>rectal</strong> <strong>cancer</strong>: determining the optimum level<br />

<strong>of</strong> anastomosis. Dis Colon Rectum 1998; 41: 558-563<br />

38 Fazio VW, Zutshi M, Remzi FH, Parc Y, Ruppert R, Fürst A,<br />

Celebrezze J Jr, Galanduik S, Orangio G, Hyman N, Bokey<br />

L, Tiret E, Kirchdorfer B, Medich D, Tietze M, Hull T, Hammel<br />

J. A randomized multicenter trial to compare long-term<br />

functional outcome, quality <strong>of</strong> life, and complications <strong>of</strong><br />

surgical procedures for low <strong>rectal</strong> <strong>cancer</strong>s. Ann Surg 2007;<br />

246: 481-488; discussion 488-490<br />

39 Huber FT, Herter B, Siewert JR. Colonic pouch vs. side-toend<br />

anastomosis in low anterior resection. Dis Colon Rectum<br />

WJG|www.wjgnet.com<br />

1999; 42: 896-902<br />

40 Machado M, Nygren J, Goldman S, Ljungqvist O. Similar<br />

outcome after colonic pouch and side-to-end anastomosis<br />

in low anterior resection for <strong>rectal</strong> <strong>cancer</strong>: a prospective randomized<br />

trial. Ann Surg 2003; 238: 214-220<br />

41 Tsunoda A, Kamiyama G, Narita K, Watanabe M, Nakao K,<br />

Kusano M. Prospective randomized trial for determination<br />

<strong>of</strong> optimum size <strong>of</strong> side limb in low anterior resection with<br />

side-to-end anastomosis for <strong>rectal</strong> carcinoma. Dis Colon Rectum<br />

2009; 52: 1572-1577<br />

42 Hallböök O, Nystrom PO, Sjödahl R. Physiologic characteristics<br />

<strong>of</strong> straight and colonic J-pouch anastomoses after<br />

<strong>rectal</strong> excision for <strong>cancer</strong>. Dis Colon Rectum 1997; 40: 332-338<br />

43 Fürst A, Burgh<strong>of</strong>er K, Hutzel L, Jauch KW. Neo<strong>rectal</strong> reservoir<br />

is not the functional principle <strong>of</strong> the colonic J-pouch:<br />

the volume <strong>of</strong> a short colonic J-pouch does not differ from<br />

a straight coloanal anastomosis. Dis Colon Rectum 2002; 45:<br />

660-667<br />

44 Peeters KC, van de Velde CJ, Leer JW, Martijn H, Junggeburt<br />

JM, Kranenbarg EK, Steup WH, Wiggers T, Rutten HJ, Marijnen<br />

CA. Late side effects <strong>of</strong> short-course preoperative radiotherapy<br />

combined with total meso<strong>rectal</strong> excision for <strong>rectal</strong><br />

<strong>cancer</strong>: increased bowel dysfunction in irradiated patients-<br />

-a Dutch colo<strong>rectal</strong> <strong>cancer</strong> group study. J Clin Oncol 2005; 23:<br />

6199-6206<br />

45 Pollack J, Holm T, Cedermark B, Holmström B, Mellgren A.<br />

Long-term effect <strong>of</strong> preoperative radiation therapy on ano<strong>rectal</strong><br />

function. Dis Colon Rectum 2006; 49: 345-352<br />

46 Pietrzak L, Bujko K, Nowacki MP, Kepka L, Oledzki J, Rutkowski<br />

A, Szmeja J, Kladny J, Dymecki D, Wieczorek A,<br />

Pawlak M, Lesniak T, Kowalska T, Richter P. Quality <strong>of</strong> life,<br />

ano<strong>rectal</strong> and sexual functions after preoperative radiotherapy<br />

for <strong>rectal</strong> <strong>cancer</strong>: report <strong>of</strong> a randomised trial. Radiother<br />

Oncol 2007; 84: 217-225<br />

47 Nathanson DR, Espat NJ, Nash GM, D’Alessio M, Thaler<br />

H, Minsky BD, Enker W, Wong D, Guillem J, Cohen A, Paty<br />

PB. Evaluation <strong>of</strong> preoperative and postoperative radiotherapy<br />

on long-term functional results <strong>of</strong> straight coloanal<br />

anastomosis. Dis Colon Rectum 2003; 46: 888-894<br />

48 Parc Y, Zutshi M, Zalinski S, Ruppert R, Fürst A, Fazio VW.<br />

Preoperative radiotherapy is associated with worse functional<br />

results after coloanal anastomosis for <strong>rectal</strong> <strong>cancer</strong>.<br />

Dis Colon Rectum 2009; 52: 2004-2014<br />

49 Bujko K, Nowacki MP, Nasierowska-Guttmejer A, Michalski<br />

W, Bebenek M, Pudełko M, Kryj M, Oledzki J, Szmeja J,<br />

Słuszniak J, Serkies K, Kładny J, Pamucka M, Kukołowicz P.<br />

Sphincter preservation following preoperative radiotherapy<br />

for <strong>rectal</strong> <strong>cancer</strong>: report <strong>of</strong> a randomised trial comparing<br />

short-term radiotherapy vs. conventionally fractionated radiochemotherapy.<br />

Radiother Oncol 2004; 72: 15-24<br />

50 Georgiou P, Tan E, Gouvas N, Antoniou A, Brown G, Nicholls<br />

RJ, Tekkis P. Extended lymphadenectomy versus conventional<br />

surgery for <strong>rectal</strong> <strong>cancer</strong>: a meta-analysis. Lancet<br />

Oncol 2009; 10: 1053-1062<br />

51 Akasu T, Sugihara K, Moriya Y. Male urinary and sexual<br />

functions after meso<strong>rectal</strong> excision alone or in combination<br />

with extended lateral pelvic lymph node dissection for <strong>rectal</strong><br />

<strong>cancer</strong>. Ann Surg Oncol 2009; 16: 2779-2786<br />

52 Kusters M, Beets GL, van de Velde CJ, Beets-Tan RG, Marijnen<br />

CA, Rutten HJ, Putter H, Moriya Y. A comparison<br />

between the treatment <strong>of</strong> low <strong>rectal</strong> <strong>cancer</strong> in Japan and the<br />

Netherlands, focusing on the patterns <strong>of</strong> local recurrence.<br />

Ann Surg 2009; 249: 229-235<br />

53 Cornish JA, Tilney HS, Heriot AG, Lavery IC, Fazio VW,<br />

Tekkis PP. A meta-analysis <strong>of</strong> quality <strong>of</strong> life for abdominoperineal<br />

excision <strong>of</strong> rectum versus anterior resection for<br />

<strong>rectal</strong> <strong>cancer</strong>. Ann Surg Oncol 2007; 14: 2056-2068<br />

54 Pachler J, Wille-Jørgensen P. Quality <strong>of</strong> life after <strong>rectal</strong> resection<br />

for <strong>cancer</strong>, with or without permanent colostomy.<br />

Cochrane Database Syst Rev 2005; CD004323<br />

860 February 21, 2011|Volume 17|Issue 7|

---

Mulsow J et al . Treatment options and their outcomes in the management <strong>of</strong> distal <strong>rectal</strong> <strong>cancer</strong><br />

55 Taylor GW, Jayne DG, Brown SR, Thorpe H, Brown JM,<br />

Dewberry SC, Parker MC, Guillou PJ. Adhesions and incisional<br />

hernias following laparoscopic versus open surgery<br />

for colo<strong>rectal</strong> <strong>cancer</strong> in the CLASICC trial. Br J Surg 2010; 97:<br />

70-78<br />

56 Jayne DG, Brown JM, Thorpe H, Walker J, Quirke P, Guillou<br />

PJ. Bladder and sexual function following resection for<br />

<strong>rectal</strong> <strong>cancer</strong> in a randomized clinical trial <strong>of</strong> laparoscopic<br />

versus open technique. Br J Surg 2005; 92: 1124-1132<br />

57 Marijnen CA, Kapiteijn E, van de Velde CJ, Martijn H,<br />

Steup WH, Wiggers T, Kranenbarg EK, Leer JW. Acute side<br />

effects and complications after short-term preoperative radiotherapy<br />

combined with total meso<strong>rectal</strong> excision in primary<br />

<strong>rectal</strong> <strong>cancer</strong>: report <strong>of</strong> a multicenter randomized trial.<br />

J Clin Oncol 2002; 20: 817-825<br />

58 Bujko K, Nowacki MP, Nasierowska-Guttmejer A, Michalski<br />

W, Bebenek M, Kryj M. Long-term results <strong>of</strong> a randomized<br />

trial comparing preoperative short-course radiotherapy<br />

with preoperative conventionally fractionated chemoradiation<br />

for <strong>rectal</strong> <strong>cancer</strong>. Br J Surg 2006; 93: 1215-1223<br />

59 Perez RO, Habr-Gama A, Seid VE, Proscurshim I, Sousa<br />

AH Jr, Kiss DR, Linhares M, Sapucahy M, Gama-Rodrigues<br />

J. Loop ileostomy morbidity: timing <strong>of</strong> closure matters. Dis<br />

Colon Rectum 2006; 49: 1539-1545<br />

WJG|www.wjgnet.com<br />

60 Zolciak A, Bujko K, Kepka L, Oledzki J, Rutkowski A,<br />

Nowacki MP. Abdominoperineal resection or anterior resection<br />

for <strong>rectal</strong> <strong>cancer</strong>: patient preferences before and after<br />

treatment. Colo<strong>rectal</strong> Dis 2006; 8: 575-580<br />

61 Masya LM, Young JM, Solomon MJ, Harrison JD, Dennis RJ,<br />

Salkeld GP. Preferences for outcomes <strong>of</strong> treatment for <strong>rectal</strong><br />

<strong>cancer</strong>: patient and clinician utilities and their application in<br />

an interactive computer-based decision aid. Dis Colon Rectum<br />

2009; 52: 1994-2002<br />

62 Solomon MJ, Pager CK, Keshava A, Findlay M, Butow P,<br />

Salkeld GP, Roberts R. What do patients want? Patient preferences<br />

and surrogate decision making in the treatment <strong>of</strong><br />

colo<strong>rectal</strong> <strong>cancer</strong>. Dis Colon Rectum 2003; 46: 1351-1357<br />

63 Harrison JD, Solomon MJ, Young JM, Meagher A, Butow P,<br />

Salkeld G, Hruby G, Clarke S. Patient and physician preferences<br />

for surgical and adjuvant treatment options for <strong>rectal</strong><br />

<strong>cancer</strong>. Arch Surg 2008; 143: 389-394<br />

64 Bossema ER, Marijnen CA, Baas-Thijssen MC, van de Velde<br />

CJ, Stiggelbout AM. Evaluation <strong>of</strong> the treatment trade<strong>of</strong>f<br />

method in <strong>rectal</strong> <strong>cancer</strong> patients: is surgery preference related<br />

to outcome utilities? Med Decis Making 2008; 28: 888-898<br />

65 Bossema E, Stiggelbout A, Baas-Thijssen M, van de Velde C,<br />

Marijnen C. Patients’ preferences for low <strong>rectal</strong> <strong>cancer</strong> surgery.<br />

Eur J Surg Oncol 2008; 34: 42-48<br />

S- Editor Sun H L- Editor O’Neill M E- Editor Ma WH<br />

861 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.862<br />

Imran Hassan, MD, Assistant Pr<strong>of</strong>essor, Series Editor<br />

Minimally invasive surgery for <strong>rectal</strong> <strong>cancer</strong>: Are we there<br />

yet?<br />

Bradley J Champagne, Rohit Makhija<br />

Bradley J Champagne, Division <strong>of</strong> Colo<strong>rectal</strong> Surgery, University<br />

Hospitals Case Medical Center, Cleveland, OH 44106,<br />

United States<br />

Rohit Makhija, Laparoscopic Colo<strong>rectal</strong> Fellow, University Hospitals<br />

Case Medical Center, Cleveland, OH 44106, United States<br />

Author contributions: Champagne BC wrote the paper, performed<br />

a literature search, analyzed data; Makhija R performed<br />

literature search and contributed to writing the paper.<br />

Correspondence to: Bradley J Champagne, MD, FACS, Associate<br />

Pr<strong>of</strong>essor, Division <strong>of</strong> Colo<strong>rectal</strong> Surgery, University<br />

Hospitals Case Medical Center, Cleveland, OH 44106,<br />

United States. brad.champagne@uhhospitals.org<br />

Telephone: +1-216-5267221 Fax: +1-216-8445957<br />

Received: September 26, 2010 Revised: December 16, 2010<br />

Accepted: December 23, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

Laparoscopic colon surgery for select <strong>cancer</strong>s is slowly<br />

evolving as the standard <strong>of</strong> care but minimally invasive<br />

approaches for <strong>rectal</strong> <strong>cancer</strong> have been viewed with significant<br />

skepticism. This procedure has been performed<br />

by select surgeons at specialized centers and concerns<br />

over local recurrence, sexual dysfunction and appropriate<br />

training measures have further hindered widespread<br />

acceptance. Data for laparoscopic <strong>rectal</strong> resection now<br />

supports its continued implementation and widespread<br />

usage by expeienced surgeons for select patients. The<br />

current controversies regarding technical approaches<br />

have created ambiguity amongst opinion leaders and are<br />

also addressed in this review.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Laparoscopic; Rectal <strong>cancer</strong>; Minimally invasive;<br />

Meso<strong>rectal</strong> excision<br />

Peer reviewer: Dr. Stefan Riss, Department <strong>of</strong> Surgery, Medical<br />

University <strong>of</strong> Vienna, Vienna, 1090, Austria<br />

WJG|www.wjgnet.com<br />

862<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 862-866<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

Champagne BJ, Makhija R. Minimally invasive surgery for<br />

<strong>rectal</strong> <strong>cancer</strong>: Are we there yet? <strong>World</strong> J Gastroenterol 2011;<br />

17(7): 862-866 Available from: URL: http://www.wjgnet.<br />

com/1007-9327/full/v17/i7/862.htm DOI: http://dx.doi.<br />

org/10.3748/wjg.v17.i7.862<br />

INTRODUCTION<br />

The benefits <strong>of</strong> laparoscopic colon surgery compared to<br />

the open approach are well established [1-4] . Furthermore,<br />

laparotomy has been associated with an increased morbidity<br />

when compared to minimally invasive techniques<br />

for colo<strong>rectal</strong> disease [5] . More recently, the implementation<br />

<strong>of</strong> enhanced care programs coupled to laparoscopic<br />

resection has also resulted in a significant reduction in<br />

length <strong>of</strong> stay after both colon and <strong>rectal</strong> resection [6,7] .<br />

Laparoscopic colon surgery for select <strong>cancer</strong>s is slowly<br />

evolving as the standard <strong>of</strong> care but minimally invasive<br />

approaches for <strong>rectal</strong> <strong>cancer</strong> have been viewed with significant<br />

skepticism.<br />

Laparoscopic <strong>rectal</strong> resection for <strong>cancer</strong> is performed<br />

by select surgeons at specialized centers. The variability<br />

in anatomic definitions <strong>of</strong> the rectum, technique, selection<br />

criteria, and need for neoadjuvant therapy amongst<br />

this group <strong>of</strong> surgeons have made parallel comparisons<br />

difficult and ambiguous. Concern over local recurrence,<br />

sexual dysfunction and appropriate training measures<br />

have further hindered widespread acceptance <strong>of</strong> this approach.<br />

This opinion addresses short-term and oncological<br />

outcomes for laparoscopic resection <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>,<br />

the aforementioned obstacles, and current controversies<br />

regarding technical approaches.<br />

ONCOlOgICal OUTCOmes<br />

TOPIC HIGHLIGHT<br />

There are many potential endpoints for determining success<br />

for laparoscopic <strong>rectal</strong> resection. Undoubtedly, the<br />

February 21, 2011|Volume 17|Issue 7|

---

most significant is ensuring oncologic equivalence when<br />

compared to the open technique. This variable can primarily<br />

be measured by the adequacy <strong>of</strong> circumferential radial<br />

margins, recurrence rates, and both disease free and overall<br />

survival. Furthermore, the incidence <strong>of</strong> sexual dysfunction<br />

and other complications after laparoscopic pelvic dissection<br />

should approximate that with the open approach.<br />

Circumferential radial margin<br />

A positive circumferential resection margin (CRM) is a<br />

known marker for increased risk <strong>of</strong> future recurrence [8] .<br />

Strict adherence to the principles <strong>of</strong> “total meso<strong>rectal</strong> excision”<br />

is essential to preserve the meso<strong>rectal</strong> envelope, obtain<br />

an adequate circumferential margin and therefore reduce<br />

local recurrence rates. The first randomized trial for laparoscopic<br />

<strong>rectal</strong> resection showed a trend towards increased<br />

CRM positivity (6% open vs 12% laparoscopic, P = 0.19)<br />

for anterior resection [3] . Although this was initially alarming,<br />

several surgeons involved were on their learning curve, and<br />

preoperative chemoradiotherapy (CRT) was not standardized.<br />

Fortunately, three year outcomes showed that the difference<br />

in CRM positivity between laparoscopic and open<br />

approaches for anterior resection did not influence local<br />

recurrence rates. More recently, five year outcomes revealed<br />

no difference between groups in survival, disease-free survival,<br />

and local and distant recurrence [9,10] . Wound/port-site<br />

recurrence rates in the laparoscopic arm were 2.4% and also<br />

unchanged [10] . Conversion was associated with significantly<br />

worse outcomes overall but not disease-free survival.<br />

In the largest retrospective review to date, Ng et al [11]<br />

reported 579 laparoscopic <strong>rectal</strong> resections for <strong>cancer</strong><br />

with a CRM positivity <strong>of</strong> 2.14%. These encouraging results<br />

were further substantiated by two recent randomized<br />

controlled trials that reported CRM positivity rates <strong>of</strong> 2.9%<br />

(open) vs 4% (laparoscopic) [12] and 1.4% (open) and 2.6%<br />

(laparoscopic) [13] .<br />

In 2006, the Spanish Association <strong>of</strong> Surgeons started<br />

an audited teaching program to both make known the<br />

results <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> treatment and improve the outcomes<br />

by the teaching process. The quality <strong>of</strong> the pathologic<br />

specimens for laparoscopic and open <strong>rectal</strong> resection<br />

patients was scored and the circumferential radial margin<br />

was positive if tumor was located 1 mm or less from the<br />

surface <strong>of</strong> the specimen. No differences between groups<br />

for the completeness <strong>of</strong> the mesorectum or distance <strong>of</strong><br />

the tumor from the CRM were observed [14] . Although<br />

laparoscopic TME amongst this experienced group approximates<br />

that for their open resection for select tumors,<br />

the results may not be as favorable for low bulky lesions<br />

or those in an obese male or narrow pelvis.<br />

Local recurrence<br />

As highlighted above, the five year results <strong>of</strong> the MRC<br />

CLASSIC trial reported similar regional recurrence for<br />

laparoscopic vs open resection <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>. Several<br />

other studies have also shown acceptable regional recurrence<br />

rates. In their retrospective review, Ng and colleagues<br />

reported two port site recurrences and a pelvic recurrence<br />

rate <strong>of</strong> 7.4% [11] . Similarly, ten year outcomes from a pro-<br />

WJG|www.wjgnet.com<br />

Champagne BJ et al . Evidence for laparoscopic <strong>rectal</strong> resection<br />

Table 1 Overall survival for laparoscopic <strong>rectal</strong> resection with<br />

minimal 5 yr follow-up<br />

Authors Survival<br />

(laparoscopic)<br />

Survival<br />

(open)<br />

Follow-up<br />

(yr)<br />

MRC CLASSIC (Jayne et al) 57.9% 58.1% 5<br />

Sartori et al 75.4% NA 5<br />

Ng et al 63.9% 55.0% 10<br />

Lam et al 64.0% 5<br />

Laurent et al 82.0% 79.0% 5<br />

Ng et al 70.0% NA 5<br />

Siami et al 80.2% NA 5<br />

Bianchi et al 81.4% NA 5<br />

Tsang et al 81.3% NA 5<br />

NA: Not applicable.<br />

spective randomized trial for the laparoscopic resection <strong>of</strong><br />

upper <strong>rectal</strong> <strong>cancer</strong>s demonstrated a regional recurrence<br />

rate <strong>of</strong> 7.1% with no port-site recurrences [13] . Laurent and<br />

colleagues aimed to assess long-term oncologic outcomes<br />

after laparoscopic versus open surgery for <strong>rectal</strong> <strong>cancer</strong><br />

from in a retrospective comparative study [15] . 471 patients<br />

had <strong>rectal</strong> excision for invasive <strong>rectal</strong> carcinoma during<br />

the trial period: 238 were treated by laparoscopy and 233<br />

by open procedure. At 5 years, there was no difference <strong>of</strong><br />

local recurrence (3.9% vs 5.5%, P = 0.371) between laparoscopic<br />

and open surgery [15] .<br />

The multi-institutional series from Japan reported 1057<br />

selected patients with <strong>rectal</strong> <strong>cancer</strong> that underwent laparoscopic<br />

surgery [16] . All the data regarding the patient details<br />

and operative and postoperative outcome were collected<br />

retrospectively. At thirty months recurrence was found in<br />

6.6% <strong>of</strong> the 1011 curatively treated patients. Specifically,<br />

local recurrence occurred in 11 patients (1.0%) and there<br />

was no port-site metastasis (Table 1) [15] .<br />

FUNCTIONal OUTCOmes<br />

Laparoscopic <strong>rectal</strong> surgery proponents argue that the view<br />

in the pelvis is superior compared to the open approach.<br />

This magnification theoretically provides better visualization<br />

<strong>of</strong> the pelvic nerves. However, in the first randomized<br />

trial for laparoscopic <strong>rectal</strong> <strong>cancer</strong> male sexual function,<br />

erection and ejaculation were all significantly reduced with<br />

laparoscopic surgery. This should be interpreted with caution<br />

considering the aforementioned learning curve and<br />

that more patients in the laparoscopic group underwent a<br />

full TME, as compared to the open group. Bladder function<br />

remained similar between groups.<br />

In a prospective evaluation <strong>of</strong> sexual function Stamopoulos<br />

and colleagues [17] used the international index <strong>of</strong><br />

erectile function (IIEF) for 56 patients who underwent<br />

<strong>rectal</strong> <strong>cancer</strong> surgery (38 open vs 18 laparoscopic procedures,<br />

38 low anterior vs 18 abdominoperineal resections).<br />

Rectal <strong>cancer</strong> resections were associated with a significant<br />

reduction in IIEF scores and high rates <strong>of</strong> sexual dysfunction<br />

at 3 and 6 mo. The IIEF and domain scores at<br />

different assessment points were comparable between the<br />

laparoscopic and open surgery groups [17] .<br />

863 February 21, 2011|Volume 17|Issue 7|

---

Champagne BJ et al . Evidence for laparoscopic <strong>rectal</strong> resection<br />

Morino et al [18] also analyzed male sexual and urinary<br />

function after laparoscopic total meso<strong>rectal</strong> excision. They<br />

found that sexual desire was maintained by 55.6%, ability<br />

to engage in intercourse by 57.8%, and ability to achieve<br />

orgasm and ejaculation by 37.8% <strong>of</strong> the patients. The distance<br />

<strong>of</strong> the tumor from the anal verge and adjuvant or<br />

neoadjuvant treatments were the significant predictors <strong>of</strong><br />

poor postoperative sexual function. Seven patients (14%)<br />

presented transitory postoperative urinary dysfunction, all<br />

<strong>of</strong> whom were medically treated. Tumor <strong>stage</strong> and distance<br />

from the anal verge were independently associated with the<br />

postoperative global international prostatic symptom score<br />

(IPSS). No differences were observed in urinary quality <strong>of</strong><br />

life. The authors concluded that laparoscopic resection did<br />

not reproduce or improve on sexual and urinary dysfunction<br />

outcomes obtained in the best open TME series [18] .<br />

In another series with investigators well beyond their<br />

learning curve, urinary dysfunction was reported by 6 (6%)<br />

patients and 6 (6%) patients had sexual dysfunction, manifesting<br />

as retrograde ejaculation in four patients and erectile<br />

dysfunction in a further two patients. The low rates <strong>of</strong><br />

sexual dysfunction in this unit may be attributable to pelvic<br />

dissection only being undertaken by experienced, dedicated<br />

laparoscopic colo<strong>rectal</strong> surgeons. Previous studies reporting<br />

poorer functional outcomes have probably included a significant<br />

number <strong>of</strong> patients on the surgeons’ learning curve.<br />

CONVeRsION<br />

The conversion rate for laparoscopic <strong>rectal</strong> resection is<br />

variable between centers and levels <strong>of</strong> expertise. The MRC<br />

CLASSIC randomized trial had a conversion rate <strong>of</strong> 32%<br />

for <strong>rectal</strong> <strong>cancer</strong> [3] , yet a previous experience <strong>of</strong> only 20<br />

laparoscopic colon and <strong>rectal</strong> cases was sufficient to participate.<br />

A similar conversion rate (30%) was realized by Ng<br />

et al [11] in their ten year experience with laparoscopic <strong>rectal</strong><br />

resection. After the inception <strong>of</strong> this trial significant improvements<br />

in energy devices, ports, cameras, and stapling<br />

devices have occurred that, combined with their experience,<br />

would likely decrease their current conversion rate.<br />

Further analysis has shown that factors associated<br />

with conversion are BMI, male sex, and locally advanced<br />

tumors [19] .<br />

More recently, conversion rates reflect the beneficial<br />

impact <strong>of</strong> extensive experience. Three large retrospective<br />

series (2008-2010) have reported conversion rates as low<br />

as 5.4% [11] , 15% [15] , and 4.9% [20] . The multi-center retrospective<br />

series from Japan also demonstrated a reasonable<br />

conversion rate <strong>of</strong> 7.3% [16] .<br />

Conversion rates are as dependent on a reasonable<br />

inclusion or selection criteria as surgeon experience. Very<br />

low bulky tumors, anterior lesions in men with previous<br />

intervention for prostate <strong>cancer</strong>, T4 lesions, reoperative<br />

pelvic dissections and morbidly obese patients should be<br />

reserved for the open approach in most cases.<br />

DeFININg THe ReCTUm<br />

There has been considerable debate as to the exact length<br />

WJG|www.wjgnet.com<br />

<strong>of</strong> the rectum, the site <strong>of</strong> transition from sigmoid to rectum<br />

and most importantly the point <strong>of</strong> reference from<br />

where measurements are made. Within the surgical literature,<br />

numerous series have reported <strong>rectal</strong> <strong>cancer</strong> as being<br />

within 15, 16 and even 18 cm from the verge, although<br />

several other series use the dentate line as the reference<br />

point. Currently, the variability <strong>of</strong> these definitions not<br />

only impacts surgical decision making between centers but<br />

also the timing and need for neoadjuvant therapy, which<br />

in turn impacts oncologic outcomes and morbidity rates.<br />

There are also significant differences in practice internationally<br />

with respect to the selection criteria used for<br />

CRT. In the United States, most practitioners adhere to<br />

the NCCN guidelines that recommend neoadjuvant CRT<br />

for patients with T3 or N1 disease with tumors within<br />

10 cm <strong>of</strong> the dentate line [21] . The Mercury study group [22]<br />

has provided evidence that pre-operative MRI can accurately<br />

predict surgical resection margins. This report<br />

has led to a paradigm shift in the preoperative investigation<br />

and treatment <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> in the UK. With this<br />

approach, CRT is predominantly used when the tumor<br />

threatens or involves the meso<strong>rectal</strong> fascia and in all low<br />

<strong>rectal</strong> <strong>cancer</strong> where there is an inherent increased risk <strong>of</strong><br />

involving the CRM.<br />

Despite these apparent discrepancies most surgeons<br />

and oncologists generally agree that <strong>rectal</strong> <strong>cancer</strong> consists<br />

<strong>of</strong> extraperitoneal and intraperitoneal lesions. Tumors at<br />

or below the anterior reflection should be grouped together<br />

in investigations and are the real subject <strong>of</strong> this and<br />

other discussions surrounding laparoscopic <strong>rectal</strong> <strong>cancer</strong>.<br />

TeCHNICal IssUes<br />

The most important variable being assessed with laparoscopic<br />

vs open <strong>rectal</strong> resection for <strong>cancer</strong> is the pelvic<br />

dissection. Surgeons must analyze their own ability to<br />

perform a laparoscopic total meso<strong>rectal</strong> excision with<br />

the same precision achieved by their open technique. Although<br />

this fact seems obvious it cannot be understated.<br />

Several studies continue to populate the literature describing<br />

a “hybrid” technique. With this approach the mobilization<br />

<strong>of</strong> the left colon is performed laparoscopically<br />

and the pelvic dissection and transection <strong>of</strong> the rectum<br />

are performed through a Pfannenstiel or lower midline<br />

incision. Outcomes with this technique have been favorable<br />

and it certainly has inherent advantages but unquestionably<br />

it is not laparoscopic <strong>rectal</strong> surgery. Therefore,<br />

although published results substantiate its role, ideally it<br />

should not be included in trials or case series for laparoscopic<br />

<strong>rectal</strong> resection and should not be billed or coded<br />

as such. If this procedure continues to demonstrate favorable<br />

outcomes and has a shorter learning curve it may<br />

require its own procedure code in the future.<br />

Internationally, the straight laparoscopic approach with<br />

three or four abdominal trocar sites and a left lower quadrant<br />

or periumbilical extraction incision is preferred. Outcomes<br />

with this approach (outlined in previous section)<br />

were initially concerning but have now more consistently<br />

been favorable. As discussed above, the protracted opera-<br />

864 February 21, 2011|Volume 17|Issue 7|

---

tive times and concerns over both local recurrence and sexual<br />

function have been diminished with increased operative<br />

experience. This may be the most technically demanding<br />

method and surgeons preferring this technique recognize<br />

its limitations. Dividing the lower rectum, providing adequate<br />

traction low in the pelvis, and teaching trainees how<br />

to perform an appropriate total meso<strong>rectal</strong> excision are the<br />

current challenges. This procedure is less daunting for patients<br />

requiring an abdominal perineal resection. They are<br />

left without the morbidity <strong>of</strong> an abdominal wound as the<br />

specimen is routinely removed through the perineum.<br />

Proponents <strong>of</strong> hand-assisted laparoscopy in the United<br />

States continuously have demonstrated equivalent outcomes<br />

for laparoscopic colon resection with reduced operative<br />

times. More recently results with hand-assisted methods<br />

for <strong>rectal</strong> <strong>cancer</strong> have also been reported with success [23,24] .<br />

When the hand-assisted device is left in place and the pelvic<br />

dissection is performed laparoscopically these cases should<br />

be included with other minimally invasive approaches to<br />

<strong>rectal</strong> <strong>cancer</strong>. This approach may be favorable in patients<br />

with a bulky mesorectum or when additional tension is required<br />

to facilitate accurate transection <strong>of</strong> the low rectum.<br />

Dividing the rectum laparoscopically is not always<br />

technically feasible The limited angulation <strong>of</strong> the stapler<br />

and physical limitations <strong>of</strong> working in the bony confines<br />

<strong>of</strong> the pelvis are common deterrents [25] . In this situation,<br />

having an assistant apply perineal pressure may elevate the<br />

pelvic floor enough to allow the first cartridge <strong>of</strong> the stapler<br />

to reach the ano<strong>rectal</strong> junction. Furthermore, utilizing<br />

a suprapubic port or medicalizing the right lower quadrant<br />

port may help. Lastly, if these techniques are unsuccessful<br />

a limited lower midline or Pfannenstiel incision can<br />

be made and a 30 mm open stapler can be introduced. If<br />

an appropriate distal margin is not obtainable with these<br />

methods a mucosectomy with partial inter-sphincteric resection<br />

and hand-sewn coloanal anastomosis is performed.<br />

In addition to the difficulty with transection, very low<br />

anteriorly based and bulky lesions are <strong>of</strong>ten challenging.<br />

Entering the appropriate plane anterior to Denonvillier’s<br />

fascia laparoscopically, respecting the need for an adequate<br />

radial margin, and maintaining meticulous hemostasis is<br />

essential. In this location, tissue planes can be more ambiguous<br />

and any bleeding further obscures the appropriate<br />

anatomy. If there is considerable doubt that the correct<br />

tissue plane is being violated, immediate conversion is<br />

warranted. Ideally these tumors are approached by surgeons<br />

who are well past their learning curve for laparoscopic<br />

pelvic dissection.<br />

The recognition <strong>of</strong> these technical limitations and the<br />

ongoing development <strong>of</strong> advanced technology led to the<br />

introduction <strong>of</strong> robotic applications for low pelvic dissection.<br />

Data for robotic approaches to <strong>rectal</strong> <strong>cancer</strong> have<br />

recently been published and presented in national and<br />

international forums. The advantage <strong>of</strong> operating with<br />

more degrees <strong>of</strong> freedom for low <strong>rectal</strong> <strong>cancer</strong> is apparent<br />

and is <strong>of</strong> particular benefit in a narrow male pelvis. However,<br />

concerns over significantly increased cost, operative<br />

times, and training have limited its widespread adoption.<br />

Furthermore, proponents seem to be employing this<br />

WJG|www.wjgnet.com<br />

Champagne BJ et al . Evidence for laparoscopic <strong>rectal</strong> resection<br />

approach carte blanche and looking for opportunities to<br />

expand its indications rather than using it as a tool. In the<br />

era <strong>of</strong> economic constraints and limited resident exposure<br />

to cases a costly technique with ill defined training methods<br />

should be used for select cases only.<br />

CONClUsION<br />

Technical advances in the field <strong>of</strong> coloproctology have<br />

unquestionably improved patient outcomes. However,<br />

it is essential that we continue to strive to define the appropriate<br />

inclusion criteria for new approaches in regards<br />

to patient, disease, and surgeon experience. Historically,<br />

new technology, such as the PPH stapler, robotics, and<br />

laparoscopy, has become more than an optional approach<br />

or “tool”. Surgeons inherently develop extraordinary<br />

comfort with the technology and tend to expand its indications,<br />

<strong>of</strong>ten illogically. Creativity and “pushing the envelope”<br />

should not be discouraged but when it becomes<br />

apparent that new approaches become simply a “means to<br />

an end” patients outcomes may be less than ideal.<br />

The abundance <strong>of</strong> data for laparoscopic <strong>rectal</strong> resection<br />

for <strong>cancer</strong> supports its continued implantation and<br />

widespread usage by experienced surgeons for select<br />

patients. Until we become more adept at operating in the<br />

low narrow pelvis and transecting the rectum we must<br />

recognize that this approach is complementary to our<br />

open technique. To ensure the best outcomes we must<br />

continue to recognize the difference between the questions,<br />

“can you?” and “should you?” in regards to minimally<br />

invasive surgery.<br />

ReFeReNCes<br />

1 Lacy AM, García-Valdecasas JC, Delgado S, Castells A,<br />

Taurá P, Piqué JM, Visa J. Laparoscopy-assisted colectomy<br />

versus open colectomy for treatment <strong>of</strong> non-metastatic colon<br />

<strong>cancer</strong>: a randomised trial. Lancet 2002; 359: 2224-2229<br />

2 A comparison <strong>of</strong> laparoscopically assisted and open colectomy<br />

for colon <strong>cancer</strong>. N Engl J Med 2004; 350: 2050-2059<br />

3 Guillou PJ, Quirke P, Thorpe H, Walker J, Jayne DG, Smith<br />

AM, Heath RM, Brown JM. Short-term endpoints <strong>of</strong> conventional<br />

versus laparoscopic-assisted surgery in patients<br />

with colo<strong>rectal</strong> <strong>cancer</strong> (MRC CLASICC trial): multicentre,<br />

randomised controlled trial. Lancet 2005; 365: 1718-1726<br />

4 Leung KL, Kwok SP, Lam SC, Lee JF, Yiu RY, Ng SS, Lai PB,<br />

Lau WY. Laparoscopic resection <strong>of</strong> rectosigmoid carcinoma:<br />

prospective randomised trial. Lancet 2004; 363: 1187-1192<br />

5 Kennedy GD, Heise C, Rajamanickam V, Harms B, Foley EF.<br />

Laparoscopy decreases postoperative complication rates after<br />

abdominal colectomy: results from the national surgical quality<br />

improvement program. Ann Surg 2009; 249: 596-601<br />

6 Delaney CP. Outcome <strong>of</strong> discharge within 24 to 72 hours<br />

after laparoscopic colo<strong>rectal</strong> surgery. Dis Colon Rectum 2008;<br />

51: 181-185<br />

7 Lindsetmo RO, Champagne B, Delaney CP. Laparoscopic<br />

<strong>rectal</strong> resections and fast-track surgery: what can be expected?<br />

Am J Surg 2009; 197: 408-412<br />

8 Nagtegaal ID, Quirke P. What is the role for the circumferential<br />

margin in the modern treatment <strong>of</strong> <strong>rectal</strong> <strong>cancer</strong>? J<br />

Clin Oncol 2008; 26: 303-312<br />

9 Jayne DG, Guillou PJ, Thorpe H, Quirke P, Copeland J,<br />

Smith AM, Heath RM, Brown JM. Randomized trial <strong>of</strong> laparoscopic-assisted<br />

resection <strong>of</strong> colo<strong>rectal</strong> carcinoma: 3-year<br />

865 February 21, 2011|Volume 17|Issue 7|

---

Champagne BJ et al . Evidence for laparoscopic <strong>rectal</strong> resection<br />

results <strong>of</strong> the UK MRC CLASICC Trial Group. J Clin Oncol<br />

2007; 25: 3061-3068<br />

10 Jayne DG, Thorpe HC, Copeland J, Quirke P, Brown JM,<br />

Guillou PJ. Five-year follow-up <strong>of</strong> the Medical Research<br />

Council CLASICC trial <strong>of</strong> laparoscopically assisted versus<br />

open surgery for colo<strong>rectal</strong> <strong>cancer</strong>. Br J Surg 2010; 97:<br />

1638-1645<br />

11 Ng KH, Ng DC, Cheung HY, Wong JC, Yau KK, Chung CC,<br />

Li MK. Laparoscopic resection for <strong>rectal</strong> <strong>cancer</strong>s: lessons<br />

learned from 579 cases. Ann Surg 2009; 249: 82-86<br />

12 Lujan J, Valero G, Hernandez Q, Sanchez A, Frutos MD,<br />

Parrilla P. Randomized clinical trial comparing laparoscopic<br />

and open surgery in patients with <strong>rectal</strong> <strong>cancer</strong>. Br J Surg<br />

2009; 96: 982-989<br />

13 Ng SS, Leung KL, Lee JF, Yiu RY, Li JC, Hon SS. Long-term<br />

morbidity and oncologic outcomes <strong>of</strong> laparoscopic-assisted<br />

anterior resection for upper <strong>rectal</strong> <strong>cancer</strong>: ten-year results <strong>of</strong><br />

a prospective, randomized trial. Dis Colon Rectum 2009; 52:<br />

558-566<br />

14 Biondo S, Ortiz H, Lujan J, Codina-Cazador A, Espin E,<br />

Garcia-Granero E, Kreisler E, de Miguel M, Alos R, Echeverria<br />

A. Quality <strong>of</strong> mesorectum after laparoscopic resection<br />

for <strong>rectal</strong> <strong>cancer</strong> - results <strong>of</strong> an audited teaching programme<br />

in Spain. Colo<strong>rectal</strong> Dis 2010; 12: 24-31<br />

15 Laurent C, Leblanc F, Wütrich P, Scheffler M, Rullier E.<br />

Laparoscopic versus open surgery for <strong>rectal</strong> <strong>cancer</strong>: longterm<br />

oncologic results. Ann Surg 2009; 250: 54-61<br />

16 Miyajima N, Fukunaga M, Hasegawa H, Tanaka J, Okuda<br />

J, Watanabe M. Results <strong>of</strong> a multicenter study <strong>of</strong> 1,057 cases<br />

<strong>of</strong> <strong>rectal</strong> <strong>cancer</strong> treated by laparoscopic surgery. Surg Endosc<br />

2009; 23: 113-118<br />

17 Stamopoulos P, Theodoropoulos GE, Papailiou J, Savidis<br />

D, Golemati C, Bramis K, Panoussopoulos SG, Leandros E.<br />

Prospective evaluation <strong>of</strong> sexual function after open and<br />

laparoscopic surgery for <strong>rectal</strong> <strong>cancer</strong>. Surg Endosc 2009;<br />

Epub ahead <strong>of</strong> print<br />

WJG|www.wjgnet.com<br />

18 Morino M, Allaix ME, Giraudo G, Corno F, Garrone C.<br />

Laparoscopic versus open surgery for extraperitoneal <strong>rectal</strong><br />

<strong>cancer</strong>: a prospective comparative study. Surg Endosc 2005;<br />

19: 1460-1467<br />

19 Thorpe H, Jayne DG, Guillou PJ, Quirke P, Copeland J,<br />

Brown JM. Patient factors influencing conversion from laparoscopically<br />

assisted to open surgery for colo<strong>rectal</strong> <strong>cancer</strong>.<br />

Br J Surg 2008; 95: 199-205<br />

20 Bege T, Lelong B, Esterni B, Turrini O, Guiramand J, Francon<br />

D, Mokart D, Houvenaeghel G, Giovannini M, Delpero JR.<br />

The learning curve for the laparoscopic approach to conservative<br />

meso<strong>rectal</strong> excision for <strong>rectal</strong> <strong>cancer</strong>: lessons drawn from<br />

a single institution’s experience. Ann Surg 2010; 251: 249-253<br />

21 Engstrom PF, Arnoletti JP, Benson AB 3rd, Chen YJ, Choti<br />

MA, Cooper HS, Covey A, Dilawari RA, Early DS, Enzinger<br />

PC, Fakih MG, Fleshman J Jr, Fuchs C, Grem JL, Kiel K, Knol<br />

JA, Leong LA, Lin E, Mulcahy MF, Rao S, Ryan DP, Saltz L,<br />

Shibata D, Skibber JM, S<strong>of</strong>ocleous C, Thomas J, Venook AP,<br />

Willett C. NCCN Clinical Practice Guidelines in Oncology:<br />

<strong>rectal</strong> <strong>cancer</strong>. J Natl Compr Canc Netw 2009; 7: 838-881<br />

22 Salerno G, Daniels IR, Brown G, Heald RJ, Moran BJ. Magnetic<br />

resonance imaging pelvimetry in 186 patients with <strong>rectal</strong><br />

<strong>cancer</strong> confirms an overlap in pelvic size between males<br />

and females. Colo<strong>rectal</strong> Dis 2006; 8: 772-776<br />

23 Milsom JW, de Oliveira O Jr, Trencheva KI, Pandey S, Lee<br />

SW, Sonoda T. Long-term outcomes <strong>of</strong> patients undergoing<br />

curative laparoscopic surgery for mid and low <strong>rectal</strong> <strong>cancer</strong>.<br />

Dis Colon Rectum 2009; 52: 1215-1222<br />

24 Larson DW, Boostrom SY, Cima RR, Pemberton JH, Larson<br />

DR, Dozois EJ. Laparoscopic surgery for <strong>rectal</strong> <strong>cancer</strong>: shortterm<br />

benefits and oncologic outcomes using more than one<br />

technique. Tech Coloproctol 2010; 14: 125-131<br />

25 Brannigan AE, De Buck S, Suetens P, Penninckx F, D’Hoore<br />

A. Intracorporeal <strong>rectal</strong> stapling following laparoscopic total<br />

meso<strong>rectal</strong> excision: overcoming a challenge. Surg Endosc<br />

2006; 20: 952-955<br />

S- Editor Sun H L- Editor O’Neill M E- Editor Ma WH<br />

866 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.867<br />

Advances in diagnosis, treatment and palliation <strong>of</strong><br />

pancreatic carcinoma: 1990-2010<br />

Chakshu Sharma, Karim M Eltawil, Paul D Renfrew, Mark J Walsh, Michele Molinari<br />

Chakshu Sharma, Karim M Eltawil, Paul D Renfrew, Mark J<br />

Walsh, Michele Molinari, Department <strong>of</strong> Surgery, Queen Elizabeth<br />

ІІ Health Sciences Center, Dalhousie University, Halifax,<br />

Nova Scotia, B3H 2Y9, Canada<br />

Author contributions: Sharma C, Eltawil KM and Molinari<br />

M contributed equally to this work; Sharma C performed the<br />

systematic literature review, contributed to the appraisal <strong>of</strong> the<br />

literature and wrote the paper; Eltawil KM performed the systematic<br />

literature review, contributed to the appraisal <strong>of</strong> the literature<br />

and wrote the paper; Renfrew PD and Walsh MJ contributed<br />

to the design framework <strong>of</strong> the systematic review; Molinari M<br />

performed the systematic literature review, contributed to the appraisal<br />

<strong>of</strong> the literature and wrote the paper.<br />

Correspondence to: Michele Molinari, MD, Department <strong>of</strong><br />

Surgery, Queen Elizabeth ІІ Health Sciences Center, Dalhousie<br />

University, Rm 6-254, Victoria Building, 1276 South Park Street,<br />

Halifax, Nova Scotia, B3H 2Y9,<br />

Canada. michele.molinari@cdha.nshealth.ca<br />

Telephone: +1-902-4737624 Fax: +1-902-4737639<br />

Received: October 25, 2010 Revised: December 8, 2010<br />

Accepted: December 15, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

Several advances in genetics, diagnosis and palliation<br />

<strong>of</strong> pancreatic <strong>cancer</strong> (PC) have occurred in the last decades.<br />

A multidisciplinary approach to this disease is<br />

therefore recommended. PC is relatively common as it<br />

is the fourth leading cause <strong>of</strong> <strong>cancer</strong> related mortality.<br />

Most patients present with obstructive jaundice, epigastric<br />

or back pain, weight loss and anorexia. Despite<br />

improvements in diagnostic modalities, the majority <strong>of</strong><br />

cases are still detected in advanced <strong>stage</strong>s. The only<br />

curative treatment for PC remains surgical resection. No<br />

more than 20% <strong>of</strong> patients are candidates for surgery<br />

at the time <strong>of</strong> diagnosis and survival remains quite poor<br />

as adjuvant therapies are not very effective. A small<br />

percentage <strong>of</strong> patients with borderline non-resectable<br />

PC might benefit from neo-adjuvant chemoradiation<br />

therapy enabling them to undergo resection; however,<br />

randomized controlled studies are needed to prove the<br />

WJG|www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 867-897<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

benefits <strong>of</strong> this strategy. Patients with unresectable<br />

PC benefit from palliative interventions such as biliary<br />

decompression and celiac plexus block. Further clinical<br />

trials to evaluate new chemo and radiation protocols<br />

as well as identification <strong>of</strong> genetic markers for PC are<br />

needed to improve the overall survival <strong>of</strong> patients affected<br />

by PC, as the current overall 5-year survival rate<br />

<strong>of</strong> patients affected by PC is still less than 5%. The aim<br />

<strong>of</strong> this article is to review the most recent high quality<br />

literature on this topic.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Diagnosis; Epidemiology; Palliation; Pancreatic<br />

<strong>cancer</strong>; Therapy<br />

Peer reviewer: Hiroyuki Uehara, MD, PhD, Chief, Division <strong>of</strong><br />

Pancreatology, Department <strong>of</strong> Gastroenterology, Osaka Medical<br />

Center for Cancer and Cardiovascular Diseases, 1-3-3 Nakamichi,<br />

Higashinari, Osaka 537-8511, Japan<br />

Sharma C, Eltawil KM, Renfrew PD, Walsh MJ, Molinari M.<br />

Advances in diagnosis, treatment and palliation <strong>of</strong> pancreatic carcinoma:<br />

1990-2010. <strong>World</strong> J Gastroenterol 2011; 17(7): 867-897<br />

Available from: URL: http://www.wjgnet.com/1007-9327/full/<br />

v17/i7/867.htm DOI: http://dx.doi.org/10.3748/wjg.v17.i7.867<br />

INTRODUCTION<br />

REVIEW<br />

The vast majority (90%) <strong>of</strong> pancreatic <strong>cancer</strong>s (PC) are<br />

malignant tumors originating from pancreatic ductal cells [1] .<br />

Anatomically, 78% <strong>of</strong> PCs are located in the head, and<br />

the remaining 22% are equally distributed in the body and<br />

in the tail [2] . The most common clinical presentations are<br />

progressive weight loss and anorexia, mid abdominal pain<br />

and jaundice [3-5] . Over the past two decades many advances<br />

in the diagnosis, therapy and palliation <strong>of</strong> PC have taken<br />

place although the overall survival <strong>of</strong> affected patients has<br />

not improved significantly. The aim <strong>of</strong> this article is to review<br />

the most recent high quality literature on this topic.<br />

867 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

the risk in comparison to normal individuals [39] . This was<br />

confirmed by another study that estimated a 40% cumulative<br />

risk <strong>of</strong> PC in patients with hereditary pancreatitis<br />

by the age <strong>of</strong> 70. For patients with paternal inheritance,<br />

the cumulative risk <strong>of</strong> PC was even higher with risk up<br />

to 75% [40] . Cytokines, reactive oxygen molecules and proinflammatory<br />

compounds seem to be responsible, as inflammation<br />

is a risk factor for many other solid tumors [38] .<br />

Genetic predisposition for PC<br />

Genetic predisposing factors have been a topic <strong>of</strong> intense<br />

research in the last decades. Case reports <strong>of</strong> families with<br />

multiple affected members suggest that PC might have a<br />

hereditary background [41] . Yet, a large population study on<br />

twins identified hereditary factors for prostatic, breast and<br />

colo<strong>rectal</strong> <strong>cancer</strong>s, but not for PC [42] . A Canadian study<br />

on patients with suspected hereditary <strong>cancer</strong> syndromes<br />

found that the standardized incidence rate <strong>of</strong> PC was 4.5<br />

(CI 0.54-16.) when <strong>cancer</strong> affected one 1st degree relative,<br />

and increased to 6.4 (CI 1.8-16.4) and 32 (CI 10.4-74.7)<br />

when two and three 1st degree relatives were affected, respectively<br />

[43] . This translates to an estimated incidence <strong>of</strong><br />

PC <strong>of</strong> 41, 58 and 288 per 100 000 individuals, respectively,<br />

compared to 9 per 100 000 for the general population [44] .<br />

Brentnall et al [45] and Meckler et al [46] described examples<br />

<strong>of</strong> autosomal dominant PC in individuals presenting at<br />

early age (median age 43 years) and with high genetic penetrance<br />

(more than 80%). A mutation causing a proline<br />

(hydrophobic) to serine (hydrophilic) amino acid change<br />

(P239S) within a highly conserved region <strong>of</strong> the gene<br />

encoding paladin (PALLD) was found in all affected family<br />

members and was absent in non-affected individuals<br />

<strong>of</strong> the same family (family X). Another study has shown<br />

that the P239S mutation was only specific for family X<br />

and was not a common finding in other individuals with<br />

suspected familial PC [47] . Currently, genetic predisposition<br />

is thought to be responsible for 7% to 10% <strong>of</strong> all PC [48] .<br />

Genetic factors including germline mutations in p16/CD-<br />

KN2A [49] , BRCA2 [50-52] and STK 11 [53] genes increase the<br />

risk <strong>of</strong> PC. The combination <strong>of</strong> all these known genetic<br />

factors accounts for less than 20% <strong>of</strong> the familial aggregation<br />

<strong>of</strong> PC, suggesting the role <strong>of</strong> other additional genes.<br />

A systematic review and meta analysis <strong>of</strong> studies that<br />

quantified familial risk <strong>of</strong> PC has shown that individuals<br />

with positive family history have an almost two-fold<br />

increased risk (RR = 1.80, CI 1.48-2.12) [54] . Therefore,<br />

families with two or more cases may benefit from a comprehensive<br />

risk assessment involving collection <strong>of</strong> detailed<br />

family history information and data regarding other risk<br />

factors [55] . A case-control study <strong>of</strong> PC in two Canadian<br />

provinces (Ontario and Quebec) assessed a total <strong>of</strong> 174<br />

PC cases and 136 healthy controls that were compared for<br />

their family histories <strong>of</strong> <strong>cancer</strong>. Information regarding the<br />

ages and sites <strong>of</strong> <strong>cancer</strong> was obtained in 966 first degree<br />

relatives <strong>of</strong> the PC patients and for 903 first degree relatives<br />

<strong>of</strong> the control group. PC was the only malignancy in<br />

excess in relatives <strong>of</strong> patients with PC, compared to the<br />

control group (RR = 5, P = 0.01). The lifetime risk <strong>of</strong> PC<br />

was 4.7% for the first degree relatives and the risk was 7.2%<br />

WJG|www.wjgnet.com<br />

for relatives <strong>of</strong> patients diagnosed before the age <strong>of</strong> 60 [56] .<br />

Besides the isolated aggregation <strong>of</strong> PC in some families,<br />

several other hereditary disorders predispose to PC in<br />

known familial <strong>cancer</strong> conditions [57] . These include hereditary<br />

pancreatitis, Puetz-Jeghers syndrome, familial atypical<br />

multiple mole melanoma, familial breast and ovarian<br />

<strong>cancer</strong>, Li-Fraumeni syndrome, Fanconi anaemia, Ataxiatelangiectasia,<br />

familial adenomatous polyposis, cystic fibrosis<br />

and possible hereditary non-polyposis colon <strong>cancer</strong><br />

or Lynch syndrome [11,55,58-60] .<br />

Familial PC registries<br />

As the prognosis <strong>of</strong> PC is generally poor, there has been<br />

a strong interest in detecting genes or other markers that<br />

could help identify high risk patients at an early <strong>stage</strong>.<br />

Although a precise genetic marker for this scope is not<br />

currently available, geneticists and epidemiologists have<br />

been pr<strong>of</strong>iling traits <strong>of</strong> high risk families enrolled in registries<br />

established in North America and Europe [61] . Even<br />

if there is no standardized definition for familial PC, most<br />

authors apply the term to families with at least two first<br />

degree relatives affected by PC in the absence <strong>of</strong> other<br />

predisposing familial conditions [61] . The creation <strong>of</strong> familial<br />

PC registries has been used not only for identification<br />

<strong>of</strong> genetic mutations, but also for the screening <strong>of</strong> high<br />

risk individuals. In selected centers in North America and<br />

Europe, screening programs for high risk individuals have<br />

been implemented with the use <strong>of</strong> endoscopic ultrasound<br />

(EUS) and computed tomography (CT) scanning or magnetic<br />

resonance imaging (MRI). Such early diagnosis <strong>of</strong><br />

PC within a comprehensive screening program is hoped<br />

to ultimately result in improved survival [62] . The discovery<br />

<strong>of</strong> the genetic bases <strong>of</strong> inherited PC continues to be an<br />

active area <strong>of</strong> research, and in 2001 a multi-center linkage<br />

was formed to conduct studies aimed at the localization<br />

and identification <strong>of</strong> PC susceptibility genes (PAC-<br />

GENE) [63] . The complex nature <strong>of</strong> pedigree data makes<br />

it difficult to accurately assess risk based upon the simple<br />

counting <strong>of</strong> the number <strong>of</strong> affected family members, as<br />

it does not adjust for family size, age <strong>of</strong> onset <strong>of</strong> PC, and<br />

the exact relationship between affected family members.<br />

Therefore, computer programs have been developed to<br />

integrate these complex risk factors and pedigree data. In<br />

April 2007, the 1st risk prediction tool for PC, PanaPro<br />

was released [64] . This model provides accurate risk assessment<br />

for kindreds with familial PC as the receiver operating<br />

characteristic (ROC) curve was 0.75 which is considered<br />

good for predictive models.<br />

Nutritional status<br />

A number <strong>of</strong> studies have explored the relationship<br />

between BMI, lifestyle, diet and the risk <strong>of</strong> PC, but uncertainty<br />

regarding the strength <strong>of</strong> this relationship still<br />

exists. A recent case-control study <strong>of</strong> 841 patients and<br />

754 healthy controls showed that individuals with a BMI<br />

<strong>of</strong> 25-29.9 had an OR <strong>of</strong> 1.67 (95% CI: 1.20-2.34) in<br />

comparison to obese patients (BMI <strong>of</strong> ≥ 30) who had an<br />

OR <strong>of</strong> 2.58 (95% CI: 1.70-3.90) independently <strong>of</strong> their<br />

diabetes status [65] . The duration <strong>of</strong> being overweight was<br />

870 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

Table 3 clinico-pathological features <strong>of</strong> the most frequent classes <strong>of</strong> pancreatic <strong>cancer</strong><br />

Classification Frequency<br />

(%)<br />

DIA (incidence per 100 000 patients at risk = 8.37) [69]<br />

SPPN (incidence per 100 000 patients at risk = NA) [69]<br />

IPMN (incidence per 100 000 patients at risk = 0.03) [69]<br />

IPMN with simultaneous DIA: (incidence per 100 000 patients at risk =<br />

NA) [69]<br />

Pancreatoblastoma (incidence per 100 000 patients at risk = NA) [69]<br />

Undifferentiated (incidence per 100 000 patients at risk = 0.03) [69]<br />

Medullary carcinoma (incidence per 100 000 patients at risk = NA) [69]<br />

Mucinous cystadenocarcinoma (incidence per 100 000 patients at risk =<br />

0.43) [69]<br />

Adenosquamous carcinoma (incidence per 100 000 patients at risk =<br />

0.05) [69]<br />

Acinar cell carcinoma (incidence per 100 000 patients at risk = 0.02) [69]<br />

sible for the metabolism <strong>of</strong> β-catenin protein causing its<br />

accumulation in the cytoplasm and nucleus <strong>of</strong> neoplastic<br />

cells [94] . As a result alteration in β-catenin protein expression<br />

disrupts E-cadherin which is a key regulator <strong>of</strong> cell<br />

junctions causing poor adhesion <strong>of</strong> neoplastic cells [95] . Although<br />

there is some histological overlap between SPNN<br />

and other tumors <strong>of</strong> the pancreas, immunolabeling for<br />

β-catenin protein may help establish the diagnosis.<br />

Intraductal papillary mucinous neoplasm<br />

Intraductal papillary mucinous neoplasms (IPMNs) represent<br />

5% <strong>of</strong> all PCs and are papillary epithelial mucinproducing<br />

neoplasms arising in the main pancreatic duct<br />

or in one <strong>of</strong> its branches. IPMNs are relatively common<br />

with increasing age <strong>of</strong> the population [91] and the mean<br />

age at presentation is 65 years [96] . IPMN is a potential premalignant<br />

condition and the risks <strong>of</strong> developing invasive<br />

adenocarcinoma increase with tumor size and when originating<br />

in the main pancreatic duct.<br />

Adenocarcinoma is present in up to one-third <strong>of</strong><br />

patients with IPMN and current guidelines recommend<br />

surgical resection when IPMNs are greater than 3 cm, in<br />

the presence <strong>of</strong> main pancreatic duct dilatation and when<br />

mural nodules are detected [97] .<br />

Neoplastic cells <strong>of</strong> IPMN are columnar with gene<br />

pr<strong>of</strong>iles similar to infiltrating ductal carcinoma. About<br />

25% <strong>of</strong> patients show loss <strong>of</strong> heterozygosity <strong>of</strong> the<br />

STK11/LKB1 gene [98,99] . Other frequent gene mutations<br />

are TP53, KRAS2, and P16/CDKN2A [100] .<br />

Pancreatic intraepithelial neoplasia<br />

Pancreatic intraepithelial neoplasia (PanIN) represents a<br />

WJG|www.wjgnet.com<br />

85-90 [1]<br />

0.1-3 [73]<br />

0.50 [79]<br />

Author yr Survival (5-yr survival after<br />

surgical resection)<br />

Conlon et al [70]<br />

Winter et al [71]<br />

Poultsides et al [72]<br />

Papavramidis et al [74]<br />

Shin et al [76]<br />

5 [75]<br />

Poultsides et al [72]<br />

Fan et al [77]<br />

Sohn et al [78]<br />

Dhebri et al [80]<br />

Saif et al [79]<br />

Paal et al [82]<br />

Connolly et al [83]<br />

NA Wilentz et al [84]<br />

2-7 [81]<br />

1 Ridder et al [85]<br />

4 Madura et al [86]<br />

Mulkeen et al [87]<br />

2 Holen et al [88]<br />

1996 10%<br />

2006 18%<br />

2010 19%<br />

2005 95%<br />

2010 Benign: 95%<br />

Malignant: 64%<br />

2010 42%<br />

2010 57%<br />

2004 43%<br />

2004 50%<br />

2007 80%<br />

2001 3% (3-yr survival)<br />

1987 5 mo (average survival)<br />

2000 11%<br />

14 mo (average survival)<br />

1996 56%<br />

1999 5-7 mo (median survival)<br />

2006<br />

2002 38 mo after surgical resection<br />

(median survival)<br />

14 mo for unresectable disease<br />

(median survival)<br />

DIA: Ductal infiltrating adenocarcinoma; SPPN: Solid pseudo-papillary neoplasm; IPMN: Intraductal papillary nucinous neoplasm; NA: Not applicable.<br />

neoplastic proliferation <strong>of</strong> mucin producing epithelial cells<br />

confined to the smaller pancreatic ducts and is considered<br />

a precursor to invasive ductal carcinoma [101] .<br />

PanINs are usually characterized by lesions too small<br />

to be symptomatic or to be detected by current imaging<br />

technologies [89] . Microscopically, PanINs are classified into<br />

three grades (PanIN-1, PanIN-2 and PanIN-3) based on<br />

the progressive degree <strong>of</strong> architecture abnormality and<br />

cellular atypia [102] . PanIN-1 shows minimum cellular atypia,<br />

PanIN-2 moderate changes and PanIN-3 is equivalent to<br />

PC-in-situ. The discovery <strong>of</strong> specific molecular changes<br />

present in both PanIN and PC has helped to establish<br />

that these small lesions are the precursors to DIA [103] .<br />

Early abnormalities <strong>of</strong> IPMNs are telomerase shortening<br />

and activating point mutations in the KRAS2 gene while<br />

intermediate mutation is the activation <strong>of</strong> the p16/CD-<br />

KN2A gene and late events are alterations in the TP53,<br />

MADH4/DPC4, and BRCA2 genes [102] . The understanding<br />

that many DIAs arise from PanIN lesions has prompted<br />

screening efforts on the detection <strong>of</strong> these small and<br />

potentially curable lesions [104] .<br />

Pancreatoblastoma<br />

Pancreatoblastoma is a rare malignant tumor (0.5% <strong>of</strong><br />

PC) usually presenting in the pediatric age group. Generally,<br />

it appears as a s<strong>of</strong>t and well demarcated mass with<br />

epithelial or acinar differentiation, but <strong>of</strong>ten it has cells<br />

with endocrine and mesenchymal characteristics [79] . Most<br />

pancreato-blastomas affect children with a mean age <strong>of</strong><br />

5 years and are frequently associated with elevated levels<br />

<strong>of</strong> serum alpha fetoprotein. The median survival <strong>of</strong> patients<br />

with pancreato-blastomas is 48 mo and the 5-year<br />

872 February 21, 2011|Volume 17|Issue 7|

---

survival rate after successful resection is 50% (95% CI:<br />

37%-62%) [80,105] .<br />

The majority <strong>of</strong> pancreato-blastomas have loss <strong>of</strong><br />

heterozygosity <strong>of</strong> chromosome 11p from the maternal<br />

side [106] . These molecular findings unite pancreatoblastoma<br />

with other primitive neoplasms such as hepatoblastoma<br />

and nephroblastoma [107] . Genetic alterations in the adenomatous<br />

polyposis coli (APC)/β-catenin pathway have also<br />

been detected in most pancreato-blastomas including mutations<br />

in β-catenin (CTNNB1) and APC genes [107] .<br />

Undifferentiated carcinoma<br />

Undifferentiated PC (UPC) lacks differentiation direction<br />

[91] and presents with symptoms similar to patients<br />

with DIA, but has a worse prognosis as it has a more aggressive<br />

behavior and tends to metastasize and infiltrate<br />

surrounding organs in early <strong>stage</strong>s [82] . The average time<br />

from diagnosis to death is about 5 mo and only 3% <strong>of</strong><br />

patients are alive at 5 years after undergoing surgical resection.<br />

UPCs can form large locally aggressive masses and<br />

may present with severe hemorrhage and necrosis. The<br />

majority <strong>of</strong> UPCs have KRAS2 gene mutation suggesting<br />

that they arise from pre-existing ductal adenocarcinomas<br />

that transform into poorly differentiated tumors during<br />

their progression [108] .<br />

Medullary carcinoma<br />

Medullary carcinoma (MC) is a variant <strong>of</strong> PC characterized<br />

by poor differentiation and syncytial growth that has<br />

been described and recognized only in recent years [84] . Patients<br />

with MC have a better prognosis and are more likely<br />

to have a family history <strong>of</strong> any kind <strong>of</strong> <strong>cancer</strong> [109] . MC<br />

does not differ significantly from other classes <strong>of</strong> PC in its<br />

clinical presentation, age and gender. These tumors tend<br />

to form well demarcated s<strong>of</strong>t masses and microscopically<br />

they are usually poorly differentiated with pushing rather<br />

than infiltrating features [110] . Focal necrosis and intratumoral<br />

lymphocytic infiltration can be prominent similar<br />

to MC <strong>of</strong> the colon and other tumors with microsatellite<br />

instability [89] . MCs have been shown to have loss <strong>of</strong><br />

expression <strong>of</strong> one <strong>of</strong> the DNA mismatch repair proteins<br />

(M1h1 and Msh2) and mutation in the BRAF gene, which<br />

is a downstream effector <strong>of</strong> the k-ras pathway [111] . Patients<br />

with MC and their families may benefit from genetic<br />

counseling and more frequent screening for early detection<br />

<strong>of</strong> other common <strong>cancer</strong>s. The prognosis <strong>of</strong> MC is<br />

better than adenocarcinoma, although it is not responsive<br />

to adjuvant chemotherapy based on fluorouracil (5-FU),<br />

similar to colon <strong>cancer</strong> with microsatellite instability [112] .<br />

Other rare classes <strong>of</strong> PCs<br />

Mucinous cystadenocarcinoma: Malignant cystic neoplasms<br />

are rare entities that account for only 1% <strong>of</strong> all<br />

pancreatic tumors [113] . Both serous and mucinous cystic<br />

neoplasms are tumors <strong>of</strong> the exocrine pancreas with different<br />

biological behaviors. Serous cystadenomas are considered<br />

benign tumors with almost no malignant potential<br />

<strong>of</strong>ten managed expectantly unless symptomatic. However,<br />

the preoperative differentiation between a benign serous<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

cystadenoma and malignant serous cystadenocarcinoma<br />

remains difficult [114] . Histologically, cystadenocarcinomas<br />

appear identical to serous cystadenomas and are distinguished<br />

only by the presence <strong>of</strong> lymphovascular invasion<br />

or metastases [115] . Mucinous cystadenocarcinomas resemble<br />

DIAs although some cell populations can present with<br />

undifferentiated features and other histological characteristics<br />

such as osteoclast-like giant cells, adenosquamous<br />

carcinoma, choriocarcinoma, or high-grade sarcoma [116-119] .<br />

Mucinous cystic neoplasms <strong>of</strong> the pancreas are slowly<br />

growing and only about 20% show invasive features [120,121] .<br />

The prognosis <strong>of</strong> cystadenocarcinoma is favorable<br />

compared to DIA with 5-year survival rates <strong>of</strong> 56% after<br />

radical resection [85] . There is limited evidence on the role<br />

<strong>of</strong> chemotherapy for cystadenocarcinomas <strong>of</strong> the pancreas<br />

as they appear to be unresponsive to current chemotherapy<br />

agents and radiation therapy [122,123] .<br />

Adenosquamous carcinoma: Adenosquamous carcinoma<br />

has previously been referred as adenoachantoma,<br />

mixed squamous and adenocarcinoma, and mucoepidermoid<br />

carcinoma. Histologically, they are characterized by<br />

mixed populations <strong>of</strong> adenomatous cells and cells with<br />

varying amount <strong>of</strong> keratinized squamous features. Usually<br />

this tumor affects patients in their seventh decade <strong>of</strong><br />

life, with symptoms and pancreatic distribution similar to<br />

DIAs. Although it is reported that adenosquamous carcinomas<br />

represents 4% <strong>of</strong> all PCs (range 3%-11%), the<br />

literature on the natural history and survival is limited to<br />

case series only [86] . The prognosis seems to be worse than<br />

DIAs, with a mean survival <strong>of</strong> 5-7 mo even after surgical<br />

resection [86,87] . Lymphovascular and perineural invasion appear<br />

to be common and early features <strong>of</strong> adenosquamous<br />

carcinomas and the role <strong>of</strong> adjuvant chemo and radiation<br />

therapy is still not clear [124] .<br />

Acinar cell carcinoma: Acinar cell carcinomas (ACCs)<br />

represent less than 2% <strong>of</strong> all pancreatic malignancies [87,88] .<br />

ACCs are predominantly constituted by neoplastic cells<br />

with immunohistochemical staining characteristic for exocrine<br />

enzymes such as trypsin, chymotripsin or lipase, and<br />

they present in older patients than DIAs and the prognosis<br />

is slightly better, although the literature is somewhat limited<br />

[125,126] . Symptoms at presentation are aspecific and include<br />

abdominal pain and weight loss that are similar to all<br />

other PCs [125] . Very rarely, patients with ACC can develop<br />

subcutaneous fat necrosis secondary to exceedingly high<br />

concentrations <strong>of</strong> serum lipase and contrary to DIAs, bile<br />

duct obstruction causing jaundice is not as common [125] .<br />

Median survival for ACC confined to the pancreas treated<br />

by surgical resection is 38 mo, whereas it is 14 mo for<br />

individuals with unresectable disease [88] . For the majority<br />

<strong>of</strong> patients, surgical management is not curative as distant<br />

recurrent disease is more frequent than in DIA, suggesting<br />

the presence <strong>of</strong> early micrometastases even when the<br />

tumors are in the early <strong>stage</strong>s [88] . Because ACCs are rare,<br />

there is a lack <strong>of</strong> studies on the role <strong>of</strong> chemotherapy, although<br />

radiation therapy seems to provide good responses<br />

in patients with regional unresectable disease [88] .<br />

873 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

DIAGNOSIS<br />

Clinical presentation<br />

Early symptoms <strong>of</strong> PC are notoriously difficult to measure<br />

as educational and economic factors influence their<br />

perception and reporting [127,128] . Cholestatic symptoms are<br />

more common in early PC <strong>of</strong> the head, while abdominal<br />

and back pain are more common in patients with distal<br />

PC and in patients with tumors infiltrating peripancreatic<br />

nerve tissue [129] . The appearance <strong>of</strong> these symptoms usually<br />

indicates advanced disease (Table 4) [129,130] .<br />

Early symptoms are usually vague such as anorexia,<br />

moderate weight loss, and early satiety [131] . Diabetes might<br />

be a sign <strong>of</strong> PC particularly when presenting during or beyond<br />

the sixth decade <strong>of</strong> life in the absence <strong>of</strong> risk factors<br />

and family history [20] . Diabetes is detected in 60% [132] to<br />

81% [133] <strong>of</strong> PC patients within two years <strong>of</strong> their diagnosis.<br />

Early detection is possible if symptoms raise clinicians’<br />

suspicion, as 25% <strong>of</strong> patients report upper abdominal discomfort<br />

up to 6 mo prior to their diagnosis [134,135] .<br />

In two European studies [128,130] , weight loss was present in<br />

66%-84% <strong>of</strong> patients, jaundice (bilirubin level > 3 mg/dL)<br />

in 56%-61%, recent onset <strong>of</strong> diabetes in 97% and distended<br />

palpable gall bladder in 12%-94%, energy loss in 86%,<br />

abdominal pain in 78%, back pain in 48%, nausea in 50%,<br />

clay-coloured stools in 54%, dark urine in 58%, jaundice in<br />

56% and pruritis in 32% <strong>of</strong> patients.<br />

Serum tumor markers<br />

Several serum tumor markers are associated with PC,<br />

however, to date, no single marker has been found to be<br />

optimal for screening.<br />

Carbohydrate antigen 19-9: Carbohydrate antigens have<br />

been used as markers for several <strong>cancer</strong>s [136,137] . The production<br />

<strong>of</strong> these antigens seems to be caused by the upregulation<br />

<strong>of</strong> glycosyl transferase genes [138] . Among these<br />

carbohydrate antigen epitopes, Sialyl Lewis a (sLe a ) detected<br />

by the 1116NS19-9 monoclonal antibody is commonly<br />

called carbohydrate antigen 19-9 (CA19-9) [139] . The serum<br />

levels <strong>of</strong> CA19-9 at the time <strong>of</strong> diagnosis and during follow-up<br />

<strong>of</strong> PC provide useful diagnostic and prognostic information<br />

[140,141] . Its sensitivity, specificity, positive predictive<br />

value (PPV), and negative predictive value (NPV) are<br />

70%-90%, 43%-91%, 72% and 81%, respectively [142-145] . A<br />

worse survival was observed in patients with pre-operative<br />

CA19-9 levels above 370 U/mL (median survival 4.4 mo<br />

vs 9.5 mo if CA19-9 < 370 U/mL, P value < 0.01) [146] . In<br />

another study, serum levels <strong>of</strong> CA19-9 > 200 U/mL were<br />

associated with a survival rate <strong>of</strong> 8 mo compared to 22 mo<br />

for patients with lower tumor antigen levels (P < 0.001) [147] .<br />

In a prospective study <strong>of</strong> patients undergoing curative<br />

resection for PC, post-operative CA19-9 < 37 U/mL<br />

was associated with a longer median and disease-free survival<br />

compared to the control group [148-150] . One <strong>of</strong> the<br />

limitations <strong>of</strong> CA19-9 is that high serum bilirubin can<br />

falsely increase its level and therefore the risk <strong>of</strong> false positive<br />

results in patients with jaundice. This is not observed<br />

for other markers such as carcinoembryonic antigen (CEA)<br />

and carbohydrate antigen 242 (CA 242) [141] .<br />

WJG|www.wjgnet.com<br />

Table 4 Presenting symptoms <strong>of</strong> advanced pancreatic <strong>cancer</strong><br />

Symptom Percentage<br />

Abdominal pain 78-82<br />

Anorexia 64<br />

Early satiety 62<br />

Jaundice 56-80<br />

Sleep disorders 54<br />

Weight loss 66-84<br />

Diabetes 97<br />

Back pain 48<br />

Nausea and weight loss 50-86<br />

CEA: CEA is part <strong>of</strong> a subgroup <strong>of</strong> glycoproteins functioning<br />

as intracellular adhesion molecules. CEA was first<br />

detected in pancreatic secretions, and several studies have<br />

shown high levels <strong>of</strong> CEA in the pancreatic juice <strong>of</strong> patients<br />

with PC [151-153] . A Japanese study found significantly<br />

higher CEA levels in the pancreatic juice <strong>of</strong> PC patients<br />

compared to those with benign pancreatic diseases. When<br />

the CEA cut <strong>of</strong>f level in pancreatic juice was 50 ng/mL,<br />

the PPV, NPV, and the accuracy for diagnosis <strong>of</strong> carcinoma<br />

were 77%, 95% and 85%, respectively. CEA levels in<br />

pancreatic juice were higher in smaller tumors in comparison<br />

to advanced PC due to the incomplete obstruction <strong>of</strong><br />

the pancreatic duct [154] . A recent study examining single vs<br />

combined efficacy <strong>of</strong> tumor markers showed that CEA (><br />

5 ng/mL) alone had a sensitivity <strong>of</strong> 45% and a specificity<br />

<strong>of</strong> 75% in comparison to CA19-9 which had a sensitivity<br />

<strong>of</strong> 80% but lower specificity (43%) (P = 0.005) [141,155] .<br />

The combination <strong>of</strong> CEA (> 5 ng/mL) and CA 19-9 (><br />

37 U/mL) decreased the sensitivity to 37%, but increased<br />

the specificity to 84%. Similarly, the combination <strong>of</strong> CEA<br />

(> 5 ng/mL) and CA242 (> 20 U/mL) decreased the<br />

sensitivity to 34% and increased the specificity to 92%.<br />

Yet, CEA and CA242 are currently not used as single tumor<br />

markers for PC, and the simultaneous use <strong>of</strong> CEA<br />

and CA19-9 provides the same information as CA19-9<br />

alone [156-158] .<br />

CA 242: CA 242, a sialylated carbohydrate was first defined<br />

by Lindholm et al in 1985 and has been used for<br />

diagnostic and prognostic purposes [159,160] . For PC, its diagnostic<br />

sensitivity and specificity are 60% (P = 0.073) and<br />

76% (P = 0.197), respectively, comparable to CEA. It also<br />

seems to be valuable in differentiating PC from benign<br />

pancreatic tumors as well as other hepatobiliary <strong>cancer</strong>s<br />

and to predict outcomes as survival rates in CA 242 positive<br />

patients are lower than those with negative serum<br />

levels (P = 0.002) [141] .<br />

In a study comparing CA 242 and CA19-9 [161] , CA<br />

242 appeared to be an independent prognostic factor for<br />

patients with resectable disease as serum levels <strong>of</strong> CA 242<br />

< 25 U/mL were associated with a significantly better<br />

survival (P < 0.05). For patients with unresectable disease,<br />

poorer outcomes were observed when CA 242 levels were<br />

> 100 U/mL.<br />

Similar results have been confirmed by Ni et al, who<br />

found that CA 242 is an independent prognostic factor<br />

874 February 21, 2011|Volume 17|Issue 7|

---

Table 5 Summary <strong>of</strong> the performance characteristics <strong>of</strong> serum tumor markers for the diagnosis <strong>of</strong> pancreatic <strong>cancer</strong><br />

Serum tumor marker Author Yr Sensitivity (%) Specificity (%) PPV (%) NPV (%) Accuracy (%)<br />

CA19-9 Boeck et al [141]<br />

Ni et al [142]<br />

Steinberg et al [143]<br />

Safi et al [144]<br />

Mu et al [162]<br />

CEA in pancreatic juice Ozkan et al [155]<br />

Futakawa et al [154]<br />

Ni et al [142]<br />

CEA in serum Boeck et al [141]<br />

CA19-9 + CEA Ni et al [142]<br />

Ozkan et al [155]<br />

Ma et al [163]<br />

CA 242 Nilsson et al [160]<br />

Röthlin et al [164]<br />

Carpelan-Holmström et al [165]<br />

Pålsson et al [166]<br />

CEA + CA 242 Ni et al [142]<br />

Ozkan et al [155]<br />

Hall et al [167]<br />

CA19-9 + CA 242 Ni et al [142]<br />

Röthlin et al [164]<br />

Jiang et al [158]<br />

CA19-9 + CA 242 + CEA Ni et al [142]<br />

in PC yielding more information than CA 19-9 [142,161] . In<br />

this study the use <strong>of</strong> combined tumor markers resulted in<br />

lower sensitivity, but higher specificity (Table 5). Despite<br />

these findings, CA 242 is not used in clinical practice as<br />

commonly as Ca 19-9 due to the limited number <strong>of</strong> laboratories<br />

equipped to run this test.<br />

Other tumor markers<br />

Recent studies have identified other serum molecules such<br />

as CA494 [168] , CEACAM1 [169] , PTHrP [170] , TuM2-PK [171] ,<br />

CAM 17.1 [172] and serum beta HCG [173] as potential markers<br />

for PC. Although preliminary results appear promising<br />

with sensitivity and specificity comparable and sometimes<br />

superior to CA19-9 and CEA, their clinical use has to<br />

be confirmed in larger studies and their role is currently<br />

confined to a limited number <strong>of</strong> medical centers and for<br />

research purposes.<br />

Imaging modalities<br />

Although PC may be detected with one particular diagnostic<br />

test, proper staging <strong>of</strong>ten requires the use <strong>of</strong> several<br />

imaging modalities [174] .<br />

Abdominal ultrasound: Trans-abdominal ultrasound<br />

(US) is currently used as a screening test for patients with<br />

suspected PC [175] . Its sensitivity ranges between 48% [176]<br />

and 89% [177] , specificity between 40% [178] and 91% [179] and<br />

accuracy between 46% [176] and 64% [180] . PCs measuring less<br />

than 1 cm are detected by US in only 50% <strong>of</strong> cases, while<br />

the sensitivity increases to 95.8% for tumors larger than<br />

3 cm [177] . Other factors affecting the sensitivity <strong>of</strong> US are<br />

the operator’s experience [181] and the technical character-<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

2006<br />

2005<br />

1990<br />

1997<br />

2003<br />

70-90 43-91 72 81 67<br />

2003<br />

2000<br />

2005<br />

NA NA 77 95 85<br />

2006 45 75 NA NA NA<br />

2005<br />

2003<br />

2009<br />

37 84 91 90 89<br />

1992<br />

1993<br />

2002<br />

1993<br />

60 76 63 61 71<br />

2005<br />

2003<br />

1994<br />

34 92 67 90 87<br />

2005<br />

1993<br />

2004<br />

59 77 65.3 87.8 65.1<br />

2005 29 96 NA NA NA<br />

PPV: Positive predictive value; NPV: Negative predictive value; CA19-9: Carbohydrate antigen 19-9; CEA: Carcinoembryonic antigen; CA 242: Carbohydrate<br />

antigen 242; NA: Not applicable.<br />

istics <strong>of</strong> the machine. Newer US machines such as tissue<br />

harmonic imaging decrease artefacts and improve tissue<br />

contrast and therefore diagnostic accuracy [182] . US has a<br />

relatively low performance pr<strong>of</strong>ile for the staging <strong>of</strong> PC<br />

as its sensitivity for lymph node involvement only ranges<br />

between 8% [159] and 57% [177] .<br />

Color Doppler US has been used to assess the possible<br />

involvement <strong>of</strong> the portal vein and superior mesenteric<br />

vessels with a sensitivity ranging between 50% [183]<br />

and 94% [184] , specificity between 80% and 100% [183] and<br />

accuracy between 81% and 95% [175] .<br />

The recent introduction <strong>of</strong> intravenous contrast has<br />

been shown to improve evaluation <strong>of</strong> the vascularity <strong>of</strong><br />

pancreatic lesions allowing differentiation between PC and<br />

other conditions with 90% sensitivity, 100% specificity<br />

and 93% accuracy [185] . Currently, US is considered a useful<br />

imaging modality for the initial screening <strong>of</strong> PC based on<br />

its ability to document unresectability (PPV = 94%) [176] .<br />

However, the PPV for resectabiltiy is only 55% [186] , therefore,<br />

other imaging techniques are usually employed for<br />

better staging.<br />

EUS: EUS provides high resolution images <strong>of</strong> the pancreas<br />

without interference by bowel gas [187] . Despite the<br />

advancement <strong>of</strong> CT scans, EUS appears to have a higher<br />

sensitivity in detecting small PCs (98%) in comparison to<br />

CT (86%) [188] . EUS has higher sensitivity compared to CT<br />

for local tumor staging (67% vs 41%), similar sensitivity<br />

for lymph node involvement (44% vs 47%) and potential<br />

tumor resectability (68% vs 64%) [185] . EUS has a NPV<br />

<strong>of</strong> 100% for PC <strong>of</strong> the head [186,189] and an accuracy <strong>of</strong><br />

90% for the assessment <strong>of</strong> portal and splenic vein inva-<br />

875 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

sion [178,190] . On the other hand, EUS does not appear to<br />

be accurate enough in assessing the invasion <strong>of</strong> SMA and<br />

superior mesenteric vein (SMV) with a NPV <strong>of</strong> 82% and<br />

sensitivity <strong>of</strong> only 50% [191,192] .<br />

In order to improve EUS performance in PC staging,<br />

recent studies have assessed the benefits <strong>of</strong> using parenteral<br />

contrast agents. This technique has shown 92% sensitivity,<br />

100% specificity, 100% PPV, 86% NPV and 95%<br />

accuracy [193] . Although EUS is becoming a leading modality<br />

for staging and diagnosis <strong>of</strong> PC, drawbacks <strong>of</strong> this<br />

technique are the fact that it is invasive, highly operator<br />

dependent, costly and associated with a small risk <strong>of</strong> pancreatitis<br />

(0.85%) [194] , bleeding and duodenal perforation.<br />

CT: On contrast CT, PC appears as an ill-defined, hypoattenuating<br />

focal mass with dilatation <strong>of</strong> the upstream<br />

pancreatic and or biliary duct [174] . Optimum visualization<br />

<strong>of</strong> the pancreas requires imaging acquisition obtained<br />

during both arterial and portal phases [195] . Sensitivity and<br />

specificity <strong>of</strong> thin section triple phase helical CT is 77%<br />

and 100%, respectively, for lesions less than 2 cm [196] . In<br />

a multicentric trial, the diagnostic accuracy <strong>of</strong> CT for resectability<br />

was 73% with a PPV for non resectability <strong>of</strong><br />

90% [197] .<br />

With the advent <strong>of</strong> multi detector CT scanners (MDCT),<br />

the pancreas can be imaged at a very high spatial and temporal<br />

resolution [198,199] . The dual phase pancreatic protocol<br />

MDCT using 1 to 3 mm slice collimation is one <strong>of</strong> the<br />

most sensitive techniques for metastatic disease to the liver<br />

and peritoneum [186,200,201] . Recent studies have shown that<br />

MDCT has a NPV <strong>of</strong> 87% for tumor resectability compared<br />

to a NPV <strong>of</strong> 79% for conventional helical CT [202] and<br />

with an accuracy between 85% and 95% [203,204] .<br />

Images from MDCT can be used to visualize the biliary<br />

tree and normal vascular variants such as replaced hepatic<br />

arteries before surgical planning. Gangi et al [198] reported<br />

that pancreatic ductal dilatation in asymptomatic patients<br />

could be identified between 0 to 50 mo before PC diagnosis<br />

was confirmed. The sensitivity, specificity and accuracy <strong>of</strong><br />

CT in the presence <strong>of</strong> hypo-attenuated pancreatic lesions,<br />

pancreatic ductal dilatation with cut-<strong>of</strong>f, distal pancreatic<br />

atrophy, pancreatic contour abnormalities and common bile<br />

duct dilatation are reported in Table 6 [205] .<br />

Despite these improvements, interpretation <strong>of</strong> the CT<br />

scan is quite challenging in the setting <strong>of</strong> pancreatitis forming<br />

mass effects [206] and in the presence <strong>of</strong> loco-regional<br />

lymph node involvement and small hepatic metastasis [207] .<br />

Magnetic resonance imaging-magnetic resonance<br />

cholangiopancreatography: In most institutions, MRI<br />

is performed when other imaging modalities provide<br />

insufficient data for the clinical staging <strong>of</strong> the tumor, or<br />

when treatment planning can not be based on the images<br />

obtained by other techniques. Several studies have<br />

shown that MRI is superior to CT for the detection and<br />

staging <strong>of</strong> PC (100% vs 94%, respectively) [208-211] . However,<br />

recent evidence has challenged this belief. The use<br />

<strong>of</strong> MRI-magnetic resonance cholangiopancreatography<br />

(MRCP) to better characterize PC is supported by a pro-<br />

WJG|www.wjgnet.com<br />

Table 6 Sensitivity, specificity and accuracy <strong>of</strong> computed tomography<br />

findings in pancreatic <strong>cancer</strong> patients<br />

CT finding Sensitivity<br />

(%)<br />

Specificity<br />

(%)<br />

Accuracy<br />

(%)<br />

Hypoattenuation 75 84 81<br />

Ductal dilatation 50 78 70<br />

Ductal interruption 45 82 70<br />

Distal pancreatic atrophy 45 96 81<br />

Pancreatic contour anomalies 15 92 70<br />

CBD dilatation 5 92 67<br />

CT: Computed tomography; CBD: Common bile duct.<br />

spective analysis that compared these two modalities in<br />

patients with periampullary <strong>cancer</strong>s [212] . MRI-MRCP was<br />

superior to CT in differentiating malignant from benign<br />

lesions (ROC = 0.96 vs 0.81, P < 0.05) and MRI-MRCP<br />

had better sensitivity (92% vs 76%), specificity (85% vs<br />

69%), accuracy (90% vs 75%), PPV (95% vs 88%) and<br />

NPV (79% vs 50%) compared to CT. Another study<br />

confirmed the previous results with MRI-MRCP showing<br />

97% sensitivity, 81% specificity and 89% accuracy [213] .<br />

On the other hand, other studies comparing gadolinium-enhanced<br />

MRI with MDCT have shown that MRI<br />

and CT had equivalent sensitivity and specificity (83%-85%<br />

vs 83% and 63% vs 63%-75%, respectively). Both techniques<br />

had good to excellent agreement between radiologists,<br />

although MRI had a superior agreement for the<br />

evaluation <strong>of</strong> distant metastases (inter-observer agreement<br />

between MRI and CT scan; 0.78 vs 0.59 P = 0.1) [214] . On<br />

the other hand, with the improvement in CT scan technology,<br />

recent studies have shown that MRI might have<br />

lower sensitivity in comparison to MDCT (82%-94% vs<br />

100%) [215] . This was confirmed by a recent meta-analysis<br />

comparing the accuracy <strong>of</strong> several imaging modalities<br />

which showed that helical CT had superior sensitivity<br />

compared to MRI (91% vs 84%) and transabdominal US<br />

(91% vs 76%) [216] . Sensitivity for resectability <strong>of</strong> the tumor<br />

was equal for both MRI and helical CT (82% vs 81%, respectively)<br />

[216] .<br />

Positron emission tomography: 18 F-2fluoro-2-deoxy-<br />

D-glucose (FDG) accumulated by tumor cells provides<br />

positron emission tomography (PET) with the advantage<br />

<strong>of</strong> combining metabolic activity and imaging characteristics.<br />

Newly developed PET scanners can detect small<br />

PCs up to 7 mm in diameter and diagnose metastatic<br />

disease in about 40% <strong>of</strong> cases [217,218] . A Japanese study<br />

found that the overall sensitivity <strong>of</strong> PET-CT was superior<br />

to contrast CT (92% vs 88%) and that PET was better<br />

at detecting bone metastases (100% vs 12%). However,<br />

CT scanning was superior for the evaluation <strong>of</strong> vascular<br />

invasion (100% vs 22%), involvement <strong>of</strong> para aortic regional<br />

lymph nodes (78% vs 57%), identification <strong>of</strong> peritoneal<br />

dissemination (57% vs 42%) and hepatic metastases<br />

(73% vs 52%) [219] . Another Japanese study confirmed<br />

that PET had a sensitivity <strong>of</strong> 87%, a specificity <strong>of</strong> 67%<br />

and accuracy <strong>of</strong> 85%, and that tumors with metastatic<br />

876 February 21, 2011|Volume 17|Issue 7|

---

Table 7 Summary <strong>of</strong> the performance characteristics <strong>of</strong> imaging tests for the diagnosis <strong>of</strong> pancreatic <strong>cancer</strong><br />

Diagnostic modality Author Yr Sensitivity (%) Specificity (%) PPV (%) NPV (%) Accuracy (%)<br />

US Giovannini et al [176]<br />

Böttger et al [177]<br />

Rösch et al [178]<br />

Niederau et al [179]<br />

Palazzo et al [180]<br />

Tanaka et al [231]<br />

Doppler US Candiani et al [232]<br />

Casadei et al [184]<br />

Calculli et al [233]<br />

EUS Akahoshi et al [234]<br />

Legmann et al [235]<br />

Contrast enhanced US Dietrich et al [185]<br />

CT Bronstein et al [196]<br />

Megibow et al [197]<br />

MDCT Park et al [214]<br />

Vargas et al [202]<br />

Diehl et al [203]<br />

Schima et al [208]<br />

MRI-MRCP Andersson et al [212]<br />

PET Maemura et al [217]<br />

Delbeke et al [221]<br />

disease had significantly higher standardized uptake<br />

values [SUV = tissue concentration (millicuries/g)/injection<br />

dose (millicuries)/body weight (g)] than those without<br />

metastases [220] . PET had superior sensitivity (100%<br />

vs 65%), specificity (77% vs 61%), NPV (100% vs 31%),<br />

PPV (94% vs 87%) and accuracy (95% vs 65%) in an<br />

American study comparing PET-CT with a SUV cut <strong>of</strong>f<br />

<strong>of</strong> 2.0 vs contrast CT [221] . A recent study enrolling 59 PC<br />

patients showed similar results, with 91% PPV and 64%<br />

NPV for PET-CT. One <strong>of</strong> the most interesting results<br />

was that the clinical management <strong>of</strong> patients undergoing<br />

PET was changed in 16% <strong>of</strong> cases deemed resectable<br />

after routine staging (P = 0.031) preventing unnecessary<br />

surgery because <strong>of</strong> distant metastases [222] .<br />

Diffuse uptake <strong>of</strong> FDG is frequent in pancreatitis in<br />

comparison to PC (53% vs 3%, P < 0.001), and therefore<br />

PET is extremely useful in distinguishing these two conditions<br />

in controversial cases [218,223] . Animal studies have<br />

shown that 11 C-acetate-PET appears to be superior to<br />

FDG PET for the detection <strong>of</strong> early PC and might be<br />

useful in differentiating inflammatory processes from malignancies<br />

as 11 C-acetate-PET is less affected by the presence<br />

<strong>of</strong> inflammation in human tissues [224] .<br />

Another very important characteristic <strong>of</strong> PET-CT is<br />

its ability to provide useful information on tumor viability,<br />

and this technique also allows monitoring <strong>of</strong> tumor response<br />

to treatment [217] and the metabolic features <strong>of</strong> PET<br />

help predict the prognosis as a SUV less than 3 appears to<br />

be a positive predictive factor [222,225-229] .<br />

Similar results were found by Zimny et al [230] who<br />

showed that better survival trends were noted in patients<br />

with PC and a SUV less than 6.0 in comparison to those<br />

with a higher SUV. Sensitivity and specificity <strong>of</strong> imaging<br />

modalities are summarized in Table 7.<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

1994<br />

1998<br />

1991<br />

1992<br />

1993<br />

1996<br />

1998<br />

48-95 40-91 92 100 46-64<br />

1998<br />

2002<br />

50-94 80-100 79 88 81-95<br />

1998<br />

1998<br />

98 97 94 100 90<br />

2008 90 100 100 86 93<br />

2004<br />

1995<br />

2009<br />

77 100 NA NA 73<br />

2004<br />

1998<br />

2002<br />

83-91 63-75 80 87 85-95<br />

2005 83-92 63-85 95 79 89<br />

2006<br />

1999<br />

87-100 67-77 94 100 85-95<br />

PPV: Positive predictive value; NPV: Negative predictive value; US: Ultrasound; EUS: Endoscopic ultrasound; CT: Computed tomography; MDCT: Multi<br />

detector computed tomography; PET: Positron emission tomography; NA: Not applicable; MRI: Magnetic resonance imaging.<br />

STAGING<br />

Pathological staging<br />

In the 7th edition <strong>of</strong> the American Joint Committee on<br />

Cancer the different categories <strong>of</strong> PC are classified according<br />

to only one TNM staging system, even if neuroendocrine<br />

tumors have a different biology and a better<br />

prognosis than ductal carcinomas. Yet, the TNM system<br />

provides a reasonable discrimination and prognostic validity<br />

for these patients [236] .<br />

The TNM system classifies PC into 3 clinically important<br />

categories: (1) patients with Tis-T2 PC have<br />

localized <strong>cancer</strong> within the pancreas; (2) patients with T3<br />

<strong>cancer</strong> have locally invasive disease; and (3) patients with<br />

T4 tumors have unresectable PC [237] (Table 8).<br />

Prognostic features <strong>of</strong> PC include perineural and lymphovascular<br />

invasion, elevated serum CA19-9 levels and<br />

incomplete tumor resection. Therefore, gross and microscopic<br />

assessment <strong>of</strong> the resection margins is <strong>of</strong> major<br />

importance even if it is not included in the TNM staging<br />

system. Patients undergoing resections with grossly or<br />

microscopically positive margins have no survival benefits<br />

compared to individuals undergoing palliative chemo- radiation<br />

therapy alone.<br />

Clinical staging<br />

Surgery is the only chance <strong>of</strong> cure and the presence <strong>of</strong><br />

negative resection margins <strong>of</strong> the primary tumor represent<br />

the strongest prognostic factor. Preoperative staging<br />

modalities include the combination <strong>of</strong> several imaging<br />

techniques such as CT scan, MRI, EUS, staging laparoscopy<br />

and laparoscopic ultrasound which aim to identify<br />

patients with resectable disease. There is consensus that<br />

patients with distant metastases (liver, lungs, peritoneum)<br />

877 February 21, 2011|Volume 17|Issue 7|

---

Table 10 Published results on laparoscopic pancreaticoduodenectomies<br />

Author Yr Patient No. Morbidity (%) Pancreatic fistula (%) Mean hospital stay Mortality (%)<br />

Kendrick et al [323]<br />

Palanivelu et al [324]<br />

Dulucq et al [325]<br />

Pugliese et al [326]<br />

that the number <strong>of</strong> lymph nodes removed during the minimally<br />

invasive procedure was significantly inferior (mean<br />

number: 5.2) in comparison to the open approach (mean<br />

number: 9.4) [333] . These findings suggest that at this time<br />

there is a lack <strong>of</strong> evidence to support oncological equipoise<br />

between laparoscopic and open resections for PC.<br />

Total pancreatectomy: Total pancreatectomy has been<br />

employed in selected patients with chronic pancreatitis [334] ,<br />

multifocal islet cell tumors or diffuse IPMN [335] . Total<br />

pancreatectomy for PC was initially proposed to avoid the<br />

risk <strong>of</strong> pancreatico-enteric leaks and to remove potential<br />

undetectable synchronous disease in other parts <strong>of</strong> the<br />

gland [336] . However, the indication <strong>of</strong> total pancreatectomy<br />

to avoid the risks <strong>of</strong> pancreatic fistulae is still controversial<br />

[337] . Improvement in operative techniques, advances<br />

in nutritional support, critical care and interventional<br />

radiology have significantly decreased the incidence <strong>of</strong><br />

life-threatening sequels <strong>of</strong> pancreaticoenteric leaks [338] .<br />

In addition, the permanent endocrine insufficiency associated<br />

with total pancreatectomy impacts enormously<br />

on the quality <strong>of</strong> life and long-term outcome <strong>of</strong> these<br />

patients [339] . Some studies have demonstrated a significant<br />

increased risk <strong>of</strong> perioperative morbidity and mortality associated<br />

with total pancreatectomy compared with PD [318] .<br />

A recent study by Reddy et al [335] showed that long-term<br />

survival rates were equivalent after total pancreatectomy<br />

and PD (19.9% vs 18.5%), supporting the fact that there is<br />

no oncological benefit <strong>of</strong> total pancreatectomy vs a more<br />

limited resection in PC. Currently, total pancreatectomy<br />

should be performed in patients with PC if it is the only<br />

oncologically sound treatment option [335] .<br />

Vascular resections and extended lymphadenectomy:<br />

With the advancement in operative techniques and perioperative<br />

management <strong>of</strong> patients with PC, more radical<br />

surgical procedures with vascular resection and extended<br />

lymphadenectomy have been proposed for selected<br />

cases [340] . The results <strong>of</strong> extended vascular and lymphatic<br />

resections remain controversial.<br />

The principal use <strong>of</strong> venous resection and reconstruction<br />

is to allow complete tumor clearance when precluded<br />

by tumor involvement <strong>of</strong> the superior mesenteric or<br />

portal vein, and when the surgeon expects to achieve a<br />

negative resection margin [341] . Post-operative morbidity<br />

and mortality rates following portal or superior mesenteric<br />

vein resections seem to be similar to those <strong>of</strong> patients<br />

with standard PD (42%-48.4% vs 47.1%, 3.2%-5.9% vs<br />

2.5%, respectively) [342,343] . Another study showed that patients<br />

undergoing pancreatic resection with venous recon-<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

2010 62 42 18 7 1.6<br />

2007 42 28.6 7.1 10.2 2.4<br />

2006 25 31.8 4.5 16.2 0<br />

2008 19 31.6 15.8 18 0<br />

struction (VR) had a median survival <strong>of</strong> 22 mo compared<br />

to 20 mo for those who had classic PD (P = 0.25) [344] . In<br />

another study, a slight survival benefit was noted in patients<br />

who did not require VR (33.5%) compared to those<br />

with VR (20%, P = 0.18), although this did not reach statistical<br />

significance [345] .<br />

Pancreatectomies with major arterial resections (common<br />

hepatic artery/celiac axis and superior mesenteric<br />

artery) have been reported in recent years with acceptable<br />

outcomes. Nevertheless, arterial reconstruction during<br />

pancreatectomies remains a challenging procedure with<br />

increased risk <strong>of</strong> complications compared to classic PD<br />

and PD with VR. In addition, most PCs with arterial invasion<br />

are for the majority, advanced tumors with distant<br />

lymph node involvement and metastases, and therefore<br />

indicated only in a very select group <strong>of</strong> patients [346] . Recent<br />

data on pancreatectomies requiring arterial resections at<br />

high volume tertiary centers have shown operative mortality<br />

rates <strong>of</strong> 4.3% [346] , peri-operative mortality rates (60 d)<br />

<strong>of</strong> 17% [347] , morbidity rates <strong>of</strong> 48% [348] and 3-year survival<br />

rates <strong>of</strong> 17%-23.1%, which are much higher than for classic<br />

PD [346,347] .<br />

It has been noted that lymph node involvement outside<br />

the standard PD specimens occurs in more than 30%<br />

<strong>of</strong> cases [349] . This has led to the evaluation <strong>of</strong> the need for<br />

a more extended lymph node dissection (ELND) in the<br />

surgical management <strong>of</strong> PC. To date, the definitions <strong>of</strong> a<br />

standard lymphadenectomy as well as ELND are still not<br />

very clear [341] . A number <strong>of</strong> Japanese studies have shown<br />

an increased survival rate in patients who have undergone<br />

ELND compared to conventional PD [350-352] . However,<br />

these studies were not randomized and their data were not<br />

validated by other centers [353] .<br />

The first RCT comparing standard PD and ELND<br />

was reported by Pedrazzoli et al [354] in 1998. In this study,<br />

standard lymph node dissection was defined as the removal<br />

<strong>of</strong> lymph nodes from the anterior and posterior pancreatoduodenal<br />

region, pyloric region, biliary duct, superior<br />

and inferior pancreatic head and body. In addition to the<br />

above, ELND included removal <strong>of</strong> lymph nodes from<br />

the hepatic hilum and along the aorta from the diaphragmatic<br />

hiatus to the inferior mesenteric artery and laterally<br />

to both renal hila, with circumferential clearance <strong>of</strong> the<br />

origin <strong>of</strong> the celiac trunk and SMA. This study showed no<br />

difference in morbidity, mortality or 4-year survival rates<br />

between the two groups.<br />

Recently, a meta-analysis on standard PD and PD +<br />

ELND for PC patients showed comparable morbidity and<br />

mortality rates with a trend towards higher rates <strong>of</strong> delayed<br />

gastric emptying in the ELND group. The weighted<br />

881 February 21, 2011|Volume 17|Issue 7|

---

controls (P = 0.099). The two- and five-year overall survival<br />

rates were 37% and 20% for the experimental arm<br />

and 23% and 10% for the control arm (P = NS) [379] .<br />

The European Study Group for PC 1 trial (ESPAC-1)<br />

compared four groups <strong>of</strong> patients who underwent pancreatic<br />

resection; (1) surgery alone; (2) 5-FU and Leucovorin<br />

adjuvant chemotherapy; (3) combination <strong>of</strong> adjuvant<br />

radiation therapy and 5-FU chemotherapy; and (4) adjuvant<br />

chemoradiation followed by chemotherapy [380] . In this<br />

study, the five-year survival rate for patients who received<br />

adjuvant chemotherapy was 21% compared to 8% for<br />

patients who did not (P = 0.009). Patients who underwent<br />

chemoradiation therapy had an inferior five-year survival<br />

rate (10% vs 20%) in comparison to patients who did not<br />

receive radiation (P = 0.05).<br />

In 2006, the Radiation Therapy Oncology Group trial<br />

compared patients receiving adjuvant chemoradiation (5040<br />

cGy in combination with continuous 5-FU) followed by<br />

5-FU vs similar chemoradiation therapy followed by Gemcitabine.<br />

For patients affected by PC <strong>of</strong> the head, the arm<br />

treated with Gemcitabine had a superior median (18.8 mo<br />

vs 16.7 mo) and overall survival at 3 years [31% vs 21% (P<br />

= 0.047)], but with a higher incidence <strong>of</strong> toxicity (80% vs<br />

60%) [381] .<br />

In 2007, a RCT conducted in Germany and Austria<br />

(CONKO-1 [Charite Onkologie Clinical Studies in GI Cancer<br />

001]) compared patients undergoing R0 or R1 pancreatic<br />

resection alone vs resection followed by Gemcitabine-based<br />

chemotherapy. The median disease-free survival for patients<br />

treated with Gemcitabine was 13.9 mo vs 6.9 mo in the<br />

observation arm (P < 0.001), although there was no difference<br />

in the overall survival between the two groups (22 mo<br />

vs 20 mo) [382] . From the results <strong>of</strong> these studies, adjuvant<br />

chemotherapy has become the standard <strong>of</strong> care for patients<br />

who can tolerate the treatment after surgical resection.<br />

NEOADJUVANT THERAPY<br />

Neoadjuvant therapy is defined as the preoperative intervention<br />

aiming to convert unresectable PCs to resectable<br />

tumors or to increase the probability <strong>of</strong> complete microscopic<br />

tumor resection [383] . One <strong>of</strong> the limitations <strong>of</strong> the<br />

role <strong>of</strong> neoadjuvant therapy for PC is the fact that there<br />

is no standardized definition for tumor resectability and<br />

there is no data from randomized phase three trials on<br />

the benefit <strong>of</strong> neoadjuvant therapy. In addition, data from<br />

prospective and retrospective studies have several biases<br />

due to heterogeneity <strong>of</strong> inclusion and exclusion criteria,<br />

preoperative quality <strong>of</strong> imaging tests, and surgical pathology<br />

reports on lymph node involvement and resection<br />

margin status.<br />

A recent systematic review [383] evaluating retrospective<br />

and prospective studies on neoadjuvant chemo and radiation<br />

therapy from 1966 to 2009 included a total <strong>of</strong> 111<br />

studies and 4,394 patients. The results <strong>of</strong> this meta-analysis<br />

showed that the majority <strong>of</strong> patients were treated with<br />

Gemcitabine, 5-FU or oral analogue Mitomycin-c, and<br />

Platinum compounds. Patients undergoing neoadjuvant<br />

treatment received radiotherapy in the range <strong>of</strong> 24-63 Gy.<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

The analysis showed that neoadjuvant treatment in patients<br />

with unresectable tumor was able to convert 33.2%<br />

<strong>of</strong> patients to resectable candidates, providing a median<br />

survival <strong>of</strong> 20.5 mo which was equivalent to patients undergoing<br />

resection followed by adjuvant therapy who had<br />

median survival <strong>of</strong> 20.1 to 23.6 mo. On the other hand,<br />

neoadjuvant therapy for patients with resectable <strong>cancer</strong><br />

did not seem to improve overall outcome.<br />

RADIATION THERAPY<br />

Persistent loco-regional disease after pancreatic surgery<br />

is a major determinant <strong>of</strong> recurrence [384] . Although there<br />

is supportive evidence for the use <strong>of</strong> adjuvant chemotherapy<br />

[380,385] , the role <strong>of</strong> adjuvant radiation remains<br />

unresolved. Generally it is believed that external-beam<br />

radiotherapy (EBRT) alone is a suboptimal treatment for<br />

locally advanced PC as most patients will die <strong>of</strong> systemic<br />

disease [386] .<br />

In the Mayo clinic clinical trial and the GITSG trial,<br />

patients who were randomized to receive EBRT only had<br />

a median survival <strong>of</strong> 5.3-6.3 mo which was inferior to<br />

EBRT plus 5-FU [387,388] .<br />

Among 210 patients who underwent surgical resection<br />

for PC [PD (73%), total and/or distal pancreatectomy<br />

(25%), Appleby procedure (2%)] followed by intraoperative<br />

electron beam radiotherapy (IOERT), some patients<br />

received a single fraction <strong>of</strong> IOERT alone (25 Gy), whereas<br />

others (30%) received additional EBRT and 54% received<br />

various forms <strong>of</strong> adjuvant chemotherapy. The study<br />

demonstrated excellent local control with the addition <strong>of</strong><br />

IOERT (75%). Despite the benefit in local control, the<br />

overall median survival was similar to other studies with<br />

adjuvant chemotherapy or chemoradiation (19 mo) [389] . A<br />

combined study <strong>of</strong> extended resection and intraoperative<br />

radiation therapy (IORT) concluded that IORT contributed<br />

to local control; however, it provided no overall survival<br />

benefits (14.6% 5-year survival) [390] .<br />

In the United States, chemoradiation with concurrent<br />

5-FU followed by Gemcitabine continues to represent the<br />

standard for adjuvant therapy <strong>of</strong> tumor <strong>of</strong> the pancreatic<br />

head. A direct comparison <strong>of</strong> chemo-radiation therapy<br />

and chemotherapy alone seems to be difficult to achieve<br />

and additive chemotherapy before or after chemo-radiation-therapy<br />

will have to be tested in randomized studies<br />

in order to determine the optimal sequencing [391] .<br />

PALLIATIVE MEASURES<br />

Palliative treatment <strong>of</strong> patients with PC plays a very important<br />

role as 80% to 90% <strong>of</strong> newly diagnosed tumors<br />

are not resectable due to local invasion or presence <strong>of</strong><br />

distal metastatic disease [392] . Median survival for patients<br />

with unresectable PC located in the head and body <strong>of</strong> the<br />

gland is approximately 7 mo, while for PC located in the<br />

tail median survival is significantly less [3 mo (P = 0.0002)],<br />

as they are usually diagnosed in more advanced <strong>stage</strong>s [393] .<br />

For these patients, relief <strong>of</strong> symptoms secondary to gastric<br />

outlet obstruction, jaundice and pain are essential to<br />

883 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

improve their quality <strong>of</strong> life and overall survival. In the<br />

past, surgical palliation was more common as the diagnosis<br />

<strong>of</strong> unresectable disease was frequently done in the<br />

operating room and patients underwent one or more <strong>of</strong><br />

the following procedures: gastric bypass, hepatico-enteric<br />

decompression and celiac plexus neurolysis for pain relief<br />

during the same surgery. With the improvement in<br />

diagnostic imaging tests, the role <strong>of</strong> surgical staging has<br />

decreased as the vast majority <strong>of</strong> patients can be currently<br />

classified as suffering from unresectable disease by noninvasive<br />

modalities such as CT and MRI or by endoscopic<br />

US. Nevertheless, there are still controversies on the best<br />

palliative strategies for these patients as there is a lack <strong>of</strong><br />

randomized controlled trials and abundant contrasting<br />

data from observational studies.<br />

Gastro-duodenal decompression<br />

There is still some controversy on the use <strong>of</strong> routine<br />

gastro-intestinal bypass for PC diagnosed as unresectable<br />

at the time <strong>of</strong> exploratory laparoscopy or laparotomy.<br />

In a large observational study <strong>of</strong> 155 patients with<br />

unresectable PC <strong>stage</strong>d by extended laparoscopy at the<br />

Memorial Sloan Kettering Cancer Center, only 4% <strong>of</strong><br />

patients required surgical intervention for gastric outlet<br />

obstruction before their death: 2 patients required open<br />

gastro-jejunal anastomosis alone and 1 patient underwent<br />

a combined gastro and hepatico-jejunostomy a few days<br />

after laparoscopy [393] . In addition, 1 patient required a<br />

percutaneous endoscopic gastrostomy for palliation <strong>of</strong><br />

gastric outlet obstruction a few weeks before demise. The<br />

authors concluded that the routine use <strong>of</strong> gastric bypass<br />

in patients with unresectable PC is not indicated. On the<br />

other hand, several other retrospective studies [394,395] have<br />

suggested that up to 25% <strong>of</strong> patients with unresectable<br />

PC would develop gastric outlet obstruction requiring surgical<br />

intervention.<br />

A recent prospective randomized trial compared 44<br />

patients who were found unresectable at the time <strong>of</strong> surgery<br />

and who underwent a retrocolic gastro-jejunostomy<br />

to 43 patients who did not [396] . The two groups had similar<br />

morbidity (32% vs 33%), mortality (0%) and hospital stay.<br />

On the other hand, patients who had gastric bypass did<br />

not develop any gastric outlet obstruction, while 19% <strong>of</strong><br />

patients in the control group did (P < 0.01). Although this<br />

study would suggest that gastric bypass should be performed<br />

in all patients found unresectable at the time <strong>of</strong><br />

surgery, the introduction <strong>of</strong> metallic self-expanding intestinal<br />

stents has changed the options for palliation.<br />

A prospective multicenter cohort study <strong>of</strong> 51 patients<br />

with malignant gastric outlet obstruction treated with selfexpandable<br />

metallic stents showed that in 98% <strong>of</strong> cases<br />

the stent was successfully deployed and that the median<br />

duration <strong>of</strong> patency was 10 mo. Only 14% <strong>of</strong> patients had<br />

stent dysfunction, and migration was observed in only 2%<br />

<strong>of</strong> cases [397] . Similar results were reported by another study<br />

from South Korea which showed a median stent patency<br />

<strong>of</strong> 385 d, and only 1% serious complications (gastrointestinal<br />

bleeding or perforation) [398] . Other observational<br />

studies have shown that compared with palliative surgery,<br />

WJG|www.wjgnet.com<br />

stent placement provides a shorter hospital stay, earlier<br />

resumption <strong>of</strong> oral intake, fewer complications and lower<br />

hospital costs [399,400] . The only randomized controlled<br />

study that compared duodenal stent and laparoscopic<br />

gastrojejunostomy favored endoscopic therapy as it was<br />

associated with less discomfort, shorter hospital stay and<br />

improved physical health scores at 1 mo [401] . In this small<br />

study, only a third <strong>of</strong> patients were alive at 1 year and no<br />

cases <strong>of</strong> stent occlusion were observed. The two groups<br />

had similar overall survival supporting equipoise between<br />

endoscopic and surgical palliation. Nevertheless, surgical<br />

palliation can still play an important role when patients<br />

have a long life-expectancy, need biliary and gastric bypass<br />

in combination with celiac neurolysis for pain control.<br />

Biliary decompression<br />

The majority <strong>of</strong> PCs occur in the head <strong>of</strong> the pancreas<br />

and obstructive jaundice is one <strong>of</strong> the early symptoms for<br />

50%-80% <strong>of</strong> patients [396] . In the past, staging laparotomy<br />

and biliary bypass were frequently performed for unresectable<br />

PC <strong>of</strong> the head [402,403] . During the last decades,<br />

the development <strong>of</strong> interventional radiology and endoscopy<br />

has allowed palliation <strong>of</strong> obstructive jaundice by<br />

the insertion <strong>of</strong> percutaneous or endoluminal stents with<br />

minimal morbidity and mortality. Currently, endoscopic<br />

biliary stenting is the treatment <strong>of</strong> choice for unresectable<br />

PC with obstructive jaundice. Percutaneous transhepatic<br />

stenting is reserved only for patients in whom endoscopic<br />

stenting has failed as it is associated with a higher complication<br />

rate than endoscopic palliation (61% vs 35%) [404,405] .<br />

High risk surgical patients are best managed by biliary<br />

stenting, however, it is still unclear whether palliative surgical<br />

biliary decompression is superior to other interventions<br />

for patients who are fit for surgery or who have a<br />

longer life expectancy. A European randomized controlled<br />

study comparing surgical biliary decompression vs endoscopic<br />

plastic stenting showed that both interventions<br />

were equally successful in palliating jaundice (95% vs 94%,<br />

respectively) and provided equal overall survival. Nevertheless,<br />

major complications (29% vs 11%) and procedurerelated<br />

mortality (14% vs 3%) were significantly higher for<br />

surgical patients [406] . In addition, surgical decompression<br />

was more expensive than stenting, although recurrent biliary<br />

obstructions and late gastric bypasses were more common<br />

in patients undergoing endoscopic treatment even<br />

if that did not reach statistical significance. Similar results<br />

were reported in a more recent Brazilian study which<br />

found that endoscopic therapy with self-expandable metallic<br />

stents was more cost-effective than surgical decompression<br />

(US$2832 vs US$3821, P = 0.031) and provided<br />

better quality <strong>of</strong> life at 30 (P = 0.04) and 60 d (P = 0.05) [407] .<br />

The only available meta-analysis <strong>of</strong> randomized controlled<br />

studies comparing surgery with endoscopic stenting included<br />

only 3 studies where none tested the use <strong>of</strong> metallic<br />

self-expanding stents [408] . Although the reintervention<br />

rate was 3% (0%-16%) in surgically treated patients compared<br />

with 36% (28%-43%) in stented patients, because<br />

<strong>of</strong> the limited number <strong>of</strong> studies with a relatively small<br />

group <strong>of</strong> patients and heterogeneous quality, the authors<br />

884 February 21, 2011|Volume 17|Issue 7|

---

concluded that they could not identify which treatment<br />

was preferable.<br />

The patency <strong>of</strong> biliary stents has greatly improved<br />

with the introduction <strong>of</strong> expandable metallic stents (EMS)<br />

as they <strong>of</strong>fer a larger diameter for drainage and are associated<br />

with a lower occlusion rate than plastic stents [409,410] .<br />

The concurrent use <strong>of</strong> chemotherapeutic agents in patients<br />

palliated with SEMS was thought to increase the<br />

risk for ascending cholangitis. However, a Japanese retrospective<br />

study has demonstrated that the combination<br />

<strong>of</strong> SEMS and palliative chemotherapy for unresectable<br />

PC did not change the incidence <strong>of</strong> biliary infectious<br />

complications [411] . In patients with combined biliary and<br />

duodenal obstructions, concomitant biliary and duodenal<br />

stenting is now feasible and justified as the need to repeat<br />

endoscopic therapies is rarely required even in long-term<br />

survival patients [412] .<br />

Currently, surgical biliary bypass is advocated only for<br />

patients with obstructive jaundice who fail endoscopic or<br />

percutaneous stent placement.<br />

Pain control<br />

About 70% <strong>of</strong> patients with unresectable PC develop<br />

clinically important pain during their lives [413] . Pain is the<br />

main cause <strong>of</strong> the significant drop in quality and quantity<br />

<strong>of</strong> life <strong>of</strong> these patients and good palliation is necessary as<br />

pain incidence and severity increases with disease progression<br />

[414] .<br />

For the majority <strong>of</strong> patients, pain from PC can be<br />

managed with opioid analgesics. However, approximately<br />

one third <strong>of</strong> patients experience inadequate control <strong>of</strong><br />

pain with oral analgesics alone [415] . For these patients, radiation<br />

therapy, chemotherapy and celiac plexus neurolysis<br />

have been used. Percutaneous neurolytic celiac plexus<br />

block with injection <strong>of</strong> 50%-100% ethyl alcohol under<br />

radiological guidance has become the most commonly<br />

recognized method <strong>of</strong> splanchnicectomy with a 70%-96%<br />

success rate [416] . The celiac plexus block has several advantages<br />

as it has been proven to ease pain without the side<br />

effects <strong>of</strong> opioids and can be administered intraoperatively,<br />

percutaneously, or by endoscopic ultrasonography. Recent<br />

studies have shown that endoscopic ultrasonographyguided<br />

neurolysis is effective and has minimal risk <strong>of</strong> the<br />

potentially serious complications associated with surgical<br />

or percutaneous approaches [417,418] .<br />

A recent double-blind randomized controlled study<br />

comparing patients treated with celiac plexus block vs systemic<br />

analgesic therapy showed that splanchnic neurolysis<br />

provided superior pain relief and quality <strong>of</strong> life scores, but<br />

overall opioid consumption, frequency <strong>of</strong> opioid adverse<br />

effects and overall survival did not reach statistical significance<br />

between the two groups [419] . For the majority <strong>of</strong> PC<br />

patients, pain is still controlled pharmacologically even if<br />

other modalities such as surgical thoracoscopic splanchnicectomy,<br />

epidural anesthesia, subcutaneous injection with<br />

octreotide, hyp<strong>of</strong>ractionated-accelerated radiotherapy and<br />

more recently photodynamic therapy have shown some<br />

temporary success [414,420-423] .<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

Nutritional supportive care<br />

The median survival <strong>of</strong> patients with unresectable PC<br />

is 33 wk and for advanced metastatic disease is only<br />

10 wk [424] . About 90% <strong>of</strong> patients with PC have significant<br />

weight loss at the time <strong>of</strong> diagnosis and all <strong>of</strong> them<br />

develop progressive cachexia due to neoplastic metabolic<br />

derangements. Secondary events such as pancreatic exocrine<br />

insufficiency due to pancreatic duct obstruction, fat<br />

malabsorption due to biliary obstruction and poor oral caloric<br />

intake caused by nausea or gastric outlet obstruction<br />

are also responsible for the progressive weight loss. Even<br />

if weight loss has been found to have a prognostic effect<br />

on survival, most <strong>of</strong> the palliative care interventions for<br />

PC are directed at correcting biliary obstruction, gastric<br />

outlet obstruction and pain, and relatively little attention<br />

has been paid to interventions that can prevent or reduce<br />

the progressive weight loss <strong>of</strong> these patients [425] . Recently,<br />

a placebo-controlled trial comparing patients receiving<br />

enteric coated pancreatic enzyme supplements vs placebo<br />

showed that after 2 mo, patients receiving pancreatin had<br />

gained 1.2% <strong>of</strong> their body weight in comparison to controls<br />

who lost 3.7% (P = 0.02), and that they had higher<br />

daily total energy intake (8.4 MJ vs 6.6 MJ, P = 0.04) [424] .<br />

Although the Karn<strong>of</strong>sky performance status between the<br />

two groups was not different and survival analysis was not<br />

performed to determine if body weight gain translates into<br />

better prognosis, this study was the first to show an effective<br />

palliative strategy able to increase the intestinal absorptive<br />

function <strong>of</strong> patients who suffer from steatorrhea.<br />

CONCLUSION<br />

In recent decades, diagnostic modalities, and the surgical<br />

and palliative treatments <strong>of</strong> PC have clearly progressed<br />

although the overall prognosis has barely changed. The<br />

management <strong>of</strong> patients affected by PC is complex and<br />

requires expertise in many fields. Multidisciplinary teams<br />

are necessary to optimize the overall care, and palliative<br />

techniques have to be mastered as the majority <strong>of</strong> PCs are<br />

diagnosed in advanced <strong>stage</strong>s. Better outcomes are reached<br />

if PC patients are appropriately referred to tertiary centers<br />

for assessment by surgical, medical and radiation oncologists,<br />

gastroenterologists, palliative care specialists and other<br />

dedicated health care providers. Despite recent progress,<br />

there is still a very limited ability to detect PC at an early<br />

<strong>stage</strong>, and there is a need for more studies to better understand<br />

genetic predisposing factors and to discover new<br />

markers that could assist physicians in this task. Randomized<br />

controlled studies are necessary to explore the role<br />

<strong>of</strong> neo-adjuvant therapies and new protocols for adjuvant<br />

strategies in patients undergoing pancreatic resection.<br />

REFERENCES<br />

1 Cubilla AL, Fitzgerald PJ. Morphological lesions associated<br />

with human primary invasive nonendocrine pancreas <strong>cancer</strong>.<br />

Cancer Res 1976; 36: 2690-2698<br />

2 Sener SF, Fremgen A, Menck HR, Winchester DP. Pancreatic<br />

<strong>cancer</strong>: a report <strong>of</strong> treatment and survival trends for 100,313<br />

885 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

patients diagnosed from 1985-1995, using the National Cancer<br />

Database. J Am Coll Surg 1999; 189: 1-7<br />

3 Porta M, Fabregat X, Malats N, Guarner L, Carrato A, de<br />

Miguel A, Ruiz L, Jariod M, Costafreda S, Coll S, Alguacil J,<br />

Corominas JM, Solà R, Salas A, Real FX. Exocrine pancreatic<br />

<strong>cancer</strong>: symptoms at presentation and their relation to tumour<br />

site and <strong>stage</strong>. Clin Transl Oncol 2005; 7: 189-197<br />

4 Kullavanijaya P, Treeprasertsuk S, Thong-Ngam D, Kladcharoen<br />

N, Mahachai V, Suwanagool P. Adenocarcinoma <strong>of</strong><br />

the pancreas: the clinical experience <strong>of</strong> 45 histopathologically<br />

proven patients, a 6 year study. J Med Assoc Thai 2001; 84:<br />

640-647<br />

5 Elli M, Piazza E, Franzone PC, Isabella L, Poliziani D, Taschieri<br />

AM. Considerations on early diagnosis <strong>of</strong> carcinoma <strong>of</strong><br />

the pancreas. Hepatogastroenterology 2003; 50: 2205-2207<br />

6 Cook DJ, Mulrow CD, Haynes RB. Systematic reviews: synthesis<br />

<strong>of</strong> best evidence for clinical decisions. Ann Intern Med<br />

1997; 126: 376-380<br />

7 Mulrow CD, Oxman AD. Cochrane Collaboration Handbook.<br />

Oxford: Update S<strong>of</strong>tware, 1997: 1<br />

8 Downs SH, Black N. The feasibility <strong>of</strong> creating a checklist<br />

for the assessment <strong>of</strong> the methodological quality both <strong>of</strong><br />

randomised and non-randomised studies <strong>of</strong> health care interventions.<br />

J Epidemiol Community Health 1998; 52: 377-384<br />

9 Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer<br />

statistics, 2009. CA Cancer J Clin 2009; 59: 225-249<br />

10 Shaib YH, Davila JA, El-Serag HB. The epidemiology <strong>of</strong><br />

pancreatic <strong>cancer</strong> in the United States: changes below the<br />

surface. Aliment Pharmacol Ther 2006; 24: 87-94<br />

11 Ghadirian P, Lynch HT, Krewski D. Epidemiology <strong>of</strong> pancreatic<br />

<strong>cancer</strong>: an overview. Cancer Detect Prev 2003; 27: 87-93<br />

12 Lowenfels AB, Maisonneuve P. Epidemiology and risk factors<br />

for pancreatic <strong>cancer</strong>. Best Pract Res Clin Gastroenterol<br />

2006; 20: 197-209<br />

13 Neugut AI, Ahsan H, Robinson E. Pancreas <strong>cancer</strong> as a second<br />

primary malignancy. A population-based study. Cancer<br />

1995; 76: 589-592<br />

14 Lynch SM, Vrieling A, Lubin JH, Kraft P, Mendelsohn JB,<br />

Hartge P, Canzian F, Steplowski E, Arslan AA, Gross M,<br />

Helzlsouer K, Jacobs EJ, LaCroix A, Petersen G, Zheng<br />

W, Albanes D, Amundadottir L, Bingham SA, B<strong>of</strong>fetta P,<br />

Boutron-Ruault MC, Chanock SJ, Clipp S, Hoover RN, Jacobs<br />

K, Johnson KC, Kooperberg C, Luo J, Messina C, Palli D,<br />

Patel AV, Riboli E, Shu XO, Rodriguez Suarez L, Thomas G,<br />

Tjønneland A, Tobias GS, Tong E, Trichopoulos D, Virtamo J,<br />

Ye W, Yu K, Zeleniuch-Jacquette A, Bueno-de-Mesquita HB,<br />

Stolzenberg-Solomon RZ. Cigarette smoking and pancreatic<br />

<strong>cancer</strong>: a pooled analysis from the pancreatic <strong>cancer</strong> cohort<br />

consortium. Am J Epidemiol 2009; 170: 403-413<br />

15 Brand RE, Greer JB, Zolotarevsky E, Brand R, Du H, Simeone<br />

D, Zisman A, Gorchow A, Lee SY, Roy HK, Anderson<br />

MA. Pancreatic <strong>cancer</strong> patients who smoke and drink are<br />

diagnosed at younger ages. Clin Gastroenterol Hepatol 2009; 7:<br />

1007-1012<br />

16 Iodice S, Gandini S, Maisonneuve P, Lowenfels AB. Tobacco<br />

and the risk <strong>of</strong> pancreatic <strong>cancer</strong>: a review and meta-analysis.<br />

Langenbecks Arch Surg 2008; 393: 535-545<br />

17 Hassan MM, Bondy ML, Wolff RA, Abbruzzese JL, Vauthey<br />

JN, Pisters PW, Evans DB, Khan R, Chou TH, Lenzi R, Jiao L,<br />

Li D. Risk factors for pancreatic <strong>cancer</strong>: case-control study.<br />

Am J Gastroenterol 2007; 102: 2696-2707<br />

18 Permert J, Ihse I, Jorfeldt L, von Schenck H, Arnqvist HJ,<br />

Larsson J. Pancreatic <strong>cancer</strong> is associated with impaired glucose<br />

metabolism. Eur J Surg 1993; 159: 101-107<br />

19 Gullo L, Pezzilli R, Morselli-Labate AM. Diabetes and the<br />

risk <strong>of</strong> pancreatic <strong>cancer</strong>. N Engl J Med 1994; 331: 81-84<br />

20 Everhart J, Wright D. Diabetes mellitus as a risk factor for pancreatic<br />

<strong>cancer</strong>. A meta-analysis. JAMA 1995; 273: 1605-1609<br />

21 Wider<strong>of</strong>f L, Gridley G, Mellemkjaer L, Chow WH, Linet<br />

M, Keehn S, Borch-Johnsen K, Olsen JH. Cancer incidence<br />

in a population-based cohort <strong>of</strong> patients hospitalized with<br />

WJG|www.wjgnet.com<br />

diabetes mellitus in Denmark. J Natl Cancer Inst 1997; 89:<br />

1360-1365<br />

22 Gapstur SM, Gann PH, Lowe W, Liu K, Colangelo L, Dyer A.<br />

Abnormal glucose metabolism and pancreatic <strong>cancer</strong> mortality.<br />

JAMA 2000; 283: 2552-2558<br />

23 Chari ST, Leibson CL, Rabe KG, Ransom J, de Andrade M,<br />

Petersen GM. Probability <strong>of</strong> pancreatic <strong>cancer</strong> following diabetes:<br />

a population-based study. Gastroenterology 2005; 129:<br />

504-511<br />

24 Ogawa Y, Tanaka M, Inoue K, Yamaguchi K, Chijiiwa K,<br />

Mizumoto K, Tsutsu N, Nakamura Y. A prospective pancreatographic<br />

study <strong>of</strong> the prevalence <strong>of</strong> pancreatic carcinoma<br />

in patients with diabetes mellitus. Cancer 2002; 94: 2344-2349<br />

25 Huxley R, Ansary-Moghaddam A, Berrington de González<br />

A, Barzi F, Woodward M. Type-II diabetes and pancreatic<br />

<strong>cancer</strong>: a meta-analysis <strong>of</strong> 36 studies. Br J Cancer 2005; 92:<br />

2076-2083<br />

26 Yalniz M, Pour PM. Diabetes mellitus: a risk factor for pancreatic<br />

<strong>cancer</strong>? Langenbecks Arch Surg 2005; 390: 66-72<br />

27 Silverman DT, Schiffman M, Everhart J, Goldstein A, Lillemoe<br />

KD, Swanson GM, Schwartz AG, Brown LM, Greenberg<br />

RS, Schoenberg JB, Pottern LM, Hoover RN, Fraumeni JF Jr.<br />

Diabetes mellitus, other medical conditions and familial history<br />

<strong>of</strong> <strong>cancer</strong> as risk factors for pancreatic <strong>cancer</strong>. Br J Cancer<br />

1999; 80: 1830-1837<br />

28 Perrin MC, Terry MB, Kleinhaus K, Deutsch L, Yanetz R,<br />

Tiram E, Calderon R, Friedlander Y, Paltiel O, Harlap S.<br />

Gestational diabetes as a risk factor for pancreatic <strong>cancer</strong>: a<br />

prospective cohort study. BMC Med 2007; 5: 25<br />

29 Fisher WE, Boros LG, Schirmer WJ. Insulin promotes pancreatic<br />

<strong>cancer</strong>: evidence for endocrine influence on exocrine<br />

pancreatic tumors. J Surg Res 1996; 63: 310-313<br />

30 Lowenfels AB, Maisonneuve P, Cavallini G, Ammann RW,<br />

Lankisch PG, Andersen JR, Dimagno EP, Andrén-Sandberg<br />

A, Domellöf L. Pancreatitis and the risk <strong>of</strong> pancreatic <strong>cancer</strong>.<br />

International Pancreatitis Study Group. N Engl J Med 1993;<br />

328: 1433-1437<br />

31 Jiao L, Silverman DT, Schairer C, Thiébaut AC, Hollenbeck<br />

AR, Leitzmann MF, Schatzkin A, Stolzenberg-Solomon RZ.<br />

Alcohol use and risk <strong>of</strong> pancreatic <strong>cancer</strong>: the NIH-AARP<br />

Diet and Health Study. Am J Epidemiol 2009; 169: 1043-1051<br />

32 Genkinger JM, Spiegelman D, Anderson KE, Bergkvist L,<br />

Bernstein L, van den Brandt PA, English DR, Freudenheim<br />

JL, Fuchs CS, Giles GG, Giovannucci E, Hankinson SE, Horn-<br />

Ross PL, Leitzmann M, Männistö S, Marshall JR, McCullough<br />

ML, Miller AB, Reding DJ, Robien K, Rohan TE, Schatzkin A,<br />

Stevens VL, Stolzenberg-Solomon RZ, Verhage BA, Wolk A,<br />

Ziegler RG, Smith-Warner SA. Alcohol intake and pancreatic<br />

<strong>cancer</strong> risk: a pooled analysis <strong>of</strong> fourteen cohort studies. Cancer<br />

Epidemiol Biomarkers Prev 2009; 18: 765-776<br />

33 Rohrmann S, Linseisen J, Vrieling A, B<strong>of</strong>fetta P, Stolzenberg-<br />

Solomon RZ, Lowenfels AB, Jensen MK, Overvad K, Olsen<br />

A, Tjonneland A, Boutron-Ruault MC, Clavel-Chapelon F,<br />

Fagherazzi G, Misirli G, Lagiou P, Trichopoulou A, Kaaks<br />

R, Bergmann MM, Boeing H, Bingham S, Khaw KT, Allen<br />

N, Roddam A, Palli D, Pala V, Panico S, Tumino R, Vineis<br />

P, Peeters PH, Hjartåker A, Lund E, Redondo Cornejo ML,<br />

Agudo A, Arriola L, Sánchez MJ, Tormo MJ, Barricarte Gurrea<br />

A, Lindkvist B, Manjer J, Johansson I, Ye W, Slimani N,<br />

Duell EJ, Jenab M, Michaud DS, Mouw T, Riboli E, Bueno-de-<br />

Mesquita HB. Ethanol intake and the risk <strong>of</strong> pancreatic <strong>cancer</strong><br />

in the European Prospective Investigation into Cancer and<br />

Nutrition (EPIC). Cancer Causes Control 2009; 20: 785-794<br />

34 Fernandez E, La Vecchia C, Porta M, Negri E, d'Avanzo B,<br />

Boyle P. Pancreatitis and the risk <strong>of</strong> pancreatic <strong>cancer</strong>. Pancreas<br />

1995; 11: 185-189<br />

35 Silverman DT, Brown LM, Hoover RN, Schiffman M, Lillemoe<br />

KD, Schoenberg JB, Swanson GM, Hayes RB, Greenberg<br />

RS, Benichou J. Alcohol and pancreatic <strong>cancer</strong> in blacks and<br />

whites in the United States. Cancer Res 1995; 55: 4899-4905<br />

36 Bansal P, Sonnenberg A. Pancreatitis is a risk factor for pan-<br />

886 February 21, 2011|Volume 17|Issue 7|

---

creatic <strong>cancer</strong>. Gastroenterology 1995; 109: 247-251<br />

37 Karlson BM, Ekbom A, Josefsson S, McLaughlin JK, Fraumeni<br />

JF Jr, Nyrén O. The risk <strong>of</strong> pancreatic <strong>cancer</strong> following<br />

pancreatitis: an association due to confounding? Gastroenterology<br />

1997; 113: 587-592<br />

38 Farrow B, Evers BM. Inflammation and the development <strong>of</strong><br />

pancreatic <strong>cancer</strong>. Surg Oncol 2002; 10: 153-169<br />

39 Whitcomb DC, Applebaum S, Martin SP. Hereditary pancreatitis<br />

and pancreatic carcinoma. Ann N Y Acad Sci 1999;<br />

880: 201-209<br />

40 Lowenfels AB, Maisonneuve P, DiMagno EP, Elitsur Y,<br />

Gates LK Jr, Perrault J, Whitcomb DC. Hereditary pancreatitis<br />

and the risk <strong>of</strong> pancreatic <strong>cancer</strong>. International Hereditary<br />

Pancreatitis Study Group. J Natl Cancer Inst 1997; 89: 442-446<br />

41 Hruban RH, Petersen GM, Goggins M, Tersmette AC, Offerhaus<br />

GJ, Falatko F, Yeo CJ, Kern SE. Familial pancreatic<br />

<strong>cancer</strong>. Ann Oncol 1999; 10 Suppl 4: 69-73<br />

42 O'Brien JM. Environmental and heritable factors in the causation<br />

<strong>of</strong> <strong>cancer</strong>: analyses <strong>of</strong> cohorts <strong>of</strong> twins from Sweden,<br />

Denmark, and Finland, by P. Lichtenstein, N.V. Holm, P.K.<br />

Verkasalo, A. Iliadou, J. Kaprio, M. Koskenvuo, E. Pukkala,<br />

A. Skytthe, and K. Hemminki. N Engl J Med 343:78-84, 2000.<br />

Surv Ophthalmol 2000; 45: 167-168<br />

43 Lilley M, Gilchrist D. The hereditary spectrum <strong>of</strong> pancreatic<br />

<strong>cancer</strong>: the Edmonton experience. Can J Gastroenterol 2004;<br />

18: 17-21<br />

44 Klein AP, Brune KA, Petersen GM, Goggins M, Tersmette<br />

AC, Offerhaus GJ, Griffin C, Cameron JL, Yeo CJ, Kern S,<br />

Hruban RH. Prospective risk <strong>of</strong> pancreatic <strong>cancer</strong> in familial<br />

pancreatic <strong>cancer</strong> kindreds. Cancer Res 2004; 64: 2634-2638<br />

45 Brentnall TA, Bronner MP, Byrd DR, Haggitt RC, Kimmey<br />

MB. Early diagnosis and treatment <strong>of</strong> pancreatic dysplasia<br />

in patients with a family history <strong>of</strong> pancreatic <strong>cancer</strong>. Ann<br />

Intern Med 1999; 131: 247-255<br />

46 Meckler KA, Brentnall TA, Haggitt RC, Crispin D, Byrd DR,<br />

Kimmey MB, Bronner MP. Familial fibrocystic pancreatic<br />

atrophy with endocrine cell hyperplasia and pancreatic carcinoma.<br />

Am J Surg Pathol 2001; 25: 1047-1053<br />

47 Zogopoulos G, Rothenmund H, Eppel A, Ash C, Akbari MR,<br />

Hedley D, Narod SA, Gallinger S. The P239S palladin variant<br />

does not account for a significant fraction <strong>of</strong> hereditary<br />

or early onset pancreas <strong>cancer</strong>. Hum Genet 2007; 121: 635-637<br />

48 Lynch HT, Fitzsimmons ML, Smyrk TC, Lanspa SJ, Watson<br />

P, McClellan J, Lynch JF. Familial pancreatic <strong>cancer</strong>: clinicopathologic<br />

study <strong>of</strong> 18 nuclear families. Am J Gastroenterol<br />

1990; 85: 54-60<br />

49 Goldstein AM, Fraser MC, Struewing JP, Hussussian CJ,<br />

Ranade K, Zametkin DP, Fontaine LS, Organic SM, Dracopoli<br />

NC, Clark WH Jr. Increased risk <strong>of</strong> pancreatic <strong>cancer</strong> in<br />

melanoma-prone kindreds with p16INK4 mutations. N Engl<br />

J Med 1995; 333: 970-974<br />

50 Goggins M, Schutte M, Lu J, Moskaluk CA, Weinstein CL,<br />

Petersen GM, Yeo CJ, Jackson CE, Lynch HT, Hruban RH,<br />

Kern SE. Germline BRCA2 gene mutations in patients with<br />

apparently sporadic pancreatic carcinomas. Cancer Res 1996;<br />

56: 5360-5364<br />

51 Hahn SA, Greenhalf B, Ellis I, Sina-Frey M, Rieder H, Korte B,<br />

Gerdes B, Kress R, Ziegler A, Raeburn JA, Campra D, Grützmann<br />

R, Rehder H, Rothmund M, Schmiegel W, Neoptolemos<br />

JP, Bartsch DK. BRCA2 germline mutations in familial<br />

pancreatic carcinoma. J Natl Cancer Inst 2003; 95: 214-221<br />

52 Murphy KM, Brune KA, Griffin C, Sollenberger JE, Petersen<br />

GM, Bansal R, Hruban RH, Kern SE. Evaluation <strong>of</strong> candidate<br />

genes MAP2K4, MADH4, ACVR1B, and BRCA2 in familial<br />

pancreatic <strong>cancer</strong>: deleterious BRCA2 mutations in 17%.<br />

Cancer Res 2002; 62: 3789-3793<br />

53 Su GH, Hruban RH, Bansal RK, Bova GS, Tang DJ, Shekher<br />

MC, Westerman AM, Entius MM, Goggins M, Yeo CJ, Kern<br />

SE. Germline and somatic mutations <strong>of</strong> the STK11/LKB1<br />

Peutz-Jeghers gene in pancreatic and biliary <strong>cancer</strong>s. Am J<br />

Pathol 1999; 154: 1835-1840<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

54 Permuth-Wey J, Egan KM. Family history is a significant<br />

risk factor for pancreatic <strong>cancer</strong>: results from a systematic<br />

review and meta-analysis. Fam Cancer 2009; 8: 109-117<br />

55 Shi C, Hruban RH, Klein AP. Familial pancreatic <strong>cancer</strong>.<br />

Arch Pathol Lab Med 2009; 133: 365-374<br />

56 Ghadirian P, Liu G, Gallinger S, Schmocker B, Paradis AJ,<br />

Lal G, Brunet JS, Foulkes WD, Narod SA. Risk <strong>of</strong> pancreatic<br />

<strong>cancer</strong> among individuals with a family history <strong>of</strong> <strong>cancer</strong> <strong>of</strong><br />

the pancreas. Int J Cancer 2002; 97: 807-810<br />

57 Bartsch DK, Kress R, Sina-Frey M, Grützmann R, Gerdes<br />

B, Pilarsky C, Heise JW, Schulte KM, Colombo-Benkmann<br />

M, Schleicher C, Witzigmann H, Pridöhl O, Ghadimi MB,<br />

Horstmann O, von Bernstorff W, Jochimsen L, Schmidt J, Eisold<br />

S, Estévéz-Schwarz L, Hahn SA, Schulmann K, Böck W,<br />

Gress TM, Zügel N, Breitschaft K, Prenzel K, Messmann H,<br />

Endlicher E, Schneider M, Ziegler A, Schmiegel W, Schäfer<br />

H, Rothmund M, Rieder H. Prevalence <strong>of</strong> familial pancreatic<br />

<strong>cancer</strong> in Germany. Int J Cancer 2004; 110: 902-906<br />

58 Bartsch DK. Familial pancreatic <strong>cancer</strong>. Br J Surg 2003; 90:<br />

386-387<br />

59 Landi S. Genetic predisposition and environmental risk factors<br />

to pancreatic <strong>cancer</strong>: A review <strong>of</strong> the literature. Mutat<br />

Res 2009; 681: 299-307<br />

60 van der Heijden MS, Yeo CJ, Hruban RH, Kern SE. Fanconi<br />

anemia gene mutations in young-onset pancreatic <strong>cancer</strong>.<br />

Cancer Res 2003; 63: 2585-2588<br />

61 Rieder H, Sina-Frey M, Ziegler A, Hahn SA, Przypadlo E,<br />

Kress R, Gerdes B, Colombo Benkmann M, Eberl T, Grützmann<br />

R, Lörken M, Schmidt J, Bartsch DK. German national<br />

case collection <strong>of</strong> familial pancreatic <strong>cancer</strong> - clinicalgenetic<br />

analysis <strong>of</strong> the first 21 families. Onkologie 2002; 25:<br />

262-266<br />

62 Hruban RH, Canto MI, Yeo CJ. Prevention <strong>of</strong> pancreatic<br />

<strong>cancer</strong> and strategies for management <strong>of</strong> familial pancreatic<br />

<strong>cancer</strong>. Dig Dis 2001; 19: 76-84<br />

63 Petersen GM, de Andrade M, Goggins M, Hruban RH,<br />

Bondy M, Korczak JF, Gallinger S, Lynch HT, Syngal S, Rabe<br />

KG, Seminara D, Klein AP. Pancreatic <strong>cancer</strong> genetic epidemiology<br />

consortium. Cancer Epidemiol Biomarkers Prev 2006;<br />

15: 704-710<br />

64 Wang W, Chen S, Brune KA, Hruban RH, Parmigiani G,<br />

Klein AP. PancPRO: risk assessment for individuals with<br />

a family history <strong>of</strong> pancreatic <strong>cancer</strong>. J Clin Oncol 2007; 25:<br />

1417-1422<br />

65 Li D, Morris JS, Liu J, Hassan MM, Day RS, Bondy ML, Abbruzzese<br />

JL. Body mass index and risk, age <strong>of</strong> onset, and<br />

survival in patients with pancreatic <strong>cancer</strong>. JAMA 2009; 301:<br />

2553-2562<br />

66 Patel AV, Rodriguez C, Bernstein L, Chao A, Thun MJ,<br />

Calle EE. Obesity, recreational physical activity, and risk <strong>of</strong><br />

pancreatic <strong>cancer</strong> in a large U.S. Cohort. Cancer Epidemiol<br />

Biomarkers Prev 2005; 14: 459-466<br />

67 Larsson SC, Permert J, Håkansson N, Näslund I, Bergkvist L,<br />

Wolk A. Overall obesity, abdominal adiposity, diabetes and<br />

cigarette smoking in relation to the risk <strong>of</strong> pancreatic <strong>cancer</strong><br />

in two Swedish population-based cohorts. Br J Cancer 2005;<br />

93: 1310-1315<br />

68 Berrington de González A, Spencer EA, Bueno-de-Mesquita<br />

HB, Roddam A, Stolzenberg-Solomon R, Halkjaer J,<br />

Tjønneland A, Overvad K, Clavel-Chapelon F, Boutron-<br />

Ruault MC, Boeing H, Pischon T, Linseisen J, Rohrmann S,<br />

Trichopoulou A, Benetou V, Papadimitriou A, Pala V, Palli<br />

D, Panico S, Tumino R, Vineis P, Boshuizen HC, Ocke MC,<br />

Peeters PH, Lund E, Gonzalez CA, Larrañaga N, Martinez-<br />

Garcia C, Mendez M, Navarro C, Quirós JR, Tormo MJ,<br />

Hallmans G, Ye W, Bingham SA, Khaw KT, Allen N, Key TJ,<br />

Jenab M, Norat T, Ferrari P, Riboli E. Anthropometry, physical<br />

activity, and the risk <strong>of</strong> pancreatic <strong>cancer</strong> in the European<br />

prospective investigation into <strong>cancer</strong> and nutrition. Cancer<br />

Epidemiol Biomarkers Prev 2006; 15: 879-885<br />

69 Fitzgerald TL, Hickner ZJ, Schmitz M, Kort EJ. Changing<br />

887 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

incidence <strong>of</strong> pancreatic neoplasms: a 16-year review <strong>of</strong> statewide<br />

tumor registry. Pancreas 2008; 37: 134-138<br />

70 Conlon KC, Klimstra DS, Brennan MF. Long-term survival<br />

after curative resection for pancreatic ductal adenocarcinoma.<br />

Clinicopathologic analysis <strong>of</strong> 5-year survivors. Ann Surg<br />

1996; 223: 273-279<br />

71 Winter JM, Cameron JL, Campbell KA, Arnold MA, Chang<br />

DC, Coleman J, Hodgin MB, Sauter PK, Hruban RH, Riall<br />

TS, Schulick RD, Choti MA, Lillemoe KD, Yeo CJ. 1423<br />

pancreaticoduodenectomies for pancreatic <strong>cancer</strong>: A singleinstitution<br />

experience. J Gastrointest Surg 2006; 10: 1199-1210;<br />

discussion 1210-1211<br />

72 Poultsides GA, Reddy S, Cameron JL, Hruban RH, Pawlik<br />

TM, Ahuja N, Jain A, Edil BH, Iacobuzio-Donahue CA,<br />

Schulick RD, Wolfgang CL. Histopathologic basis for the<br />

favorable survival after resection <strong>of</strong> intraductal papillary<br />

mucinous neoplasm-associated invasive adenocarcinoma <strong>of</strong><br />

the pancreas. Ann Surg 2010; 251: 470-476<br />

73 Mortenson MM, Katz MH, Tamm EP, Bhutani MS, Wang H,<br />

Evans DB, Fleming JB. Current diagnosis and management<br />

<strong>of</strong> unusual pancreatic tumors. Am J Surg 2008; 196: 100-113<br />

74 Papavramidis T, Papavramidis S. Solid pseudopapillary<br />

tumors <strong>of</strong> the pancreas: review <strong>of</strong> 718 patients reported in<br />

English literature. J Am Coll Surg 2005; 200: 965-972<br />

75 Chadwick B, Willmore-Payne C, Tripp S, Layfield LJ,<br />

Hirschowitz S, Holden J. Histologic, immunohistochemical,<br />

and molecular classification <strong>of</strong> 52 IPMNs <strong>of</strong> the pancreas.<br />

Appl Immunohistochem Mol Morphol 2009; 17: 31-39<br />

76 Shin SH, Han DJ, Park KT, Kim YH, Park JB, Kim SC. Validating<br />

a simple scoring system to predict malignancy and<br />

invasiveness <strong>of</strong> intraductal papillary mucinous neoplasms <strong>of</strong><br />

the pancreas. <strong>World</strong> J Surg 2010; 34: 776-783<br />

77 Fan F, Lai EC, Xie F, Yang JM, Xu F, Kan T, Shen RX, Yang<br />

XY, Lau Wan Y, Wu MC. Intraductal papillary mucinous<br />

neoplasms <strong>of</strong> the pancreas--predictors <strong>of</strong> malignancy. Hepatogastroenterology<br />

2010; 57: 635-639<br />

78 Sohn TA, Yeo CJ, Cameron JL, Hruban RH, Fukushima N,<br />

Campbell KA, Lillemoe KD. Intraductal papillary mucinous<br />

neoplasms <strong>of</strong> the pancreas: an updated experience. Ann Surg<br />

2004; 239: 788-797; discussion 797-799<br />

79 Saif MW. Pancreatoblastoma. JOP 2007; 8: 55-63<br />

80 Dhebri AR, Connor S, Campbell F, Ghaneh P, Sutton R,<br />

Neoptolemos JP. Diagnosis, treatment and outcome <strong>of</strong> pancreatoblastoma.<br />

Pancreatology 2004; 4: 441-451; discussion<br />

452-453<br />

81 Chen J, Baithun SI. Morphological study <strong>of</strong> 391 cases <strong>of</strong> exocrine<br />

pancreatic tumours with special reference to the classification<br />

<strong>of</strong> exocrine pancreatic carcinoma. J Pathol 1985; 146:<br />

17-29<br />

82 Paal E, Thompson LD, Frommelt RA, Przygodzki RM, Heffess<br />

CS. A clinicopathologic and immunohistochemical<br />

study <strong>of</strong> 35 anaplastic carcinomas <strong>of</strong> the pancreas with a review<br />

<strong>of</strong> the literature. Ann Diagn Pathol 2001; 5: 129-140<br />

83 Connolly MM, Dawson PJ, Michelassi F, Moossa AR, Lowenstein<br />

F. Survival in 1001 patients with carcinoma <strong>of</strong> the<br />

pancreas. Ann Surg 1987; 206: 366-373<br />

84 Wilentz RE, Goggins M, Redston M, Marcus VA, Adsay NV,<br />

Sohn TA, Kadkol SS, Yeo CJ, Choti M, Zahurak M, Johnson<br />

K, Tascilar M, Offerhaus GJ, Hruban RH, Kern SE. Genetic,<br />

immunohistochemical, and clinical features <strong>of</strong> medullary<br />

carcinoma <strong>of</strong> the pancreas: A newly described and characterized<br />

entity. Am J Pathol 2000; 156: 1641-1651<br />

85 Ridder GJ, Maschek H, Klempnauer J. Favourable prognosis<br />

<strong>of</strong> cystadeno- over adenocarcinoma <strong>of</strong> the pancreas after curative<br />

resection. Eur J Surg Oncol 1996; 22: 232-236<br />

86 Madura JA, Jarman BT, Doherty MG, Yum MN, Howard TJ.<br />

Adenosquamous carcinoma <strong>of</strong> the pancreas. Arch Surg 1999;<br />

134: 599-603<br />

87 Mulkeen AL, Yoo PS, Cha C. Less common neoplasms <strong>of</strong><br />

the pancreas. <strong>World</strong> J Gastroenterol 2006; 12: 3180-3185<br />

88 Holen KD, Klimstra DS, Hummer A, Gonen M, Conlon K,<br />

WJG|www.wjgnet.com<br />

Brennan M, Saltz LB. Clinical characteristics and outcomes<br />

from an institutional series <strong>of</strong> acinar cell carcinoma <strong>of</strong> the<br />

pancreas and related tumors. J Clin Oncol 2002; 20: 4673-4678<br />

89 Shi C, Daniels JA, Hruban RH. Molecular characterization <strong>of</strong><br />

pancreatic neoplasms. Adv Anat Pathol 2008; 15: 185-195<br />

90 Liu F. SMAD4/DPC4 and pancreatic <strong>cancer</strong> survival. Commentary<br />

re: M. Tascilar et al., The SMAD4 protein and<br />

prognosis <strong>of</strong> pancreatic ductal adenocarcinoma. Clin. Cancer<br />

Res., 7: 4115-4121, 2001. Clin Cancer Res 2001; 7: 3853-3856<br />

91 Hurban RH, Pitman MB, Klimstra DS. Tumors <strong>of</strong> the pancreas.<br />

Atlas <strong>of</strong> tumor pathology. Washington DC: American<br />

Registry <strong>of</strong> Pathology and Armed forces Institute <strong>of</strong> Patholgy,<br />

2007<br />

92 Klimstra DS, Wenig BM, Heffess CS. Solid-pseudopapillary<br />

tumor <strong>of</strong> the pancreas: a typically cystic carcinoma <strong>of</strong> low<br />

malignant potential. Semin Diagn Pathol 2000; 17: 66-80<br />

93 Abraham SC, Klimstra DS, Wilentz RE, Yeo CJ, Conlon K,<br />

Brennan M, Cameron JL, Wu TT, Hruban RH. Solid-pseudopapillary<br />

tumors <strong>of</strong> the pancreas are genetically distinct from<br />

pancreatic ductal adenocarcinomas and almost always harbor<br />

beta-catenin mutations. Am J Pathol 2002; 160: 1361-1369<br />

94 Tanaka Y, Kato K, Notohara K, Hojo H, Ijiri R, Miyake T,<br />

Nagahara N, Sasaki F, Kitagawa N, Nakatani Y, Kobayashi<br />

Y. Frequent beta-catenin mutation and cytoplasmic/nuclear<br />

accumulation in pancreatic solid-pseudopapillary neoplasm.<br />

Cancer Res 2001; 61: 8401-8404<br />

95 El-Bahrawy MA, Rowan A, Horncastle D, Tomlinson I,<br />

Theis BA, Russell RC, Stamp G. E-cadherin/catenin complex<br />

status in solid pseudopapillary tumor <strong>of</strong> the pancreas. Am J<br />

Surg Pathol 2008; 32: 1-7<br />

96 Laffan TA, Horton KM, Klein AP, Berlanstein B, Siegelman<br />

SS, Kawamoto S, Johnson PT, Fishman EK, Hruban RH.<br />

Prevalence <strong>of</strong> unsuspected pancreatic cysts on MDCT. AJR<br />

Am J Roentgenol 2008; 191: 802-807<br />

97 Tanaka M, Chari S, Adsay V, Fernandez-del Castillo C,<br />

Falconi M, Shimizu M, Yamaguchi K, Yamao K, Matsuno S.<br />

International consensus guidelines for management <strong>of</strong> intraductal<br />

papillary mucinous neoplasms and mucinous cystic<br />

neoplasms <strong>of</strong> the pancreas. Pancreatology 2006; 6: 17-32<br />

98 Schönleben F, Qiu W, Ciau NT, Ho DJ, Li X, Allendorf JD,<br />

Remotti HE, Su GH. PIK3CA mutations in intraductal papillary<br />

mucinous neoplasm/carcinoma <strong>of</strong> the pancreas. Clin<br />

Cancer Res 2006; 12: 3851-3855<br />

99 Sato N, Rosty C, Jansen M, Fukushima N, Ueki T, Yeo CJ,<br />

Cameron JL, Iacobuzio-Donahue CA, Hruban RH, Goggins<br />

M. STK11/LKB1 Peutz-Jeghers gene inactivation in intraductal<br />

papillary-mucinous neoplasms <strong>of</strong> the pancreas. Am J<br />

Pathol 2001; 159: 2017-2022<br />

100 Iacobuzio-Donahue CA, Klimstra DS, Adsay NV, Wilentz<br />

RE, Argani P, Sohn TA, Yeo CJ, Cameron JL, Kern SE, Hruban<br />

RH. Dpc-4 protein is expressed in virtually all human<br />

intraductal papillary mucinous neoplasms <strong>of</strong> the pancreas:<br />

comparison with conventional ductal adenocarcinomas. Am<br />

J Pathol 2000; 157: 755-761<br />

101 Hruban RH, Adsay NV, Albores-Saavedra J, Compton C,<br />

Garrett ES, Goodman SN, Kern SE, Klimstra DS, Klöppel G,<br />

Longnecker DS, Lüttges J, Offerhaus GJ. Pancreatic intraepithelial<br />

neoplasia: a new nomenclature and classification<br />

system for pancreatic duct lesions. Am J Surg Pathol 2001; 25:<br />

579-586<br />

102 Wilentz RE, Iacobuzio-Donahue CA, Argani P, McCarthy<br />

DM, Parsons JL, Yeo CJ, Kern SE, Hruban RH. Loss <strong>of</strong> expression<br />

<strong>of</strong> Dpc4 in pancreatic intraepithelial neoplasia:<br />

evidence that DPC4 inactivation occurs late in neoplastic<br />

progression. Cancer Res 2000; 60: 2002-2006<br />

103 Maitra A, Hruban RH. Pancreatic <strong>cancer</strong>. Annu Rev Pathol<br />

2008; 3: 157-188<br />

104 Canto MI, Goggins M, Hruban RH, Petersen GM, Giardiello<br />

FM, Yeo C, Fishman EK, Brune K, Axilbund J, Griffin C, Ali S,<br />

Richman J, Jagannath S, Kantsevoy SV, Kalloo AN. Screening<br />

for early pancreatic neoplasia in high-risk individuals: a<br />

888 February 21, 2011|Volume 17|Issue 7|

---

prospective controlled study. Clin Gastroenterol Hepatol 2006;<br />

4: 766-781; quiz 665<br />

105 Klimstra DS, Longnecker DS. Acinar cell carcinoma. In:<br />

Hamilton SR, Aaltonen LA, editors. <strong>World</strong> Health Organization<br />

Classifiaction <strong>of</strong> tumors. Lyon: IARC Press, 2000: 241-243<br />

106 Kerr NJ, Chun YH, Yun K, Heathcott RW, Reeve AE, Sullivan<br />

MJ. Pancreatoblastoma is associated with chromosome<br />

11p loss <strong>of</strong> heterozygosity and IGF2 overexpression. Med<br />

Pediatr Oncol 2002; 39: 52-54<br />

107 Abraham SC, Wu TT, Klimstra DS, Finn LS, Lee JH, Yeo<br />

CJ, Cameron JL, Hruban RH. Distinctive molecular genetic<br />

alterations in sporadic and familial adenomatous polyposisassociated<br />

pancreatoblastomas : frequent alterations in the<br />

APC/beta-catenin pathway and chromosome 11p. Am J<br />

Pathol 2001; 159: 1619-1627<br />

108 Hoorens A, Prenzel K, Lemoine NR, Klöppel G. Undifferentiated<br />

carcinoma <strong>of</strong> the pancreas: analysis <strong>of</strong> intermediate<br />

filament pr<strong>of</strong>ile and Ki-ras mutations provides evidence <strong>of</strong> a<br />

ductal origin. J Pathol 1998; 185: 53-60<br />

109 Goggins M, Offerhaus GJ, Hilgers W, Griffin CA, Shekher M,<br />

Tang D, Sohn TA, Yeo CJ, Kern SE, Hruban RH. Pancreatic<br />

adenocarcinomas with DNA replication errors (RER+) are<br />

associated with wild-type K-ras and characteristic histopathology.<br />

Poor differentiation, a syncytial growth pattern,<br />

and pushing borders suggest RER+. Am J Pathol 1998; 152:<br />

1501-1507<br />

110 Yamamoto H, Itoh F, Nakamura H, Fukushima H, Sasaki S,<br />

Perucho M, Imai K. Genetic and clinical features <strong>of</strong> human<br />

pancreatic ductal adenocarcinomas with widespread microsatellite<br />

instability. Cancer Res 2001; 61: 3139-3144<br />

111 Calhoun ES, Jones JB, Ashfaq R, Adsay V, Baker SJ, Valentine<br />

V, Hempen PM, Hilgers W, Yeo CJ, Hruban RH, Kern<br />

SE. BRAF and FBXW7 (CDC4, FBW7, AGO, SEL10) mutations<br />

in distinct subsets <strong>of</strong> pancreatic <strong>cancer</strong>: potential therapeutic<br />

targets. Am J Pathol 2003; 163: 1255-1260<br />

112 Ribic CM, Sargent DJ, Moore MJ, Thibodeau SN, French<br />

AJ, Goldberg RM, Hamilton SR, Laurent-Puig P, Gryfe<br />

R, Shepherd LE, Tu D, Redston M, Gallinger S. Tumor<br />

microsatellite-instability status as a predictor <strong>of</strong> benefit from<br />

fluorouracil-based adjuvant chemotherapy for colon <strong>cancer</strong>.<br />

N Engl J Med 2003; 349: 247-257<br />

113 Becker WF, Welsh RA, Pratt HS. Cystadenoma and cystadenocarcinoma<br />

<strong>of</strong> the pancreas. Ann Surg 1965; 161: 845-863<br />

114 King JC, Ng TT, White SC, Cortina G, Reber HA, Hines OJ.<br />

Pancreatic serous cystadenocarcinoma: a case report and review<br />

<strong>of</strong> the literature. J Gastrointest Surg 2009; 13: 1864-1868<br />

115 Roggin KK, Chennat J, Oto A, N<strong>of</strong>fsinger A, Briggs A, Matthews<br />

JB. Pancreatic cystic neoplasm. Curr Probl Surg 2010;<br />

47: 459-510<br />

116 Wenig BM, Albores-Saavedra J, Buetow PC, Heffess CS.<br />

Pancreatic mucinous cystic neoplasm with sarcomatous stroma:<br />

a report <strong>of</strong> three cases. Am J Surg Pathol 1997; 21: 70-80<br />

117 Posen JA. Giant cell tumor <strong>of</strong> the pancreas <strong>of</strong> the osteoclastic<br />

type associated with a mucous secreting cystadenocarcinoma.<br />

Hum Pathol 1981; 12: 944-947<br />

118 Sarnaik AA, Saad AG, Mutema GK, Martin SP, Attar A,<br />

Lowy AM. Osteoclast-like giant cell tumor <strong>of</strong> the pancreas<br />

associated with a mucinous cystadenocarcinoma. Surgery<br />

2003; 133: 700-701<br />

119 Campman SC, Fajardo MA, Rippon MB, Kraegel SA, Ruebner<br />

BH. Adenosquamous carcinoma arising in a mucinous<br />

cystadenoma <strong>of</strong> the pancreas. J Surg Oncol 1997; 64: 159-162<br />

120 Fukushima N, Mukai K, Kanai Y, Hasebe T, Shimada K,<br />

Ozaki H, Kinoshita T, Kosuge T. Intraductal papillary tumors<br />

and mucinous cystic tumors <strong>of</strong> the pancreas: clinicopathologic<br />

study <strong>of</strong> 38 cases. Hum Pathol 1997; 28: 1010-1017<br />

121 Crippa S, Salvia R, Warshaw AL, Domínguez I, Bassi C, Falconi<br />

M, Thayer SP, Zamboni G, Lauwers GY, Mino-Kenudson<br />

M, Capelli P, Pederzoli P, Castillo CF. Mucinous cystic<br />

neoplasm <strong>of</strong> the pancreas is not an aggressive entity: lessons<br />

from 163 resected patients. Ann Surg 2008; 247: 571-579<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

122 Wood D, Silberman AW, Heifetz L, Memsic L, Shabot MM.<br />

Cystadenocarcinoma <strong>of</strong> the pancreas: neo-adjuvant therapy<br />

and CEA monitoring. J Surg Oncol 1990; 43: 56-60<br />

123 Bradley EL 3rd, Satchidanand SK. Is there a role for chemoradiation<br />

in the management <strong>of</strong> cystadenocarcinoma <strong>of</strong> the<br />

pancreas? Pancreas 2005; 31: 101-103<br />

124 Brown HA, Dotto J, Robert M, Salem RR. Squamous cell carcinoma<br />

<strong>of</strong> the pancreas. J Clin Gastroenterol 2005; 39: 915-919<br />

125 Stelow EB, Shaco-Levy R, Bao F, Garcia J, Klimstra DS. Pancreatic<br />

acinar cell carcinomas with prominent ductal differentiation:<br />

Mixed acinar ductal carcinoma and mixed acinar endocrine<br />

ductal carcinoma. Am J Surg Pathol 2010; 34: 510-518<br />

126 Caruso RA, Inferrera A, Tuccari G, Barresi G. Acinar cell carcinoma<br />

<strong>of</strong> the pancreas. A histologic, immunocytochemical<br />

and ultrastructural study. Histol Histopathol 1994; 9: 53-58<br />

127 Halder SL, McBeth J, Silman AJ, Thompson DG, Macfarlane<br />

GJ. Psychosocial risk factors for the onset <strong>of</strong> abdominal pain.<br />

Results from a large prospective population-based study. Int<br />

J Epidemiol 2002; 31: 1219-1225; discussion 1225-1226<br />

128 Fernandez E, Porta M, Malats N, Belloc J, Gallén M. Symptom-to-diagnosis<br />

interval and survival in <strong>cancer</strong>s <strong>of</strong> the digestive<br />

tract. Dig Dis Sci 2002; 47: 2434-2440<br />

129 Ridder GJ, Klempnauer J. Back pain in patients with ductal<br />

pancreatic <strong>cancer</strong>. Its impact on resectability and prognosis<br />

after resection. Scand J Gastroenterol 1995; 30: 1216-1220<br />

130 La Seta F, Cottone M, Marcenò MP, Maringhini A, Sciarrino<br />

E, Pagliaro L. [Echography in patients with clinically<br />

suspected pancreatic carcinoma. Analysis <strong>of</strong> a prospective<br />

study]. Radiol Med 1983; 69: 538-540<br />

131 Krech RL, Walsh D. Symptoms <strong>of</strong> pancreatic <strong>cancer</strong>. J Pain<br />

Symptom Manage 1991; 6: 360-367<br />

132 Permert J, Larsson J, Westermark GT, Herrington MK,<br />

Christmanson L, Pour PM, Westermark P, Adrian TE. Islet<br />

amyloid polypeptide in patients with pancreatic <strong>cancer</strong> and<br />

diabetes. N Engl J Med 1994; 330: 313-318<br />

133 Schwarts SS, Zeidler A, Moossa AR, Kuku SF, Rubenstein<br />

AH. A prospective study <strong>of</strong> glucose tolerance, insulin,<br />

C-peptide, and glucagon responses in patients with pancreatic<br />

carcinoma. Am J Dig Dis 1978; 23: 1107-1114<br />

134 Tarpila E, Borch K, Kullman E, Liedberg G. Pancreatic <strong>cancer</strong>.<br />

Ann Chir Gynaecol 1986; 75: 146-150<br />

135 Grahm AL, Andrén-Sandberg A. Prospective evaluation <strong>of</strong><br />

pain in exocrine pancreatic <strong>cancer</strong>. Digestion 1997; 58: 542-549<br />

136 Nicolson GL. Cancer metastasis. Organ colonization and<br />

the cell-surface properties <strong>of</strong> malignant cells. Biochim Biophys<br />

Acta 1982; 695: 113-176<br />

137 Hakomori S. Aberrant glycosylation in tumors and tumorassociated<br />

carbohydrate antigens. Adv Cancer Res 1989; 52:<br />

257-331<br />

138 Kleene R, Berger EG. The molecular and cell biology <strong>of</strong> glycosyltransferases.<br />

Biochim Biophys Acta 1993; 1154: 283-325<br />

139 Magnani JL, Nilsson B, Brockhaus M, Zopf D, Steplewski Z,<br />

Koprowski H, Ginsburg V. A monoclonal antibody-defined<br />

antigen associated with gastrointestinal <strong>cancer</strong> is a ganglioside<br />

containing sialylated lacto-N-fucopentaose II. J Biol<br />

Chem 1982; 257: 14365-14369<br />

140 Tanaka N, Okada S, Ueno H, Okusaka T, Ikeda M. The usefulness<br />

<strong>of</strong> serial changes in serum CA19-9 levels in the diagnosis<br />

<strong>of</strong> pancreatic <strong>cancer</strong>. Pancreas 2000; 20: 378-381<br />

141 Boeck S, Stieber P, Holdenrieder S, Wilkowski R, Heinemann<br />

V. Prognostic and therapeutic significance <strong>of</strong> carbohydrate<br />

antigen 19-9 as tumor marker in patients with pancreatic<br />

<strong>cancer</strong>. Oncology 2006; 70: 255-264<br />

142 Ni XG, Bai XF, Mao YL, Shao YF, Wu JX, Shan Y, Wang CF,<br />

Wang J, Tian YT, Liu Q, Xu DK, Zhao P. The clinical value <strong>of</strong><br />

serum CEA, CA19-9, and CA242 in the diagnosis and prognosis<br />

<strong>of</strong> pancreatic <strong>cancer</strong>. Eur J Surg Oncol 2005; 31: 164-169<br />

143 Steinberg W. The clinical utility <strong>of</strong> the CA 19-9 tumor-associated<br />

antigen. Am J Gastroenterol 1990; 85: 350-355<br />

144 Safi F, Schlosser W, Kolb G, Beger HG. Diagnostic value <strong>of</strong><br />

CA 19-9 in patients with pancreatic <strong>cancer</strong> and nonspecific<br />

889 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

gastrointestinal symptoms. J Gastrointest Surg 1997; 1: 106-112<br />

145 Goonetilleke KS, Siriwardena AK. Systematic review <strong>of</strong><br />

carbohydrate antigen (CA 19-9) as a biochemical marker in<br />

the diagnosis <strong>of</strong> pancreatic <strong>cancer</strong>. Eur J Surg Oncol 2007; 33:<br />

266-270<br />

146 Lundin J, Roberts PJ, Kuusela P, Haglund C. The prognostic<br />

value <strong>of</strong> preoperative serum levels <strong>of</strong> CA 19-9 and CEA in<br />

patients with pancreatic <strong>cancer</strong>. Br J Cancer 1994; 69: 515-519<br />

147 Sperti C, Pasquali C, Catalini S, Cappellazzo F, Bonadimani B,<br />

Behboo R, Pedrazzoli S. CA 19-9 as a prognostic index after<br />

resection for pancreatic <strong>cancer</strong>. J Surg Oncol 1993; 52: 137-141<br />

148 Glenn J, Steinberg WM, Kurtzman SH, Steinberg SM, Sindelar<br />

WF. Evaluation <strong>of</strong> the utility <strong>of</strong> a radioimmunoassay for<br />

serum CA 19-9 levels in patients before and after treatment<br />

<strong>of</strong> carcinoma <strong>of</strong> the pancreas. J Clin Oncol 1988; 6: 462-468<br />

149 Safi F, Schlosser W, Falkenreck S, Beger HG. Prognostic<br />

value <strong>of</strong> CA 19-9 serum course in pancreatic <strong>cancer</strong>. Hepatogastroenterology<br />

1998; 45: 253-259<br />

150 Tian F, Appert HE, Myles J, Howard JM. Prognostic value<br />

<strong>of</strong> serum CA 19-9 levels in pancreatic adenocarcinoma. Ann<br />

Surg 1992; 215: 350-355<br />

151 Basso D, Fabris C, Del Favero G, Angonese C, Meggiato T,<br />

Infantino A, Plebani M, Piccoli A, Leandro G, Burlina A. Serum<br />

carcinoembryonic antigen in the differential diagnosis<br />

<strong>of</strong> pancreatic <strong>cancer</strong>: influence <strong>of</strong> tumour spread, liver impairment,<br />

and age. Dis Markers 1988; 6: 203-207<br />

152 Chevinsky AH. CEA in tumors <strong>of</strong> other than colo<strong>rectal</strong> origin.<br />

Semin Surg Oncol 1991; 7: 162-166<br />

153 Ona FV, Zamcheck N, Dhar P, Moore T, Kupchik HZ. Carcinoembryonic<br />

antigen (CEA) in the diagnosis <strong>of</strong> pancreatic<br />

<strong>cancer</strong>. Cancer 1973; 31: 324-327<br />

154 Futakawa N, Kimura W, Yamagata S, Zhao B, Ilsoo H, Inoue<br />

T, Sata N, Kawaguchi Y, Kubota Y, Muto T. Significance <strong>of</strong><br />

K-ras mutation and CEA level in pancreatic juice in the diagnosis<br />

<strong>of</strong> pancreatic <strong>cancer</strong>. J Hepatobiliary Pancreat Surg 2000;<br />

7: 63-71<br />

155 Ozkan H, Kaya M, Cengiz A. Comparison <strong>of</strong> tumor marker<br />

CA 242 with CA 19-9 and carcinoembryonic antigen (CEA) in<br />

pancreatic <strong>cancer</strong>. Hepatogastroenterology 2003; 50: 1669-1674<br />

156 Gattani AM, Mandeli J, Bruckner HW. Tumor markers in<br />

patients with pancreatic carcinoma. Cancer 1996; 78: 57-62<br />

157 Pasanen PA, Eskelinen M, Partanen K, Pikkarainen P, Penttilä<br />

I, Alhava E. A prospective study <strong>of</strong> serum tumour markers<br />

carcinoembryonic antigen, carbohydrate antigens 50<br />

and 242, tissue polypeptide antigen and tissue polypeptide<br />

specific antigen in the diagnosis <strong>of</strong> pancreatic <strong>cancer</strong> with<br />

special reference to multivariate diagnostic score. Br J Cancer<br />

1994; 69: 562-565<br />

158 Jiang XT, Tao HQ, Zou SC. Detection <strong>of</strong> serum tumor markers<br />

in the diagnosis and treatment <strong>of</strong> patients with pancreatic<br />

<strong>cancer</strong>. Hepatobiliary Pancreat Dis Int 2004; 3: 464-468<br />

159 Lindholm L, Johansson C, Jansson EL, Hallberg C, Nilsson O.<br />

An immunoradiometric assay (IRMA) for the CA 50 antigen.<br />

In: Holmgren J, editor. Tumor Maker Antigens. Lund: Studentlitteratur,<br />

1985: 122-133<br />

160 Nilsson O, Johansson C, Glimelius B, Persson B, Nørgaard-<br />

Pedersen B, Andrén-Sandberg A, Lindholm L. Sensitivity and<br />

specificity <strong>of</strong> CA242 in gastro-intestinal <strong>cancer</strong>. A comparison<br />

with CEA, CA50 and CA 19-9. Br J Cancer 1992; 65: 215-221<br />

161 Lundin J, Roberts PJ, Kuusela P, Haglund C. Prognostic significance<br />

<strong>of</strong> serum CA 242 in pancreatic <strong>cancer</strong>. A comparison<br />

with CA 19-9. Anti<strong>cancer</strong> Res 1995; 15: 2181-2186<br />

162 Mu DQ, Wang GF, Peng SY. p53 protein expression and<br />

CA19.9 values in differential cytological diagnosis <strong>of</strong> pancreatic<br />

<strong>cancer</strong> complicated with chronic pancreatitis and chronic<br />

pancreatitis. <strong>World</strong> J Gastroenterol 2003; 9: 1815-1818<br />

163 Ma ZH, Wang Z. An evaluation <strong>of</strong> the diagnostic value <strong>of</strong><br />

CA 19-9 and CEA levels in patients with pancreatic <strong>cancer</strong>.<br />

Nanjing Yike Daxue Xuebao 2009; 23: 199-202<br />

164 Röthlin MA, Joller H, Largiadèr F. CA 242 is a new tumor<br />

marker for pancreatic <strong>cancer</strong>. Cancer 1993; 71: 701-707<br />

WJG|www.wjgnet.com<br />

165 Carpelan-Holmström M, Louhimo J, Stenman UH, Alfthan<br />

H, Haglund C. CEA, CA 19-9 and CA 72-4 improve the diagnostic<br />

accuracy in gastrointestinal <strong>cancer</strong>s. Anti<strong>cancer</strong> Res<br />

2002; 22: 2311-2316<br />

166 Pålsson B, Masson P, Andrén-Sandberg A. The influence <strong>of</strong><br />

cholestasis on CA 50 and CA 242 in pancreatic <strong>cancer</strong> and<br />

benign biliopancreatic diseases. Scand J Gastroenterol 1993; 28:<br />

981-987<br />

167 Hall NR, Finan PJ, Stephenson BM, Purves DA, Cooper EH.<br />

The role <strong>of</strong> CA-242 and CEA in surveillance following curative<br />

resection for colo<strong>rectal</strong> <strong>cancer</strong>. Br J Cancer 1994; 70: 549-553<br />

168 Friess H, Büchler M, Auerbach B, Weber A, Malfertheiner P,<br />

Hammer K, Madry N, Greiner S, Bosslet K, Beger HG. CA<br />

494--a new tumor marker for the diagnosis <strong>of</strong> pancreatic <strong>cancer</strong>.<br />

Int J Cancer 1993; 53: 759-763<br />

169 Simeone DM, Ji B, Banerjee M, Arumugam T, Li D, Anderson<br />

MA, Bamberger AM, Greenson J, Brand RE, Ramachandran<br />

V, Logsdon CD. CEACAM1, a novel serum biomarker<br />

for pancreatic <strong>cancer</strong>. Pancreas 2007; 34: 436-443<br />

170 Bouvet M, Nardin SR, Burton DW, Lee NC, Yang M, Wang X,<br />

Baranov E, Behling C, Moossa AR, H<strong>of</strong>fman RM, Deftos LJ.<br />

Parathyroid hormone-related protein as a novel tumor marker<br />

in pancreatic adenocarcinoma. Pancreas 2002; 24: 284-290<br />

171 Kumar Y, Gurusamy K, Pamecha V, Davidson BR. Tumor<br />

M2-pyruvate kinase as tumor marker in exocrine pancreatic<br />

<strong>cancer</strong> a meta-analysis. Pancreas 2007; 35: 114-119<br />

172 Gansauge F, Gansauge S, Parker N, Beger MI, Poch B, Link<br />

KH, Safi F, Beger HG. CAM 17.1--a new diagnostic marker<br />

in pancreatic <strong>cancer</strong>. Br J Cancer 1996; 74: 1997-2002<br />

173 Louhimo J, Alfthan H, Stenman UH, Haglund C. Serum<br />

HCG beta and CA 72-4 are stronger prognostic factors than<br />

CEA, CA 19-9 and CA 242 in pancreatic <strong>cancer</strong>. Oncology<br />

2004; 66: 126-131<br />

174 Tamm EP, Silverman PM, Charnsangavej C, Evans DB. Diagnosis,<br />

staging, and surveillance <strong>of</strong> pancreatic <strong>cancer</strong>. AJR<br />

Am J Roentgenol 2003; 180: 1311-1323<br />

175 Gandolfi L, Torresan F, Solmi L, Puccetti A. The role <strong>of</strong> ultrasound<br />

in biliary and pancreatic diseases. Eur J Ultrasound<br />

2003; 16: 141-159<br />

176 Giovannini M, Seitz JF. Endoscopic ultrasonography with<br />

a linear-type echoendoscope in the evaluation <strong>of</strong> 94 patients<br />

with pancreatobiliary disease. Endoscopy 1994; 26: 579-585<br />

177 Böttger TC, Boddin J, Düber C, Heintz A, Küchle R, Junginger<br />

T. Diagnosing and staging <strong>of</strong> pancreatic carcinoma-what<br />

is necessary? Oncology 1998; 55: 122-129<br />

178 Rösch T, Lorenz R, Braig C, Feuerbach S, Siewert JR, Schusdziarra<br />

V, Classen M. Endoscopic ultrasound in pancreatic<br />

tumor diagnosis. Gastrointest Endosc 1991; 37: 347-352<br />

179 Niederau C, Grendell JH. Diagnosis <strong>of</strong> pancreatic carcinoma.<br />

Imaging techniques and tumor markers. Pancreas 1992; 7:<br />

66-86<br />

180 Palazzo L, Roseau G, Gayet B, Vilgrain V, Belghiti J, Fékéte<br />

F, Paolaggi JA. Endoscopic ultrasonography in the diagnosis<br />

and staging <strong>of</strong> pancreatic adenocarcinoma. Results <strong>of</strong> a prospective<br />

study with comparison to ultrasonography and CT<br />

scan. Endoscopy 1993; 25: 143-150<br />

181 Karlson BM, Ekbom A, Lindgren PG, Källskog V, Rastad J.<br />

Abdominal US for diagnosis <strong>of</strong> pancreatic tumor: prospective<br />

cohort analysis. Radiology 1999; 213: 107-111<br />

182 Shapiro RS, Wagreich J, Parsons RB, Stancato-Pasik A, Yeh<br />

HC, Lao R. Tissue harmonic imaging sonography: evaluation<br />

<strong>of</strong> image quality compared with conventional sonography.<br />

AJR Am J Roentgenol 1998; 171: 1203-1206<br />

183 Baarir N, Amouyal G, Faintuch JM, Houry S, Huguier M.<br />

[Comparison <strong>of</strong> color Doppler ultrasonography and endoscopic<br />

ultrasonography for preoperative evaluation <strong>of</strong> the<br />

mesenteric-portal axis in pancreatic lesions]. Chirurgie 1998;<br />

123: 445-449<br />

184 Casadei R, Ghigi G, Gullo L, Moretti CC, Greco VM, Salizzoni<br />

E, Canini R, Marrano D. Role <strong>of</strong> color Doppler ultrasonography<br />

in the preoperative staging <strong>of</strong> pancreatic <strong>cancer</strong>.<br />

890 February 21, 2011|Volume 17|Issue 7|

---

Pancreas 1998; 16: 26-30<br />

185 Dietrich CF, Braden B, Hocke M, Ott M, Ignee A. Improved<br />

characterisation <strong>of</strong> solitary solid pancreatic tumours using<br />

contrast enhanced transabdominal ultrasound. J Cancer Res<br />

Clin Oncol 2008; 134: 635-643<br />

186 Sørensen MB, Weibull AS, Haubek A, Rokkjaer M, Jørgensen<br />

J. [Resectability <strong>of</strong> papillary and pancreatic <strong>cancer</strong><br />

assessed by ultrasonography and computer tomography].<br />

Ugeskr Laeger 1997; 159: 743-747<br />

187 Sahani DV, Shah ZK, Catalano OA, Boland GW, Brugge<br />

WR. Radiology <strong>of</strong> pancreatic adenocarcinoma: current status<br />

<strong>of</strong> imaging. J Gastroenterol Hepatol 2008; 23: 23-33<br />

188 DeWitt J, Devereaux B, Chriswell M, McGreevy K, Howard<br />

T, Imperiale TF, Ciaccia D, Lane KA, Maglinte D, Kopecky K,<br />

LeBlanc J, McHenry L, Madura J, Aisen A, Cramer H, Cummings<br />

O, Sherman S. Comparison <strong>of</strong> endoscopic ultrasonography<br />

and multidetector computed tomography for detecting<br />

and staging pancreatic <strong>cancer</strong>. Ann Intern Med 2004; 141:<br />

753-763<br />

189 Klapman JB, Chang KJ, Lee JG, Nguyen P. Negative predictive<br />

value <strong>of</strong> endoscopic ultrasound in a large series <strong>of</strong><br />

patients with a clinical suspicion <strong>of</strong> pancreatic <strong>cancer</strong>. Am J<br />

Gastroenterol 2005; 100: 2658-2661<br />

190 Brugge WR, Lee MJ, Kelsey PB, Schapiro RH, Warshaw AL.<br />

The use <strong>of</strong> EUS to diagnose malignant portal venous system<br />

invasion by pancreatic <strong>cancer</strong>. Gastrointest Endosc 1996; 43:<br />

561-567<br />

191 Faigel DO, Kochman ML. The role <strong>of</strong> endoscopic ultrasound<br />

in the preoperative staging <strong>of</strong> pancreatic malignancies. Gastrointest<br />

Endosc 1996; 43: 626-628<br />

192 Aslanian H, Salem R, Lee J, Andersen D, Robert M, Topazian<br />

M. EUS diagnosis <strong>of</strong> vascular invasion in pancreatic<br />

<strong>cancer</strong>: surgical and histologic correlates. Am J Gastroenterol<br />

2005; 100: 1381-1385<br />

193 Dietrich CF, Ignee A, Braden B, Barreiros AP, Ott M, Hocke<br />

M. Improved differentiation <strong>of</strong> pancreatic tumors using<br />

contrast-enhanced endoscopic ultrasound. Clin Gastroenterol<br />

Hepatol 2008; 6: 590-597.e1<br />

194 Eloubeidi MA, Tamhane A, Varadarajulu S, Wilcox CM.<br />

Frequency <strong>of</strong> major complications after EUS-guided FNA <strong>of</strong><br />

solid pancreatic masses: a prospective evaluation. Gastrointest<br />

Endosc 2006; 63: 622-629<br />

195 Choi BI, Chung MJ, Han JK, Han MC, Yoon YB. Detection <strong>of</strong><br />

pancreatic adenocarcinoma: relative value <strong>of</strong> arterial and late<br />

phases <strong>of</strong> spiral CT. Abdom Imaging 1997; 22: 199-203<br />

196 Bronstein YL, Loyer EM, Kaur H, Choi H, David C, DuBrow<br />

RA, Broemeling LD, Cleary KR, Charnsangavej C. Detection<br />

<strong>of</strong> small pancreatic tumors with multiphasic helical CT. AJR<br />

Am J Roentgenol 2004; 182: 619-623<br />

197 Megibow AJ, Zhou XH, Rotterdam H, Francis IR, Zerhouni<br />

EA, Balfe DM, Weinreb JC, Aisen A, Kuhlman J, Heiken JP.<br />

Pancreatic adenocarcinoma: CT versus MR imaging in the<br />

evaluation <strong>of</strong> resectability--report <strong>of</strong> the Radiology Diagnostic<br />

Oncology Group. Radiology 1995; 195: 327-332<br />

198 Gangi S, Fletcher JG, Nathan MA, Christensen JA, Harmsen<br />

WS, Crownhart BS, Chari ST. Time interval between abnormalities<br />

seen on CT and the clinical diagnosis <strong>of</strong> pancreatic<br />

<strong>cancer</strong>: retrospective review <strong>of</strong> CT scans obtained before<br />

diagnosis. AJR Am J Roentgenol 2004; 182: 897-903<br />

199 Ohwada S, Ogawa T, Tanahashi Y, Nakamura S, Takeyoshi I,<br />

Ohya T, Ikeya T, Kawashima K, Kawashima Y, Morishita Y.<br />

Fibrin glue sandwich prevents pancreatic fistula following<br />

distal pancreatectomy. <strong>World</strong> J Surg 1998; 22: 494-498<br />

200 Baum U, Lell M, Nömayr A, Wolf H, Brunner T, Greess H,<br />

Bautz W. [Multiplanar spiral CT in the diagnosis <strong>of</strong> pancreatic<br />

tumors]. Radiologe 1999; 39: 958-964<br />

201 Fletcher JG, Wiersema MJ, Farrell MA, Fidler JL, Burgart LJ,<br />

Koyama T, Johnson CD, Stephens DH, Ward EM, Harmsen<br />

WS. Pancreatic malignancy: value <strong>of</strong> arterial, pancreatic, and<br />

hepatic phase imaging with multi-detector row CT. Radiology<br />

2003; 229: 81-90<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

202 Vargas R, Nino-Murcia M, Trueblood W, Jeffrey RB Jr.<br />

MDCT in Pancreatic adenocarcinoma: prediction <strong>of</strong> vascular<br />

invasion and resectability using a multiphasic technique<br />

with curved planar reformations. AJR Am J Roentgenol 2004;<br />

182: 419-425<br />

203 Diehl SJ, Lehmann KJ, Sadick M, Lachmann R, Georgi M.<br />

Pancreatic <strong>cancer</strong>: value <strong>of</strong> dual-phase helical CT in assessing<br />

resectability. Radiology 1998; 206: 373-378<br />

204 Lu DS, Reber HA, Krasny RM, Kadell BM, Sayre J. Local<br />

staging <strong>of</strong> pancreatic <strong>cancer</strong>: criteria for unresectability <strong>of</strong><br />

major vessels as revealed by pancreatic-phase, thin-section<br />

helical CT. AJR Am J Roentgenol 1997; 168: 1439-1443<br />

205 Ahn SS, Kim MJ, Choi JY, Hong HS, Chung YE, Lim JS. Indicative<br />

findings <strong>of</strong> pancreatic <strong>cancer</strong> in prediagnostic CT.<br />

Eur Radiol 2009; 19: 2448-2455<br />

206 Johnson PT, Outwater EK. Pancreatic carcinoma versus<br />

chronic pancreatitis: dynamic MR imaging. Radiology 1999;<br />

212: 213-218<br />

207 Bluemke DA, Cameron JL, Hruban RH, Pitt HA, Siegelman<br />

SS, Soyer P, Fishman EK. Potentially resectable pancreatic<br />

adenocarcinoma: spiral CT assessment with surgical and<br />

pathologic correlation. Radiology 1995; 197: 381-385<br />

208 Schima W, Függer R, Schober E, Oettl C, Wamser P, Grabenwöger<br />

F, Ryan JM, Novacek G. Diagnosis and staging <strong>of</strong><br />

pancreatic <strong>cancer</strong>: comparison <strong>of</strong> mangafodipir trisodiumenhanced<br />

MR imaging and contrast-enhanced helical hydro-<br />

CT. AJR Am J Roentgenol 2002; 179: 717-724<br />

209 Ichikawa T, Haradome H, Hachiya J, Nitatori T, Ohtomo<br />

K, Kinoshita T, Araki T. Pancreatic ductal adenocarcinoma:<br />

preoperative assessment with helical CT versus dynamic MR<br />

imaging. Radiology 1997; 202: 655-662<br />

210 Irie H, Honda H, Kaneko K, Kuroiwa T, Yoshimitsu K, Masuda<br />

K. Comparison <strong>of</strong> helical CT and MR imaging in detecting<br />

and staging small pancreatic adenocarcinoma. Abdom<br />

Imaging 1997; 22: 429-433<br />

211 Romijn MG, Stoker J, van Eijck CH, van Muiswinkel JM,<br />

Torres CG, Laméris JS. MRI with mangafodipir trisodium in<br />

the detection and staging <strong>of</strong> pancreatic <strong>cancer</strong>. J Magn Reson<br />

Imaging 2000; 12: 261-268<br />

212 Andersson M, Kostic S, Johansson M, Lundell L, Asztély M,<br />

Hellström M. MRI combined with MR cholangiopancreatography<br />

versus helical CT in the evaluation <strong>of</strong> patients with<br />

suspected periampullary tumors: a prospective comparative<br />

study. Acta Radiol 2005; 46: 16-27<br />

213 Hänninen EL, Ricke J, Amthauer H, Röttgen R, Böhmig M,<br />

Langrehr J, Pech M, Denecke T, Rosewicz S, Felix R. Magnetic<br />

resonance cholangiopancreatography: image quality,<br />

ductal morphology, and value <strong>of</strong> additional T2- and T1weighted<br />

sequences for the assessment <strong>of</strong> suspected pancreatic<br />

<strong>cancer</strong>. Acta Radiol 2005; 46: 117-125<br />

214 Park HS, Lee JM, Choi HK, Hong SH, Han JK, Choi BI. Preoperative<br />

evaluation <strong>of</strong> pancreatic <strong>cancer</strong>: comparison <strong>of</strong><br />

gadolinium-enhanced dynamic MRI with MR cholangiopancreatography<br />

versus MDCT. J Magn Reson Imaging 2009; 30:<br />

586-595<br />

215 Grenacher L, Klauss M, Dukic L, Delorme S, Knaebel HP,<br />

Düx M, Kauczor HU, Büchler MW, Kauffmann GW, Richter<br />

GM. [Diagnosis and staging <strong>of</strong> pancreatic carcinoma: MRI<br />

versus multislice-CT -- a prospective study]. R<strong>of</strong>o 2004; 176:<br />

1624-1633<br />

216 Bipat S, Phoa SS, van Delden OM, Bossuyt PM, Gouma DJ,<br />

Laméris JS, Stoker J. Ultrasonography, computed tomography<br />

and magnetic resonance imaging for diagnosis and<br />

determining resectability <strong>of</strong> pancreatic adenocarcinoma: a<br />

meta-analysis. J Comput Assist Tomogr 2005; 29: 438-445<br />

217 Maemura K, Takao S, Shinchi H, Noma H, Mataki Y, Kurahara<br />

H, Jinnouchi S, Aikou T. Role <strong>of</strong> positron emission tomography<br />

in decisions on treatment strategies for pancreatic<br />

<strong>cancer</strong>. J Hepatobiliary Pancreat Surg 2006; 13: 435-441<br />

218 Higashi T, Saga T, Nakamoto Y, Ishimori T, Fujimoto K, Doi<br />

R, Imamura M, Konishi J. Diagnosis <strong>of</strong> pancreatic <strong>cancer</strong><br />

891 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

using fluorine-18 fluorodeoxyglucose positron emission tomography<br />

(FDG PET) --usefulness and limitations in "clinical<br />

reality". Ann Nucl Med 2003; 17: 261-279<br />

219 Wakabayashi H, Nishiyama Y, Otani T, Sano T, Yachida S,<br />

Okano K, Izuishi K, Suzuki Y. Role <strong>of</strong> 18F-fluorodeoxyglucose<br />

positron emission tomography imaging in surgery for<br />

pancreatic <strong>cancer</strong>. <strong>World</strong> J Gastroenterol 2008; 14: 64-69<br />

220 Schima W, Függer R. Evaluation <strong>of</strong> focal pancreatic masses:<br />

comparison <strong>of</strong> mangafodipir-enhanced MR imaging and<br />

contrast-enhanced helical CT. Eur Radiol 2002; 12: 2998-3008<br />

221 Delbeke D, Rose DM, Chapman WC, Pinson CW, Wright<br />

JK, Beauchamp RD, Shyr Y, Leach SD. Optimal interpretation<br />

<strong>of</strong> FDG PET in the diagnosis, staging and management<br />

<strong>of</strong> pancreatic carcinoma. J Nucl Med 1999; 40: 1784-1791<br />

222 Heinrich S, Goerres GW, Schäfer M, Sagmeister M, Bauerfeind<br />

P, Pestalozzi BC, Hany TF, von Schulthess GK, Clavien<br />

PA. Positron emission tomography/computed tomography<br />

influences on the management <strong>of</strong> resectable pancreatic <strong>cancer</strong><br />

and its cost-effectiveness. Ann Surg 2005; 242: 235-243<br />

223 Lee TY, Kim MH, Park do H, Seo DW, Lee SK, Kim JS, Lee<br />

KT. Utility <strong>of</strong> 18F-FDG PET/CT for differentiation <strong>of</strong> autoimmune<br />

pancreatitis with atypical pancreatic imaging findings<br />

from pancreatic <strong>cancer</strong>. AJR Am J Roentgenol 2009; 193:<br />

343-348<br />

224 Zhao C, Chen Z, Ye X, Zhang Y, Zhan H, Aburano T, Tian M,<br />

Zhang H. Imaging a pancreatic carcinoma xenograft model<br />

with 11C-acetate: a comparison study with 18F-FDG. Nucl<br />

Med Commun 2009; 30: 971-977<br />

225 Nakata B, Nishimura S, Ishikawa T, Ohira M, Nishino H,<br />

Kawabe J, Ochi H, Hirakawa K. Prognostic predictive value<br />

<strong>of</strong> 18F-fluorodeoxyglucose positron emission tomography<br />

for patients with pancreatic <strong>cancer</strong>. Int J Oncol 2001; 19: 53-58<br />

226 Yoshioka M, Sato T, Furuya T, Shibata S, Andoh H, Asanuma<br />

Y, Hatazawa J, Shimosegawa E, Koyama K, Yamamoto<br />

Y. Role <strong>of</strong> positron emission tomography with 2-deoxy-<br />

2-[18F]fluoro-D-glucose in evaluating the effects <strong>of</strong> arterial<br />

infusion chemotherapy and radiotherapy on pancreatic <strong>cancer</strong>.<br />

J Gastroenterol 2004; 39: 50-55<br />

227 Klever P, Bares R, Fass J, Büll U, Schumpelick V. PET with<br />

fluorine-18 deoxyglucose for pancreatic disease. Lancet 1992;<br />

340: 1158-1159<br />

228 Nakamoto Y, Higashi T, Sakahara H, Tamaki N, Kogire M,<br />

Imamura M, Konishi J. Contribution <strong>of</strong> PET in the detection<br />

<strong>of</strong> liver metastases from pancreatic tumours. Clin Radiol<br />

1999; 54: 248-252<br />

229 Berberat P, Friess H, Kashiwagi M, Beger HG, Büchler MW.<br />

Diagnosis and staging <strong>of</strong> pancreatic <strong>cancer</strong> by positron emission<br />

tomography. <strong>World</strong> J Surg 1999; 23: 882-887<br />

230 Zimny M, Fass J, Bares R, Cremerius U, Sabri O, Buechin P,<br />

Schumpelick V, Buell U. Fluorodeoxyglucose positron emission<br />

tomography and the prognosis <strong>of</strong> pancreatic carcinoma.<br />

Scand J Gastroenterol 2000; 35: 883-888<br />

231 Tanaka S, Kitamra T, Yamamoto K, Fujikawa S, Imaoka T,<br />

Nishikawa S, Nakaizumi A, Uehara H, Ishikawa O, Ohigashi<br />

H. Evaluation <strong>of</strong> routine sonography for early detection <strong>of</strong><br />

pancreatic <strong>cancer</strong>. Jpn J Clin Oncol 1996; 26: 422-427<br />

232 Candiani F, Meduri F, Norberto L, Calderone M. [Contrast<br />

media in ultrasonography. Venous involvement in tumors <strong>of</strong><br />

the head <strong>of</strong> the pancreas]. Radiol Med 1998; 95: 29-33<br />

233 Calculli L, Casadei R, Amore B, Albini Riccioli L, Minni F,<br />

Caputo M, Marrano D, Gavelli G. The usefulness <strong>of</strong> spiral<br />

Computed Tomography and colour-Doppler ultrasonography<br />

to predict portal-mesenteric trunk involvement in pancreatic<br />

<strong>cancer</strong>. Radiol Med 2002; 104: 307-315<br />

234 Akahoshi K, Chijiiwa Y, Nakano I, Nawata H, Ogawa Y,<br />

Tanaka M, Nagai E, Tsuneyoshi M. Diagnosis and staging <strong>of</strong><br />

pancreatic <strong>cancer</strong> by endoscopic ultrasound. Br J Radiol 1998;<br />

71: 492-496<br />

235 Legmann P, Vignaux O, Dousset B, Baraza AJ, Palazzo L,<br />

Dumontier I, Coste J, Louvel A, Roseau G, Couturier D, Bonnin<br />

A. Pancreatic tumors: comparison <strong>of</strong> dual-phase helical<br />

WJG|www.wjgnet.com<br />

CT and endoscopic sonography. AJR Am J Roentgenol 1998;<br />

170: 1315-1322<br />

236 Bilimoria KY, Bentrem DJ, Ko CY, Ritchey J, Stewart AK,<br />

Winchester DP, Talamonti MS. Validation <strong>of</strong> the 6th edition<br />

AJCC Pancreatic Cancer Staging System: report from the National<br />

Cancer Database. Cancer 2007; 110: 738-744<br />

237 AJCC Cancer Staging Handbook. 7th edition. New York:<br />

Springer-Verlag, 2010<br />

238 Warshaw AL, Fernández-del Castillo C. Pancreatic carcinoma.<br />

N Engl J Med 1992; 326: 455-465<br />

239 Soriano A, Castells A, Ayuso C, Ayuso JR, de Caralt MT, Ginès<br />

MA, Real MI, Gilabert R, Quintó L, Trilla A, Feu F, Montanyà<br />

X, Fernández-Cruz L, Navarro S. Preoperative staging<br />

and tumor resectability assessment <strong>of</strong> pancreatic <strong>cancer</strong>:<br />

prospective study comparing endoscopic ultrasonography,<br />

helical computed tomography, magnetic resonance imaging,<br />

and angiography. Am J Gastroenterol 2004; 99: 492-501<br />

240 Cuschieri A. Laparoscopy for pancreatic <strong>cancer</strong>: does it benefit<br />

the patient? Eur J Surg Oncol 1988; 14: 41-44<br />

241 Warshaw AL, Tepper JE, Shipley WU. Laparoscopy in the<br />

staging and planning <strong>of</strong> therapy for pancreatic <strong>cancer</strong>. Am J<br />

Surg 1986; 151: 76-80<br />

242 Warshaw AL, Gu ZY, Wittenberg J, Waltman AC. Preoperative<br />

staging and assessment <strong>of</strong> resectability <strong>of</strong> pancreatic<br />

<strong>cancer</strong>. Arch Surg 1990; 125: 230-233<br />

243 Camacho D, Reichenbach D, Duerr GD, Venema TL, Sweeney<br />

JF, Fisher WE. Value <strong>of</strong> laparoscopy in the staging <strong>of</strong><br />

pancreatic <strong>cancer</strong>. JOP 2005; 6: 552-561<br />

244 Ellsmere J, Mortele K, Sahani D, Maher M, Cantisani V,<br />

Wells W, Brooks D, Rattner D. Does multidetector-row CT<br />

eliminate the role <strong>of</strong> diagnostic laparoscopy in assessing the<br />

resectability <strong>of</strong> pancreatic head adenocarcinoma? Surg Endosc<br />

2005; 19: 369-373<br />

245 Morganti AG, Brizi MG, Macchia G, Sallustio G, Costamagna<br />

G, Alfieri S, Mattiucci GC, Valentini V, Natale L, Deodato<br />

F, Mutignani M, Doglietto GB, Cellini N. The prognostic<br />

effect <strong>of</strong> clinical staging in pancreatic adenocarcinoma. Ann<br />

Surg Oncol 2005; 12: 145-151<br />

246 Nieveen van Dijkum EJ, Romijn MG, Terwee CB, de Wit<br />

LT, van der Meulen JH, Lameris HS, Rauws EA, Obertop H,<br />

van Eyck CH, Bossuyt PM, Gouma DJ. Laparoscopic staging<br />

and subsequent palliation in patients with peripancreatic<br />

carcinoma. Ann Surg 2003; 237: 66-73<br />

247 Conlon KC, Dougherty E, Klimstra DS, Coit DG, Turnbull<br />

AD, Brennan MF. The value <strong>of</strong> minimal access surgery in the<br />

staging <strong>of</strong> patients with potentially resectable peripancreatic<br />

malignancy. Ann Surg 1996; 223: 134-140<br />

248 Tilleman EH, Busch OR, Bemelman WA, van Gulik TM,<br />

Obertop H, Gouma DJ. Diagnostic laparoscopy in staging<br />

pancreatic carcinoma: developments during the past decade.<br />

J Hepatobiliary Pancreat Surg 2004; 11: 11-16<br />

249 Pisters PW, Lee JE, Vauthey JN, Charnsangavej C, Evans DB.<br />

Laparoscopy in the staging <strong>of</strong> pancreatic <strong>cancer</strong>. Br J Surg<br />

2001; 88: 325-337<br />

250 Kwon AH, Inui H, Kamiyama Y. Preoperative laparoscopic<br />

examination using surgical manipulation and ultrasonography<br />

for pancreatic lesions. Endoscopy 2002; 34: 464-468<br />

251 Catheline JM, Turner R, Rizk N, Barrat C, Champault G. The<br />

use <strong>of</strong> diagnostic laparoscopy supported by laparoscopic<br />

ultrasonography in the assessment <strong>of</strong> pancreatic <strong>cancer</strong>. Surg<br />

Endosc 1999; 13: 239-245<br />

252 White R, Winston C, Gonen M, D'Angelica M, Jarnagin W,<br />

Fong Y, Conlon K, Brennan M, Allen P. Current utility <strong>of</strong><br />

staging laparoscopy for pancreatic and peripancreatic neoplasms.<br />

J Am Coll Surg 2008; 206: 445-450<br />

253 National Comprehensive Cancer Network. Practice Guidelines<br />

for Pancreatic Cancer. Accessed on October 20, 2010<br />

254 Chang DK, Merrett ND, Biankin AV. Improving outcomes<br />

for operable pancreatic <strong>cancer</strong>: is access to safer surgery the<br />

problem? J Gastroenterol Hepatol 2008; 23: 1036-1045<br />

255 Freelove R, Walling AD. Pancreatic <strong>cancer</strong>: diagnosis and<br />

892 February 21, 2011|Volume 17|Issue 7|

---

management. Am Fam Physician 2006; 73: 485-492<br />

256 Büchler MW, Wagner M, Schmied BM, Uhl W, Friess H,<br />

Z'graggen K. Changes in morbidity after pancreatic resection:<br />

toward the end <strong>of</strong> completion pancreatectomy. Arch<br />

Surg 2003; 138: 1310-1314; discussion 1315<br />

257 Birkmeyer JD, Siewers AE, Finlayson EV, Stukel TA, Lucas<br />

FL, Batista I, Welch HG, Wennberg DE. Hospital volume and<br />

surgical mortality in the United States. N Engl J Med 2002;<br />

346: 1128-1137<br />

258 Cameron JL, Riall TS, Coleman J, Belcher KA. One thousand<br />

consecutive pancreaticoduodenectomies. Ann Surg 2006; 244:<br />

10-15<br />

259 The US National Cancer Institute. Surveillance Epidemiology<br />

and End Results (SEER) data base. 2007. Available from:<br />

URL: http://seer.<strong>cancer</strong>.gov/<br />

260 Zuckerman DS, Ryan DP. Adjuvant therapy for pancreatic<br />

<strong>cancer</strong>: a review. Cancer 2008; 112: 243-249<br />

261 Takhar AS, Palaniappan P, Dhingsa R, Lobo DN. Recent developments<br />

in diagnosis <strong>of</strong> pancreatic <strong>cancer</strong>. BMJ 2004; 329:<br />

668-673<br />

262 Li D, Xie K, Wolff R, Abbruzzese JL. Pancreatic <strong>cancer</strong>. Lancet<br />

2004; 363: 1049-1057<br />

263 Barugola G, Partelli S, Marcucci S, Sartori N, Capelli P, Bassi<br />

C, Pederzoli P, Falconi M. Resectable pancreatic <strong>cancer</strong>:<br />

who really benefits from resection? Ann Surg Oncol 2009; 16:<br />

3316-3322<br />

264 van der Gaag NA, Kloek JJ, de Castro SM, Busch OR, van<br />

Gulik TM, Gouma DJ. Preoperative biliary drainage in patients<br />

with obstructive jaundice: history and current status. J<br />

Gastrointest Surg 2009; 13: 814-820<br />

265 Klinkenbijl JH, Jeekel J, Schmitz PI, Rombout PA, Nix GA,<br />

Bruining HA, van Blankenstein M. Carcinoma <strong>of</strong> the pancreas<br />

and periampullary region: palliation versus cure. Br J<br />

Surg 1993; 80: 1575-1578<br />

266 Kimmings AN, van Deventer SJ, Obertop H, Rauws EA,<br />

Huibregtse K, Gouma DJ. Endotoxin, cytokines, and endotoxin<br />

binding proteins in obstructive jaundice and after preoperative<br />

biliary drainage. Gut 2000; 46: 725-731<br />

267 Jethwa P, Breuning E, Bhati C, Buckles J, Mirza D, Bramhall<br />

S. The microbiological impact <strong>of</strong> pre-operative biliary drainage<br />

on patients undergoing hepato-biliary-pancreatic (HPB)<br />

surgery. Aliment Pharmacol Ther 2007; 25: 1175-1180<br />

268 Limongelli P, Pai M, Bansi D, Thiallinagram A, Tait P,<br />

Jackson J, Habib NA, Williamson RC, Jiao LR. Correlation<br />

between preoperative biliary drainage, bile duct contamination,<br />

and postoperative outcomes for pancreatic surgery.<br />

Surgery 2007; 142: 313-318<br />

269 Coates JM, Beal SH, Russo JE, Vanderveen KA, Chen SL,<br />

Bold RJ, Canter RJ. Negligible effect <strong>of</strong> selective preoperative<br />

biliary drainage on perioperative resuscitation, morbidity,<br />

and mortality in patients undergoing pancreaticoduodenectomy.<br />

Arch Surg 2009; 144: 841-847<br />

270 Mezhir JJ, Brennan MF, Baser RE, D'Angelica MI, Fong Y,<br />

DeMatteo RP, Jarnagin WR, Allen PJ. A matched case-control<br />

study <strong>of</strong> preoperative biliary drainage in patients with<br />

pancreatic adenocarcinoma: routine drainage is not justified.<br />

J Gastrointest Surg 2009; 13: 2163-2169<br />

271 Wang Q, Gurusamy KS, Lin H, Xie X, Wang C. Preoperative<br />

biliary drainage for obstructive jaundice. Cochrane Database<br />

Syst Rev 2008; CD005444<br />

272 Sewnath ME, Karsten TM, Prins MH, Rauws EJ, Obertop H,<br />

Gouma DJ. A meta-analysis on the efficacy <strong>of</strong> preoperative<br />

biliary drainage for tumors causing obstructive jaundice.<br />

Ann Surg 2002; 236: 17-27<br />

273 van der Gaag NA, Rauws EA, van Eijck CH, Bruno MJ, van<br />

der Harst E, Kubben FJ, Gerritsen JJ, Greve JW, Gerhards<br />

MF, de Hingh IH, Klinkenbijl JH, Nio CY, de Castro SM,<br />

Busch OR, van Gulik TM, Bossuyt PM, Gouma DJ. Preoperative<br />

biliary drainage for <strong>cancer</strong> <strong>of</strong> the head <strong>of</strong> the pancreas. N<br />

Engl J Med 2010; 362: 129-137<br />

274 Landry J, Catalano PJ, Staley C, Harris W, H<strong>of</strong>fman J, Tal-<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

amonti M, Xu N, Cooper H, Benson AB 3rd. Randomized<br />

phase II study <strong>of</strong> gemcitabine plus radiotherapy versus gemcitabine,<br />

5-fluorouracil, and cisplatin followed by radiotherapy<br />

and 5-fluorouracil for patients with locally advanced, potentially<br />

resectable pancreatic adenocarcinoma. J Surg Oncol<br />

2010; 101: 587-592<br />

275 Lee S, Oh SY, Kim BG, Kwon HC, Kim SH, Rho MH, Kim<br />

YH, Rho MS, Jeong JS, Kim HJ. Second-line treatment with a<br />

combination <strong>of</strong> continuous 5-fluorouracil, doxorubicin, and<br />

mitomycin-C (conti-FAM) in gemcitabine-pretreated pancreatic<br />

and biliary tract <strong>cancer</strong>. Am J Clin Oncol 2009; 32: 348-352<br />

276 Le Scodan R, Mornex F, Girard N, Mercier C, Valette PJ,<br />

Ychou M, Bibeau F, Roy P, Scoazec JY, Partensky C. Preoperative<br />

chemoradiation in potentially resectable pancreatic<br />

adenocarcinoma: feasibility, treatment effect evaluation and<br />

prognostic factors, analysis <strong>of</strong> the SFRO-FFCD 9704 trial and<br />

literature review. Ann Oncol 2009; 20: 1387-1396<br />

277 Heinrich S, Schäfer M, Weber A, Hany TF, Bhure U,<br />

Pestalozzi BC, Clavien PA. Neoadjuvant chemotherapy generates<br />

a significant tumor response in resectable pancreatic<br />

<strong>cancer</strong> without increasing morbidity: results <strong>of</strong> a prospective<br />

phase II trial. Ann Surg 2008; 248: 1014-1022<br />

278 Marti JL, Hochster HS, Hiotis SP, Donahue B, Ryan T, Newman<br />

E. Phase I/II trial <strong>of</strong> induction chemotherapy followed<br />

by concurrent chemoradiotherapy and surgery for locoregionally<br />

advanced pancreatic <strong>cancer</strong>. Ann Surg Oncol 2008;<br />

15: 3521-3531<br />

279 Le Scodan R, Mornex F, Partensky C, Mercier C, Valette PJ,<br />

Ychou M, Roy P, Scoazec JY. Histopathological response to<br />

preoperative chemoradiation for resectable pancreatic adenocarcinoma:<br />

the French Phase II FFCD 9704-SFRO Trial.<br />

Am J Clin Oncol 2008; 31: 545-552<br />

280 Lind PA, Isaksson B, Almström M, Johnsson A, Albiin N,<br />

Byström P, Permert J. Efficacy <strong>of</strong> preoperative radiochemotherapy<br />

in patients with locally advanced pancreatic carcinoma.<br />

Acta Oncol 2008; 47: 413-420<br />

281 Evans DB, Varadhachary GR, Crane CH, Sun CC, Lee JE,<br />

Pisters PW, Vauthey JN, Wang H, Cleary KR, Staerkel GA,<br />

Charnsangavej C, Lano EA, Ho L, Lenzi R, Abbruzzese JL,<br />

Wolff RA. Preoperative gemcitabine-based chemoradiation<br />

for patients with resectable adenocarcinoma <strong>of</strong> the pancreatic<br />

head. J Clin Oncol 2008; 26: 3496-3502<br />

282 Varadhachary GR, Wolff RA, Crane CH, Sun CC, Lee JE, Pisters<br />

PW, Vauthey JN, Abdalla E, Wang H, Staerkel GA, Lee<br />

JH, Ross WA, Tamm EP, Bhosale PR, Krishnan S, Das P, Ho L,<br />

Xiong H, Abbruzzese JL, Evans DB. Preoperative gemcitabine<br />

and cisplatin followed by gemcitabine-based chemoradiation<br />

for resectable adenocarcinoma <strong>of</strong> the pancreatic head. J<br />

Clin Oncol 2008; 26: 3487-3495<br />

283 Heinrich S, Pestalozzi BC, Schäfer M, Weber A, Bauerfeind<br />

P, Knuth A, Clavien PA. Prospective phase II trial <strong>of</strong> neoadjuvant<br />

chemotherapy with gemcitabine and cisplatin for resectable<br />

adenocarcinoma <strong>of</strong> the pancreatic head. J Clin Oncol<br />

2008; 26: 2526-2531<br />

284 Boulay BR, Gardner TB, Gordon SR. Occlusion rate and<br />

complications <strong>of</strong> plastic biliary stent placement in patients<br />

undergoing neoadjuvant chemoradiotherapy for pancreatic<br />

<strong>cancer</strong> with malignant biliary obstruction. J Clin Gastroenterol<br />

2010; 44: 452-455<br />

285 Wasan SM, Ross WA, Staerkel GA, Lee JH. Use <strong>of</strong> expandable<br />

metallic biliary stents in resectable pancreatic <strong>cancer</strong>.<br />

Am J Gastroenterol 2005; 100: 2056-2061<br />

286 Kausch W. Das carcinom der papilla duodeni und seine radikale<br />

entfernung. Beitr Klin Chir 1912; 78: 439-451<br />

287 Whipple A. Present-day surgery <strong>of</strong> the pancreas. N Engl J<br />

Med 1942; 226: 515-518<br />

288 Trede M. Surgery <strong>of</strong> the pancreas. Edinburgh: Churchill Livingstone,<br />

1993<br />

289 Seiler CA, Wagner M, Sadowski C, Kulli C, Büchler MW.<br />

Randomized prospective trial <strong>of</strong> pylorus-preserving vs. Classic<br />

duodenopancreatectomy (Whipple procedure): initial<br />

893 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

clinical results. J Gastrointest Surg 2000; 4: 443-452<br />

290 Williamson RC, Bliouras N, Cooper MJ, Davies ER. Gastric<br />

emptying and enterogastric reflux after conservative and conventional<br />

pancreatoduodenectomy. Surgery 1993; 114: 82-86<br />

291 Watson K. Carcinoma <strong>of</strong> the ampulla <strong>of</strong> Vater. Successful<br />

radical resection. Br J Surg 1944; 31: 368<br />

292 Traverso LW, Longmire WP Jr. Preservation <strong>of</strong> the pylorus<br />

in pancreaticoduodenectomy. Surg Gynecol Obstet 1978; 146:<br />

959-962<br />

293 Loos M, Kleeff J, Friess H, Buchler MW. Surgical treatment<br />

<strong>of</strong> pancreatic <strong>cancer</strong>. Ann N Y Acad Sci 2008; 1138: 169-180<br />

294 Horstmann O, Markus PM, Ghadimi MB, Becker H. Pylorus<br />

preservation has no impact on delayed gastric emptying after<br />

pancreatic head resection. Pancreas 2004; 28: 69-74<br />

295 Wenger FA, Jacobi CA, Haubold K, Zieren HU, Müller<br />

JM. [Gastrointestinal quality <strong>of</strong> life after duodenopancreatectomy<br />

in pancreatic carcinoma. Preliminary results <strong>of</strong> a<br />

prospective randomized study: pancreatoduodenectomy or<br />

pylorus-preserving pancreatoduodenectomy]. Chirurg 1999;<br />

70: 1454-1459<br />

296 Park YC, Kim SW, Jang JY, Ahn YJ, Park YH. Factors influencing<br />

delayed gastric emptying after pylorus-preserving<br />

pancreatoduodenectomy. J Am Coll Surg 2003; 196: 859-865<br />

297 Roder JD, Stein HJ, Hüttl W, Siewert JR. Pylorus-preserving<br />

versus standard pancreatico-duodenectomy: an analysis <strong>of</strong><br />

110 pancreatic and periampullary carcinomas. Br J Surg 1992;<br />

79: 152-155<br />

298 Diener MK, Knaebel HP, Heukaufer C, Antes G, Büchler<br />

MW, Seiler CM. A systematic review and meta-analysis <strong>of</strong><br />

pylorus-preserving versus classical pancreaticoduodenectomy<br />

for surgical treatment <strong>of</strong> periampullary and pancreatic<br />

carcinoma. Ann Surg 2007; 245: 187-200<br />

299 Seiler CA, Wagner M, Bachmann T, Redaelli CA, Schmied<br />

B, Uhl W, Friess H, Büchler MW. Randomized clinical trial<br />

<strong>of</strong> pylorus-preserving duodenopancreatectomy versus classical<br />

Whipple resection-long term results. Br J Surg 2005; 92:<br />

547-556<br />

300 Lin PW, Shan YS, Lin YJ, Hung CJ. Pancreaticoduodenectomy<br />

for pancreatic head <strong>cancer</strong>: PPPD versus Whipple procedure.<br />

Hepatogastroenterology 2005; 52: 1601-1604<br />

301 Schmidt CM, Powell ES, Yiannoutsos CT, Howard TJ,<br />

Wiebke EA, Wiesenauer CA, Baumgardner JA, Cummings<br />

OW, Jacobson LE, Broadie TA, Canal DF, Goulet RJ Jr, Curie<br />

EA, Cardenes H, Watkins JM, Loehrer PJ, Lillemoe KD, Madura<br />

JA. Pancreaticoduodenectomy: a 20-year experience in<br />

516 patients. Arch Surg 2004; 139: 718-725; discussion 725-727<br />

302 Bassi C, Falconi M, Salvia R, Mascetta G, Molinari E, Pederzoli<br />

P. <strong>Management</strong> <strong>of</strong> complications after pancreaticoduodenectomy<br />

in a high volume centre: results on 150 consecutive<br />

patients. Dig Surg 2001; 18: 453-457; discussion 458<br />

303 Shrikhande SV, D'Souza MA. Pancreatic fistula after pancreatectomy:<br />

evolving definitions, preventive strategies and modern<br />

management. <strong>World</strong> J Gastroenterol 2008; 14: 5789-5796<br />

304 Dixon E, Fingerhut A, Bassi C, Sutherland F, McKay A.<br />

Meta-analysis <strong>of</strong> pancreaticojejunostomy versus pancreaticogastrostomy<br />

reconstruction after pancreaticoduodenectomy:<br />

authors' comment (Br J Surg 2006; 93: 929-936). Br J Surg 2006;<br />

93: 1435<br />

305 Wente MN, Shrikhande SV, Müller MW, Diener MK, Seiler<br />

CM, Friess H, Büchler MW. Pancreaticojejunostomy versus<br />

pancreaticogastrostomy: systematic review and meta-analysis.<br />

Am J Surg 2007; 193: 171-183<br />

306 Andrén-Sandberg A, Wagner M, Tihanyi T, Löfgren P,<br />

Friess H. Technical aspects <strong>of</strong> left-sided pancreatic resection<br />

for <strong>cancer</strong>. Dig Surg 1999; 16: 305-312<br />

307 Shoup M, Brennan MF, McWhite K, Leung DH, Klimstra<br />

D, Conlon KC. The value <strong>of</strong> splenic preservation with distal<br />

pancreatectomy. Arch Surg 2002; 137: 164-168<br />

308 Warshaw AL. Conservation <strong>of</strong> the spleen with distal pancreatectomy.<br />

Arch Surg 1988; 123: 550-553<br />

309 Bilimoria MM, Cormier JN, Mun Y, Lee JE, Evans DB, Pi-<br />

WJG|www.wjgnet.com<br />

sters PW. Pancreatic leak after left pancreatectomy is reduced<br />

following main pancreatic duct ligation. Br J Surg 2003; 90:<br />

190-196<br />

310 Sheehan MK, Beck K, Creech S, Pickleman J, Aranha GV.<br />

Distal pancreatectomy: does the method <strong>of</strong> closure influence<br />

fistula formation? Am Surg 2002; 68: 264-267; discussion<br />

267-268<br />

311 Takeuchi K, Tsuzuki Y, Ando T, Sekihara M, Hara T, Kori<br />

T, Nakajima H, Kuwano H. Distal pancreatectomy: is staple<br />

closure beneficial? ANZ J Surg 2003; 73: 922-925<br />

312 Balzano G, Zerbi A, Cristallo M, Di Carlo V. The unsolved<br />

problem <strong>of</strong> fistula after left pancreatectomy: the benefit <strong>of</strong> cautious<br />

drain management. J Gastrointest Surg 2005; 9: 837-842<br />

313 Suzuki Y, Fujino Y, Tanioka Y, Hori Y, Ueda T, Takeyama Y,<br />

Tominaga M, Ku Y, Yamamoto YM, Kuroda Y. Randomized<br />

clinical trial <strong>of</strong> ultrasonic dissector or conventional division<br />

in distal pancreatectomy for non-fibrotic pancreas. Br J Surg<br />

1999; 86: 608-611<br />

314 Adam U, Makowiec F, Riediger H, Trzeczak S, Benz S, Hopt<br />

UT. [Distal pancreatic resection--indications, techniques and<br />

complications]. Zentralbl Chir 2001; 126: 908-912<br />

315 Moriura S, Kimura A, Ikeda S, Iwatsuka Y, Ikezawa T, Naiki<br />

K. Closure <strong>of</strong> the distal pancreatic stump with a seromuscular<br />

flap. Surg Today 1995; 25: 992-994<br />

316 Kluger Y, Alfici R, Abbley B, S<strong>of</strong>fer D, Aladgem D. Gastric<br />

serosal patch in distal pancreatectomy for injury: a neglected<br />

technique. Injury 1997; 28: 127-129<br />

317 Brennan MF, Moccia RD, Klimstra D. <strong>Management</strong> <strong>of</strong> adenocarcinoma<br />

<strong>of</strong> the body and tail <strong>of</strong> the pancreas. Ann Surg<br />

1996; 223: 506-511; discussion 511-512<br />

318 Sohn TA, Yeo CJ, Cameron JL, Koniaris L, Kaushal S,<br />

Abrams RA, Sauter PK, Coleman J, Hruban RH, Lillemoe<br />

KD. Resected adenocarcinoma <strong>of</strong> the pancreas-616 patients:<br />

results, outcomes, and prognostic indicators. J Gastrointest<br />

Surg 2000; 4: 567-579<br />

319 Mori T, Abe N, Sugiyama M, Atomi Y. Laparoscopic pancreatic<br />

surgery. J Hepatobiliary Pancreat Surg 2005; 12: 451-455<br />

320 Olivié D, Lepanto L, Billiard JS, Audet P, Lavallée JM. Predicting<br />

resectability <strong>of</strong> pancreatic head <strong>cancer</strong> with multidetector<br />

CT. Surgical and pathologic correlation. JOP 2007; 8:<br />

753-758<br />

321 Gagner M, Pomp A. Laparoscopic pylorus-preserving pancreatoduodenectomy.<br />

Surg Endosc 1994; 8: 408-410<br />

322 Gagner M, Palermo M. Laparoscopic Whipple procedure:<br />

review <strong>of</strong> the literature. J Hepatobiliary Pancreat Surg 2009; 16:<br />

726-730<br />

323 Kendrick ML, Cusati D. Total laparoscopic pancreaticoduodenectomy:<br />

feasibility and outcome in an early experience.<br />

Arch Surg 2010; 145: 19-23<br />

324 Palanivelu C, Jani K, Senthilnathan P, Parthasarathi R, Rajapandian<br />

S, Madhankumar MV. Laparoscopic pancreaticoduodenectomy:<br />

technique and outcomes. J Am Coll Surg 2007;<br />

205: 222-230<br />

325 Dulucq JL, Wintringer P, Mahajna A. Laparoscopic pancreaticoduodenectomy<br />

for benign and malignant diseases. Surg<br />

Endosc 2006; 20: 1045-1050<br />

326 Pugliese R, Scandroglio I, Sansonna F, Maggioni D, Costanzi<br />

A, Citterio D, Ferrari GC, Di Lernia S, Magistro C. Laparoscopic<br />

pancreaticoduodenectomy: a retrospective review <strong>of</strong><br />

19 cases. Surg Laparosc Endosc Percutan Tech 2008; 18: 13-18<br />

327 Sahm M, Pross M, Schubert D, Lippert H. Laparoscopic distal<br />

pancreatic resection: our own experience in the treatment<br />

<strong>of</strong> solid tumors. Surg Today 2009; 39: 1103-1108<br />

328 Al-Taan OS, Stephenson JA, Briggs C, Pollard C, Metcalfe<br />

MS, Dennison AR. Laparoscopic pancreatic surgery: a review<br />

<strong>of</strong> present results and future prospects. HPB (Oxford)<br />

2010; 12: 239-243<br />

329 Kooby DA, Gillespie T, Bentrem D, Nakeeb A, Schmidt MC,<br />

Merchant NB, Parikh AA, Martin RC 2nd, Scoggins CR,<br />

Ahmad S, Kim HJ, Park J, Johnston F, Strouch MJ, Menze A,<br />

Rymer J, McClaine R, Strasberg SM, Talamonti MS, Staley<br />

894 February 21, 2011|Volume 17|Issue 7|

---

CA, McMasters KM, Lowy AM, Byrd-Sellers J, Wood WC,<br />

Hawkins WG. Left-sided pancreatectomy: a multicenter<br />

comparison <strong>of</strong> laparoscopic and open approaches. Ann Surg<br />

2008; 248: 438-446<br />

330 Mabrut JY, Fernandez-Cruz L, Azagra JS, Bassi C, Delvaux<br />

G, Weerts J, Fabre JM, Boulez J, Baulieux J, Peix JL, Gigot JF.<br />

Laparoscopic pancreatic resection: results <strong>of</strong> a multicenter<br />

European study <strong>of</strong> 127 patients. Surgery 2005; 137: 597-605<br />

331 Fernández-Cruz L, Cosa R, Blanco L, Levi S, López-Boado<br />

MA, Navarro S. Curative laparoscopic resection for pancreatic<br />

neoplasms: a critical analysis from a single institution. J<br />

Gastrointest Surg 2007; 11: 1607-1621; discussion 1621-1622<br />

332 Briggs CD, Mann CD, Irving GR, Neal CP, Peterson M, Cameron<br />

IC, Berry DP. Systematic review <strong>of</strong> minimally invasive<br />

pancreatic resection. J Gastrointest Surg 2009; 13: 1129-1137<br />

333 Baker MS, Bentrem DJ, Ujiki MB, Stocker S, Talamonti MS.<br />

A prospective single institution comparison <strong>of</strong> peri-operative<br />

outcomes for laparoscopic and open distal pancreatectomy.<br />

Surgery 2009; 146: 635-643; discussion 643-645<br />

334 Sohn TA, Campbell KA, Pitt HA, Sauter PK, Coleman JA,<br />

Lillemo KD, Yeo CJ, Cameron JL. Quality <strong>of</strong> life and longterm<br />

survival after surgery for chronic pancreatitis. J Gastrointest<br />

Surg 2000; 4: 355-364; discussion 364-365<br />

335 Reddy S, Wolfgang CL, Cameron JL, Eckhauser F, Choti<br />

MA, Schulick RD, Edil BH, Pawlik TM. Total pancreatectomy<br />

for pancreatic adenocarcinoma: evaluation <strong>of</strong> morbidity<br />

and long-term survival. Ann Surg 2009; 250: 282-287<br />

336 Pliam MB, ReMine WH. Further evaluation <strong>of</strong> total pancreatectomy.<br />

Arch Surg 1975; 110: 506-512<br />

337 Bahra M, Neuhaus P. Pancreas: Is there still a role for total<br />

pancreatectomy? Nat Rev Gastroenterol Hepatol 2010; 7: 72-74<br />

338 Yeo CJ, Cameron JL, Sohn TA, Lillemoe KD, Pitt HA, Talamini<br />

MA, Hruban RH, Ord SE, Sauter PK, Coleman J, Zahurak<br />

ML, Grochow LB, Abrams RA. Six hundred fifty consecutive<br />

pancreaticoduodenectomies in the 1990s: pathology, complications,<br />

and outcomes. Ann Surg 1997; 226: 248-257; discussion<br />

257-260<br />

339 Pezzilli R. Diabetic control after total pancreatectomy. Dig<br />

Liver Dis 2006; 38: 420-422<br />

340 Hartwig W, Hackert T, Hinz U, Hassenpflug M, Strobel O,<br />

Büchler MW, Werner J. Multivisceral resection for pancreatic<br />

malignancies: risk-analysis and long-term outcome. Ann<br />

Surg 2009; 250: 81-87<br />

341 Adams RB, Allen PJ. Surgical treatment <strong>of</strong> resectable and<br />

borderline resectable pancreatic <strong>cancer</strong>: expert consensus<br />

statement by Evans et al. Ann Surg Oncol 2009; 16: 1745-1750<br />

342 Bachellier P, Nakano H, Oussoultzoglou PD, Weber JC,<br />

Boudjema K, Wolf PD, Jaeck D. Is pancreaticoduodenectomy<br />

with mesentericoportal venous resection safe and worthwhile?<br />

Am J Surg 2001; 182: 120-129<br />

343 Siriwardana HP, Siriwardena AK. Systematic review <strong>of</strong> outcome<br />

<strong>of</strong> synchronous portal-superior mesenteric vein resection<br />

during pancreatectomy for <strong>cancer</strong>. Br J Surg 2006; 93: 662-673<br />

344 Leach SD, Lee JE, Charnsangavej C, Cleary KR, Lowy AM,<br />

Fenoglio CJ, Pisters PW, Evans DB. Survival following<br />

pancreaticoduodenectomy with resection <strong>of</strong> the superior<br />

mesenteric-portal vein confluence for adenocarcinoma <strong>of</strong> the<br />

pancreatic head. Br J Surg 1998; 85: 611-617<br />

345 Al-Haddad M, Martin JK, Nguyen J, Pungpapong S, Raimondo<br />

M, Woodward T, Kim G, Noh K, Wallace MB. Vascular resection<br />

and reconstruction for pancreatic malignancy: a single<br />

center survival study. J Gastrointest Surg 2007; 11: 1168-1174<br />

346 Amano H, Miura F, Toyota N, Wada K, Katoh K, Hayano<br />

K, Kadowaki S, Shibuya M, Maeno S, Eguchi T, Takada T,<br />

Asano T. Is pancreatectomy with arterial reconstruction a<br />

safe and useful procedure for locally advanced pancreatic<br />

<strong>cancer</strong>? J Hepatobiliary Pancreat Surg 2009; 16: 850-857<br />

347 Stitzenberg KB, Watson JC, Roberts A, Kagan SA, Cohen SJ,<br />

Konski AA, H<strong>of</strong>fman JP. Survival after pancreatectomy with<br />

major arterial resection and reconstruction. Ann Surg Oncol<br />

2008; 15: 1399-1406<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

348 Hirano S, Kondo S, Hara T, Ambo Y, Tanaka E, Shichinohe<br />

T, Suzuki O, Hazama K. Distal pancreatectomy with en bloc<br />

celiac axis resection for locally advanced pancreatic body<br />

<strong>cancer</strong>: long-term results. Ann Surg 2007; 246: 46-51<br />

349 Cubilla AL, Fortner J, Fitzgerald PJ. Lymph node involvement<br />

in carcinoma <strong>of</strong> the head <strong>of</strong> the pancreas area. Cancer<br />

1978; 41: 880-887<br />

350 Ishikawa O, Ohhigashi H, Sasaki Y, Kabuto T, Fukuda I,<br />

Furukawa H, Imaoka S, Iwanaga T. Practical usefulness <strong>of</strong><br />

lymphatic and connective tissue clearance for the carcinoma<br />

<strong>of</strong> the pancreas head. Ann Surg 1988; 208: 215-220<br />

351 Manabe T, Ohshio G, Baba N, Miyashita T, Asano N, Tamura<br />

K, Yamaki K, Nonaka A, Tobe T. Radical pancreatectomy<br />

for ductal cell carcinoma <strong>of</strong> the head <strong>of</strong> the pancreas. Cancer<br />

1989; 64: 1132-1137<br />

352 Kawarada Y, Yokoi H, Isaji S, Naganuma T, Tabata M, Machishi<br />

H, Das BC, Takahashi K, Murabayashi K. Modified<br />

standard pancreaticoduodenectomy for the treatment <strong>of</strong><br />

pancreatic head <strong>cancer</strong>. Digestion 1999; 60 Suppl 1: 120-125<br />

353 Samra JS, Gananadha S, Hugh TJ. Surgical management <strong>of</strong><br />

carcinoma <strong>of</strong> the head <strong>of</strong> pancreas: extended lymphadenectomy<br />

or modified en bloc resection? ANZ J Surg 2008; 78:<br />

228-236<br />

354 Pedrazzoli S, DiCarlo V, Dionigi R, Mosca F, Pederzoli P,<br />

Pasquali C, Klöppel G, Dhaene K, Michelassi F. Standard<br />

versus extended lymphadenectomy associated with pancreatoduodenectomy<br />

in the surgical treatment <strong>of</strong> adenocarcinoma<br />

<strong>of</strong> the head <strong>of</strong> the pancreas: a multicenter, prospective,<br />

randomized study. Lymphadenectomy Study Group. Ann<br />

Surg 1998; 228: 508-517<br />

355 Michalski CW, Kleeff J, Wente MN, Diener MK, Büchler<br />

MW, Friess H. Systematic review and meta-analysis <strong>of</strong> standard<br />

and extended lymphadenectomy in pancreaticoduodenectomy<br />

for pancreatic <strong>cancer</strong>. Br J Surg 2007; 94: 265-273<br />

356 Lieberman MD, Kilburn H, Lindsey M, Brennan MF. Relation<br />

<strong>of</strong> perioperative deaths to hospital volume among patients<br />

undergoing pancreatic resection for malignancy. Ann<br />

Surg 1995; 222: 638-645<br />

357 Imperato PJ, Nenner RP, Starr HA, Will TO, Rosenberg CR,<br />

Dearie MB. The effects <strong>of</strong> regionalization on clinical outcomes<br />

for a high risk surgical procedure: a study <strong>of</strong> the Whipple procedure<br />

in New York State. Am J Med Qual 1996; 11: 193-197<br />

358 Rosemurgy AS, Bloomston M, Serafini FM, Coon B, Murr<br />

MM, Carey LC. Frequency with which surgeons undertake<br />

pancreaticoduodenectomy determines length <strong>of</strong> stay, hospital<br />

charges, and in-hospital mortality. J Gastrointest Surg<br />

2001; 5: 21-26<br />

359 Sosa JA, Bowman HM, Gordon TA, Bass EB, Yeo CJ, Lillemoe<br />

KD, Pitt HA, Tielsch JM, Cameron JL. Importance <strong>of</strong><br />

hospital volume in the overall management <strong>of</strong> pancreatic<br />

<strong>cancer</strong>. Ann Surg 1998; 228: 429-438<br />

360 Ho V, Heslin MJ. Effect <strong>of</strong> hospital volume and experience on<br />

in-hospital mortality for pancreaticoduodenectomy. Ann Surg<br />

2003; 237: 509-514<br />

361 Simunovic M, To T, Theriault M, Langer B. Relation between<br />

hospital surgical volume and outcome for pancreatic resection<br />

for neoplasm in a publicly funded health care system.<br />

CMAJ 1999; 160: 643-648<br />

362 Gouma DJ, van Geenen RC, van Gulik TM, de Haan RJ, de<br />

Wit LT, Busch OR, Obertop H. Rates <strong>of</strong> complications and<br />

death after pancreaticoduodenectomy: risk factors and the<br />

impact <strong>of</strong> hospital volume. Ann Surg 2000; 232: 786-795<br />

363 Nienhuijs SW, Rutten HJ, Luiten EJ, van Driel OJ, Reemst<br />

PH, Lemmens VE, de Hingh IH. Reduction <strong>of</strong> in-hospital<br />

mortality following regionalisation <strong>of</strong> pancreatic surgery in<br />

the south-east <strong>of</strong> the Netherlands. Eur J Surg Oncol 2010; 36:<br />

652-656<br />

364 Edge SB, Schmieg RE Jr, Rosenl<strong>of</strong> LK, Wilhelm MC. Pancreas<br />

<strong>cancer</strong> resection outcome in American University centers<br />

in 1989-1990. Cancer 1993; 71: 3502-3508<br />

365 Birkmeyer JD, Finlayson SR, Tosteson AN, Sharp SM, War-<br />

895 February 21, 2011|Volume 17|Issue 7|

---

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

shaw AL, Fisher ES. Effect <strong>of</strong> hospital volume on in-hospital<br />

mortality with pancreaticoduodenectomy. Surgery 1999; 125:<br />

250-256<br />

366 Bilimoria KY, Bentrem DJ, Ko CY, Tomlinson JS, Stewart<br />

AK, Winchester DP, Talamonti MS. Multimodality therapy<br />

for pancreatic <strong>cancer</strong> in the U.S. : utilization, outcomes, and<br />

the effect <strong>of</strong> hospital volume. Cancer 2007; 110: 1227-1234<br />

367 Bilimoria KY, Bentrem DJ, Ko CY, Stewart AK, Winchester<br />

DP, Talamonti MS. National failure to operate on early <strong>stage</strong><br />

pancreatic <strong>cancer</strong>. Ann Surg 2007; 246: 173-180<br />

368 Sherman WH, Fine RL. Combination gemcitabine and<br />

docetaxel therapy in advanced adenocarcinoma <strong>of</strong> the pancreas.<br />

Oncology 2001; 60: 316-321<br />

369 Moertel CG. Chemotherapy <strong>of</strong> gastrointestinal <strong>cancer</strong>. Clin<br />

Gastroenterol 1976; 5: 777-793<br />

370 Burris HA 3rd, Moore MJ, Andersen J, Green MR, Rothenberg<br />

ML, Modiano MR, Cripps MC, Portenoy RK, Storniolo AM,<br />

Tarass<strong>of</strong>f P, Nelson R, Dorr FA, Stephens CD, Von H<strong>of</strong>f DD.<br />

Improvements in survival and clinical benefit with gemcitabine<br />

as first-line therapy for patients with advanced pancreas<br />

<strong>cancer</strong>: a randomized trial. J Clin Oncol 1997; 15: 2403-2413<br />

371 Fatima J, Schnelldorfer T, Barton J, Wood CM, Wiste HJ,<br />

Smyrk TC, Zhang L, Sarr MG, Nagorney DM, Farnell MB. Pancreatoduodenectomy<br />

for ductal adenocarcinoma: implications<br />

<strong>of</strong> positive margin on survival. Arch Surg 2010; 145: 167-172<br />

372 Shimada K, Sakamoto Y, Sano T, Kosuge T. Prognostic factors<br />

after distal pancreatectomy with extended lymphadenectomy<br />

for invasive pancreatic adenocarcinoma <strong>of</strong> the body<br />

and tail. Surgery 2006; 139: 288-295<br />

373 Raut CP, Tseng JF, Sun CC, Wang H, Wolff RA, Crane CH,<br />

Hwang R, Vauthey JN, Abdalla EK, Lee JE, Pisters PW, Evans<br />

DB. Impact <strong>of</strong> resection status on pattern <strong>of</strong> failure and<br />

survival after pancreaticoduodenectomy for pancreatic adenocarcinoma.<br />

Ann Surg 2007; 246: 52-60<br />

374 Moon HJ, Jang KT, Heo JS, Choi SH, Joh JW, Kim YI. [A result<br />

<strong>of</strong> surgical treatment for ductal adenocarcinoma <strong>of</strong> the<br />

head <strong>of</strong> the pancreas]. Korean J Gastroenterol 2003; 42: 156-163<br />

375 Howard TJ, Krug JE, Yu J, Zyromski NJ, Schmidt CM, Jacobson<br />

LE, Madura JA, Wiebke EA, Lillemoe KD. A marginnegative<br />

R0 resection accomplished with minimal postoperative<br />

complications is the surgeon's contribution to longterm<br />

survival in pancreatic <strong>cancer</strong>. J Gastrointest Surg 2006;<br />

10: 1338-1345; discussion 1345-1346<br />

376 Kato K, Yamada S, Sugimoto H, Kanazumi N, Nomoto S,<br />

Takeda S, Kodera Y, Morita S, Nakao A. Prognostic factors<br />

for survival after extended pancreatectomy for pancreatic<br />

head <strong>cancer</strong>: influence <strong>of</strong> resection margin status on survival.<br />

Pancreas 2009; 38: 605-612<br />

377 Sorg C, Schmidt J, Büchler MW, Edler L, Märten A. Examination<br />

<strong>of</strong> external validity in randomized controlled trials for<br />

adjuvant treatment <strong>of</strong> pancreatic adenocarcinoma. Pancreas<br />

2009; 38: 542-550<br />

378 Further evidence <strong>of</strong> effective adjuvant combined radiation<br />

and chemotherapy following curative resection <strong>of</strong> pancreatic<br />

<strong>cancer</strong>. Gastrointestinal Tumor Study Group. Cancer 1987;<br />

59: 2006-2010<br />

379 Klinkenbijl JH, Jeekel J, Sahmoud T, van Pel R, Couvreur<br />

ML, Veenh<strong>of</strong> CH, Arnaud JP, Gonzalez DG, de Wit LT, Hennipman<br />

A, Wils J. Adjuvant radiotherapy and 5-fluorouracil<br />

after curative resection <strong>of</strong> <strong>cancer</strong> <strong>of</strong> the pancreas and periampullary<br />

region: phase III trial <strong>of</strong> the EORTC gastrointestinal<br />

tract <strong>cancer</strong> cooperative group. Ann Surg 1999; 230: 776-782;<br />

discussion 782-784<br />

380 Neoptolemos JP, Stocken DD, Friess H, Bassi C, Dunn JA,<br />

Hickey H, Beger H, Fernandez-Cruz L, Dervenis C, Lacaine<br />

F, Falconi M, Pederzoli P, Pap A, Spooner D, Kerr DJ, Büchler<br />

MW. A randomized trial <strong>of</strong> chemoradiotherapy and chemotherapy<br />

after resection <strong>of</strong> pancreatic <strong>cancer</strong>. N Engl J Med<br />

2004; 350: 1200-1210<br />

381 Crane CH, Winter K, Regine WF, Safran H, Rich TA, Curran<br />

W, Wolff RA, Willett CG. Phase II study <strong>of</strong> bevacizumab with<br />

WJG|www.wjgnet.com<br />

concurrent capecitabine and radiation followed by maintenance<br />

gemcitabine and bevacizumab for locally advanced<br />

pancreatic <strong>cancer</strong>: Radiation Therapy Oncology Group RTOG<br />

0411. J Clin Oncol 2009; 27: 4096-4102<br />

382 Oettle H, Post S, Neuhaus P, Gellert K, Langrehr J, Ridwelski<br />

K, Schramm H, Fahlke J, Zuelke C, Burkart C, Gutberlet K,<br />

Kettner E, Schmalenberg H, Weigang-Koehler K, Bechstein<br />

WO, Niedergethmann M, Schmidt-Wolf I, Roll L, Doerken B,<br />

Riess H. Adjuvant chemotherapy with gemcitabine vs observation<br />

in patients undergoing curative-intent resection <strong>of</strong> pancreatic<br />

<strong>cancer</strong>: a randomized controlled trial. JAMA 2007; 297:<br />

267-277<br />

383 Gillen S, Schuster T, Meyer Zum Büschenfelde C, Friess H,<br />

Kleeff J. Preoperative/neoadjuvant therapy in pancreatic<br />

<strong>cancer</strong>: a systematic review and meta-analysis <strong>of</strong> response<br />

and resection percentages. PLoS Med 2010; 7: e1000267<br />

384 Shah AP, Strauss JB, Abrams RA. Review and commentary<br />

on the role <strong>of</strong> radiation therapy in the adjuvant management<br />

<strong>of</strong> pancreatic <strong>cancer</strong>. Am J Clin Oncol 2010; 33: 101-106<br />

385 Stocken DD, Büchler MW, Dervenis C, Bassi C, Jeekel H,<br />

Klinkenbijl JH, Bakkevold KE, Takada T, Amano H, Neoptolemos<br />

JP. Meta-analysis <strong>of</strong> randomised adjuvant therapy<br />

trials for pancreatic <strong>cancer</strong>. Br J Cancer 2005; 92: 1372-1381<br />

386 Kim R, Saif MW. Is there an optimal neoadjuvant therapy<br />

for locally advanced pancreatic <strong>cancer</strong>? JOP 2007; 8: 279-288<br />

387 Moertel CG, Childs DS Jr, Reitemeier RJ, Colby MY Jr, Holbrook<br />

MA. Combined 5-fluorouracil and supervoltage radiation<br />

therapy <strong>of</strong> locally unresectable gastrointestinal <strong>cancer</strong>.<br />

Lancet 1969; 2: 865-867<br />

388 Moertel CG, Frytak S, Hahn RG, O'Connell MJ, Reitemeier<br />

RJ, Rubin J, Schutt AJ, Weiland LH, Childs DS, Holbrook<br />

MA, Lavin PT, Livstone E, Spiro H, Knowlton A, Kalser M,<br />

Barkin J, Lessner H, Mann-Kaplan R, Ramming K, Douglas<br />

HO Jr, Thomas P, Nave H, Bateman J, Lokich J, Brooks J,<br />

Chaffey J, Corson JM, Zamcheck N, Novak JW. Therapy <strong>of</strong><br />

locally unresectable pancreatic carcinoma: a randomized<br />

comparison <strong>of</strong> high dose (6000 rads) radiation alone, moderate<br />

dose radiation (4000 rads + 5-fluorouracil), and high dose<br />

radiation + 5-fluorouracil: The Gastrointestinal Tumor Study<br />

Group. Cancer 1981; 48: 1705-1710<br />

389 Ogawa K, Karasawa K, Ito Y, Ogawa Y, Jingu K, Onishi H,<br />

Aoki S, Wada H, Kokubo M, Etoh H, Kazumoto T, Takayama<br />

M, Negoro Y, Nemoto K, Nishimura Y. Intraoperative<br />

radiotherapy for resected pancreatic <strong>cancer</strong>: a multi-institutional<br />

retrospective analysis <strong>of</strong> 210 patients. Int J Radiat Oncol<br />

Biol Phys 2010; 77: 734-742<br />

390 Takamori H, Hiraoka T, Kanemitsu K, Tsuji T, Tanaka H,<br />

Chikamoto A, Horino K, Beppu T, Hirota M, Baba H. Longterm<br />

outcomes <strong>of</strong> extended radical resection combined with<br />

intraoperative radiation therapy for pancreatic <strong>cancer</strong>. J<br />

Hepatobiliary Pancreat Surg 2008; 15: 603-607<br />

391 Klautke G, Brunner TB. Radiotherapy in pancreatic <strong>cancer</strong>.<br />

Strahlenther Onkol 2008; 184: 557-564<br />

392 Carter DC. Cancer <strong>of</strong> the pancreas. Gut 1990; 31: 494-496<br />

393 Espat NJ, Brennan MF, Conlon KC. Patients with laparoscopically<br />

<strong>stage</strong>d unresectable pancreatic adenocarcinoma<br />

do not require subsequent surgical biliary or gastric bypass.<br />

J Am Coll Surg 1999; 188: 649-655; discussion 655-657<br />

394 Warshaw AL, Swanson RS. Pancreatic <strong>cancer</strong> in 1988. Possibilities<br />

and probabilities. Ann Surg 1988; 208: 541-553<br />

395 Singh SM, Longmire WP Jr, Reber HA. Surgical palliation<br />

for pancreatic <strong>cancer</strong>. The UCLA experience. Ann Surg 1990;<br />

212: 132-139<br />

396 Lillemoe KD, Cameron JL, Hardacre JM, Sohn TA, Sauter<br />

PK, Coleman J, Pitt HA, Yeo CJ. Is prophylactic gastrojejunostomy<br />

indicated for unresectable periampullary <strong>cancer</strong>? A<br />

prospective randomized trial. Ann Surg 1999; 230: 322-328;<br />

discussion 328-330<br />

397 van Ho<strong>of</strong>t JE, Uitdehaag MJ, Bruno MJ, Timmer R, Siersema<br />

PD, Dijkgraaf MG, Fockens P. Efficacy and safety <strong>of</strong> the new<br />

WallFlex enteral stent in palliative treatment <strong>of</strong> malignant<br />

896 February 21, 2011|Volume 17|Issue 7|

---

gastric outlet obstruction (DUOFLEX study): a prospective<br />

multicenter study. Gastrointest Endosc 2009; 69: 1059-1066<br />

398 Kim JH, Song HY, Shin JH, Hu HT, Lee SK, Jung HY, Yook<br />

JH. Metallic stent placement in the palliative treatment <strong>of</strong><br />

malignant gastric outlet obstructions: primary gastric carcinoma<br />

versus pancreatic carcinoma. AJR Am J Roentgenol<br />

2009; 193: 241-247<br />

399 Maetani I, Tada T, Ukita T, Inoue H, Sakai Y, Nagao J. Comparison<br />

<strong>of</strong> duodenal stent placement with surgical gastrojejunostomy<br />

for palliation in patients with duodenal obstructions<br />

caused by pancreaticobiliary malignancies. Endoscopy 2004;<br />

36: 73-78<br />

400 Maetani I, Akatsuka S, Ikeda M, Tada T, Ukita T, Nakamura<br />

Y, Nagao J, Sakai Y. Self-expandable metallic stent placement<br />

for palliation in gastric outlet obstructions caused by gastric<br />

<strong>cancer</strong>: a comparison with surgical gastrojejunostomy. J Gastroenterol<br />

2005; 40: 932-937<br />

401 Mehta S, Hindmarsh A, Cheong E, Cockburn J, Saada J,<br />

Tighe R, Lewis MP, Rhodes M. Prospective randomized trial<br />

<strong>of</strong> laparoscopic gastrojejunostomy versus duodenal stenting<br />

for malignant gastric outflow obstruction. Surg Endosc 2006;<br />

20: 239-242<br />

402 Watanapa P, Williamson RC. Surgical palliation for pancreatic<br />

<strong>cancer</strong>: developments during the past two decades. Br J<br />

Surg 1992; 79: 8-20<br />

403 Neuberger TJ, Wade TP, Swope TJ, Virgo KS, Johnson FE.<br />

Palliative operations for pancreatic <strong>cancer</strong> in the hospitals <strong>of</strong><br />

the U.S. Department <strong>of</strong> Veterans Affairs from 1987 to 1991.<br />

Am J Surg 1993; 166: 632-636; discussion 636-637<br />

404 Piñol V, Castells A, Bordas JM, Real MI, Llach J, Montañà X,<br />

Feu F, Navarro S. Percutaneous self-expanding metal stents<br />

versus endoscopic polyethylene endoprostheses for treating<br />

malignant biliary obstruction: randomized clinical trial. Radiology<br />

2002; 225: 27-34<br />

405 Maosheng D, Ohtsuka T, Ohuchida J, Inoue K, Yokohata K,<br />

Yamaguchi K, Chijiiwa K, Tanaka M. Surgical bypass versus<br />

metallic stent for unresectable pancreatic <strong>cancer</strong>. J Hepatobiliary<br />

Pancreat Surg 2001; 8: 367-373<br />

406 Smith AC, Dowsett JF, Russell RC, Hatfield AR, Cotton PB.<br />

Randomised trial <strong>of</strong> endoscopic stenting versus surgical bypass<br />

in malignant low bileduct obstruction. Lancet 1994; 344:<br />

1655-1660<br />

407 Artifon EL, Sakai P, Cunha JE, Dupont A, Filho FM, Hondo<br />

FY, Ishioka S, Raju GS. Surgery or endoscopy for palliation<br />

<strong>of</strong> biliary obstruction due to metastatic pancreatic <strong>cancer</strong>. Am<br />

J Gastroenterol 2006; 101: 2031-2037<br />

408 Taylor MC, McLeod RS, Langer B. Biliary stenting versus<br />

bypass surgery for the palliation <strong>of</strong> malignant distal bile duct<br />

obstruction: a meta-analysis. Liver Transpl 2000; 6: 302-308<br />

409 Knyrim K, Wagner HJ, Pausch J, Vakil N. A prospective, randomized,<br />

controlled trial <strong>of</strong> metal stents for malignant obstruction<br />

<strong>of</strong> the common bile duct. Endoscopy 1993; 25: 207-212<br />

410 Davids PH, Groen AK, Rauws EA, Tytgat GN, Huibregtse K.<br />

Randomised trial <strong>of</strong> self-expanding metal stents versus polyethylene<br />

stents for distal malignant biliary obstruction. Lancet<br />

1992; 340: 1488-1492<br />

411 Nakai Y, Isayama H, Kawabe T, Tsujino T, Yoshida H, Sasaki<br />

WJG|www.wjgnet.com<br />

Sharma C et al . Clinical advances in pancreatic carcinoma<br />

T, Tada M, Arizumi T, Yagioka H, Kogure H, Togawa O, Ito<br />

Y, Matsubara S, Hirano K, Sasahira N, Omata M. Efficacy and<br />

safety <strong>of</strong> metallic stents in patients with unresectable pancreatic<br />

<strong>cancer</strong> receiving gemcitabine. Pancreas 2008; 37: 405-410<br />

412 Maire F, Hammel P, Ponsot P, Aubert A, O'Toole D, Hentic<br />

O, Levy P, Ruszniewski P. Long-term outcome <strong>of</strong> biliary<br />

and duodenal stents in palliative treatment <strong>of</strong> patients with<br />

unresectable adenocarcinoma <strong>of</strong> the head <strong>of</strong> pancreas. Am J<br />

Gastroenterol 2006; 101: 735-742<br />

413 Wang T, Tian FZ, Cai ZH, Li X, Cheng T, Shi L, Cheng Q.<br />

Ultrasonic interventional analgesia in pancreatic carcinoma<br />

with chemical destruction <strong>of</strong> celiac ganglion. <strong>World</strong> J Gastroenterol<br />

2006; 12: 3288-3291<br />

414 Caraceni A, Portenoy RK. Pain management in patients with<br />

pancreatic carcinoma. Cancer 1996; 78: 639-653<br />

415 Shulman M, Harris JE, Lubenow TR, Nath HA, Ivankovich<br />

AD. Comparison <strong>of</strong> epidural butamben to celiac plexus<br />

neurolytic block for the treatment <strong>of</strong> the pain <strong>of</strong> pancreatic<br />

<strong>cancer</strong>. Clin J Pain 2000; 16: 304-309<br />

416 Eisenberg E, Carr DB, Chalmers TC. Neurolytic celiac plexus<br />

block for treatment <strong>of</strong> <strong>cancer</strong> pain: a meta-analysis. Anesth<br />

Analg 1995; 80: 290-295<br />

417 Gunaratnam NT, Sarma AV, Norton ID, Wiersema MJ. A<br />

prospective study <strong>of</strong> EUS-guided celiac plexus neurolysis for<br />

pancreatic <strong>cancer</strong> pain. Gastrointest Endosc 2001; 54: 316-324<br />

418 Puli SR, Reddy JB, Bechtold ML, Antillon MR, Brugge WR.<br />

EUS-guided celiac plexus neurolysis for pain due to chronic<br />

pancreatitis or pancreatic <strong>cancer</strong> pain: a meta-analysis and<br />

systematic review. Dig Dis Sci 2009; 54: 2330-2337<br />

419 Wong GY, Schroeder DR, Carns PE, Wilson JL, Martin DP,<br />

Kinney MO, Mantilla CB, Warner DO. Effect <strong>of</strong> neurolytic<br />

celiac plexus block on pain relief, quality <strong>of</strong> life, and survival<br />

in patients with unresectable pancreatic <strong>cancer</strong>: a randomized<br />

controlled trial. JAMA 2004; 291: 1092-1099<br />

420 Russell RC. Palliation <strong>of</strong> pain and jaundice: an overview.<br />

Ann Oncol 1999; 10 Suppl 4: 165-169<br />

421 Bown SG, Rogowska AZ, Whitelaw DE, Lees WR, Lovat LB,<br />

Ripley P, Jones L, Wyld P, Gillams A, Hatfield AW. Photodynamic<br />

therapy for <strong>cancer</strong> <strong>of</strong> the pancreas. Gut 2002; 50: 549-557<br />

422 Morganti AG, Trodella L, Valentini V, Barbi S, Macchia G,<br />

Mantini G, Turriziani A, Cellini N. Pain relief with shortterm<br />

irradiation in locally advanced carcinoma <strong>of</strong> the pancreas.<br />

J Palliat Care 2003; 19: 258-262<br />

423 De Conno F, Saita L, Ripamonti C, Ventafridda V. Subcutaneous<br />

octreotide in the treatment <strong>of</strong> pain in advanced <strong>cancer</strong><br />

patients. J Pain Symptom Manage 1994; 9: 34-38<br />

424 Bruno MJ, Haverkort EB, Tijssen GP, Tytgat GN, van Leeuwen<br />

DJ. Placebo controlled trial <strong>of</strong> enteric coated pancreatin<br />

microsphere treatment in patients with unresectable <strong>cancer</strong><br />

<strong>of</strong> the pancreatic head region. Gut 1998; 42: 92-96<br />

425 Dewys WD, Begg C, Lavin PT, Band PR, Bennett JM, Bertino<br />

JR, Cohen MH, Douglass HO Jr, Engstrom PF, Ezdinli<br />

EZ, Horton J, Johnson GJ, Moertel CG, Oken MM, Perlia<br />

C, Rosenbaum C, Silverstein MN, Skeel RT, Sponzo RW,<br />

Tormey DC. Prognostic effect <strong>of</strong> weight loss prior to chemotherapy<br />

in <strong>cancer</strong> patients. Eastern Cooperative Oncology<br />

Group. Am J Med 1980; 69: 491-497<br />

S- Editor Tian L L- Editor Webster JR E- Editor Lin YP<br />

897 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.898<br />

Neuroprotective action <strong>of</strong> Ginkgo biloba on the enteric<br />

nervous system <strong>of</strong> diabetic rats<br />

Glasiella Gonzalez Perez da Silva, Jacqueline Nelisis Zanoni, Nilza Cristina Buttow<br />

Glasiella Gonzalez Perez da Silva, Jacqueline Nelisis Zanoni,<br />

Nilza Cristina Buttow, Department <strong>of</strong> Morphological Sciences,<br />

Universidade Estadual de Maringá, Av. Colombo, 5790<br />

Bloco H-79, CEP 87020-900, Maringá, PR, Brazil<br />

Author contributions: da Silva GGP performed data collection<br />

and wrote the paper; Buttow NC designed the study, contributed<br />

analytical tools and corrected the paper; Zanoni JN analyzed the<br />

data.<br />

Correspondence to: Nilza Cristina Buttow, PhD, Department<br />

<strong>of</strong> Morphological Sciences, Universidade Estadual de Maringá,<br />

Av. Colombo, 5790 Bloco H-79, CEP 87020-900, Maringá, PR,<br />

Brazil. ncbuttow@uem.br<br />

Telephone: +55-44-30111370 Fax: +55-44-30114340<br />

Received: February 18, 2010 Revised: March 24, 2010<br />

Accepted: March 31, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To investigate the effect <strong>of</strong> Ginkgo biloba extract<br />

on the enteric neurons in the small intestine <strong>of</strong> diabetic<br />

rats.<br />

METHODS: Fifteen Wistar rats were divided into three<br />

groups: control group (C), diabetic group (D) and diabetic-treated<br />

(DT) daily with EGb 761 extract (50 mg/kg<br />

body weight) for 120 d. The enteric neurons were identified<br />

by the myosin-V immunohistochemical technique.<br />

The neuronal density and the cell body area were also<br />

analyzed.<br />

RESULTS: There was a significant decrease in the<br />

neuronal population (myenteric plexus P = 0.0351;<br />

submucous plexus P = 0.0217) in both plexuses <strong>of</strong> the<br />

jejunum in group D when compared to group C. With<br />

regard to the ileum, there was a significant decrease (P<br />

= 0.0117) only in the myenteric plexus. The DT group<br />

showed preservation <strong>of</strong> the neuronal population in the<br />

jejunum submucous plexus and in the myenteric plexus<br />

in the ileum. The cell body area in group D increased<br />

significantly (P = 0.0001) in the myenteric plexus <strong>of</strong><br />

WJG|www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 898-905<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

both segments studied as well as in the ileum submucosal<br />

plexus, when compared to C. The treatment reduced<br />

(P = 0.0001) the cell body area <strong>of</strong> the submucosal neurons<br />

<strong>of</strong> both segments and the jejunum myenteric neurons.<br />

CONCLUSION: The purified Ginkgo biloba extract has<br />

a neuroprotective effect on the jejunum submucous<br />

plexus and the myenteric plexus <strong>of</strong> the ileum <strong>of</strong> diabetic<br />

rats.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Diabetes mellitus; Ginkgo biloba; Myenteric<br />

plexus; Submucous plexus; Neuroprotection<br />

Peer reviewer: Claudio Daniel Gonzalez, MD, Pr<strong>of</strong>essor <strong>of</strong><br />

Pharmacology, Department <strong>of</strong> Pharmacology, CEMIC University<br />

Hospital, Buenos Aires, Argentina<br />

da Silva GGP, Zanoni JN, Buttow NC. Neuroprotective action<br />

<strong>of</strong> Ginkgo biloba on the enteric nervous system <strong>of</strong> diabetic rats.<br />

<strong>World</strong> J Gastroenterol 2011; 17(7): 898-905 Available from:<br />

URL: http://www.wjgnet.com/1007-9327/full/v17/i7/898.htm<br />

DOI: http://dx.doi.org/10.3748/wjg.v17.i7.898<br />

INTRODUCTION<br />

ORIGINAL ARTICLE<br />

Diabetes mellitus (DM) is a group <strong>of</strong> metabolic diseases<br />

characterized by high levels <strong>of</strong> glucose due to the lack <strong>of</strong><br />

insulin and/or the inability <strong>of</strong> insulin to properly exercise<br />

its effects [1] . Long-term hyperglycemia induces morbid<br />

states in patients, resulting in macroangiopathy [2] complications,<br />

microangiopathy (retinopathy and nephropathy) [3]<br />

and neuropathies [4] .<br />

Neuropathy is the most common late complication<br />

in diabetic patients [5,6] . It compromises the sympathetic,<br />

parasympathetic and enteric nerves, causing a variety <strong>of</strong><br />

abnormalities such as ulcerations <strong>of</strong> the lower limbs, sud-<br />

898 February 21, 2011|Volume 17|Issue 7|

---

da Silva GGP et al . Neuroprotection in enteric neurons<br />

mucosa and submucosal tunica were removed from the<br />

myenteric plexus, while the external muscular layer was<br />

kept. The mucosa was removed from the submucosal<br />

plexus with the aid <strong>of</strong> a wooden spatula.<br />

Immunohistochemistry <strong>of</strong> the myenteric and<br />

submucosal plexuses<br />

The myenteric and submucous plexuses were stained by<br />

the anti-myosin-V immunohistochemical technique as<br />

described by Buttow et al [23] . The final concentration <strong>of</strong><br />

antibody was 0.89 mg/mL. The dilution used was 1:1000<br />

(v/v). The membranes were first immersed in a blocking<br />

solution <strong>of</strong> 0.1 mol/L PBS containing 2% bovine serum<br />

albumin (BSA) and 0.5% Triton X-100 and normal goat<br />

serum at a ratio <strong>of</strong> 1:50 (v/v) for 3 h. The material was incubated<br />

with primary antibody for 48 h at room temperature<br />

(RT); this was performed in a solution <strong>of</strong> 0.1 mol/L<br />

PBS containing 1% BSA and 0.1% Triton X-100 and<br />

normal goat serum in the proportion <strong>of</strong> 1:50 (v/v). After<br />

the incubation, the material was washed twice for 15 min<br />

with PBS solution 0.1 mol/L and Triton X-100 0.1% and<br />

then also washed twice in PBS 0.1 mol/L and Tween 20 at<br />

a concentration <strong>of</strong> 0.05% for 15 min. The whole-mounts<br />

were then incubated with anti-rabbit secondary antibody<br />

produced in goat, peroxidase-conjugated [ImmunoPure ®<br />

Goat Anti-Rabbit IgG, (Fc), Peroxidase Conjugated, brand<br />

Pierce] in a blocking solution containing 0.1 mol/LPBS, 1%<br />

BSA and 0.05% Tween 20 for 24 h at RT. Normal goat serum<br />

at 1:50 (v/v) was also added to this blocking solution.<br />

The material was washed 4 times for 15 min in a solution<br />

<strong>of</strong> 0.1 mol/L PBS containing 0.05% Tween 20. The membranes<br />

were developed with the use <strong>of</strong> a diaminobenzidine<br />

solution (Sigma, St. Louis, MO, USA) for approximately<br />

10 min at a concentration <strong>of</strong> 0.14 mg/mL. After developing,<br />

the material was mounted on histological slides<br />

with glycerol-gel (containing 50% glycerol, 0.07 g/mL<br />

gelatin in PBS, and 2 μL/mL phenol). The slides were<br />

then placed in refrigerator (4℃), in order to slowly dry the<br />

whole-mounts.<br />

Density analysis <strong>of</strong> myosin-V immunoreactive neurons<br />

Enteric neurons were counted on a BX 40 Olympus<br />

microscope under a 40 × lens. Forty microscopy fields,<br />

randomly selected, were counted for each preparation.<br />

The area <strong>of</strong> each field was 0.229 mm 2 . The results were<br />

expressed in number <strong>of</strong> neurons per cm 2 .<br />

Morphometric analysis <strong>of</strong> myosin-V immunoreactive<br />

neurons<br />

Images <strong>of</strong> the ganglia were taken and then measured with<br />

the aid <strong>of</strong> the image analysis s<strong>of</strong>tware Image Pro-Plus 3.0.1<br />

(Media Cybernetics, Silver Spring, MD, USA) to study the<br />

area <strong>of</strong> neurons in different groups. The area (μm 2 ) <strong>of</strong><br />

100 cell bodies per animal was measured, for a total <strong>of</strong><br />

500 neurons (5 animals per group). Neurons were classified<br />

into the class interval <strong>of</strong> 10 μm 2 , and the percentage<br />

<strong>of</strong> each group was calculated for each interval.<br />

WJG|www.wjgnet.com<br />

Table 1 Final weight and glycemia in groups: control, diabetic<br />

and EGb 76-treated diabetic (mean ± SE)<br />

Group Final weight (g) Blood glucose (mg/dL)<br />

C 445.6 ± 63.04 78.97 ± 5.12<br />

D 264.6 ± 22.88 253 ± 64.97<br />

DT 308 ± 19.27 322 ± 20.42<br />

n = 5/groups. C: Control; D: Diabetic; DT: EGb 76-treated diabetic.<br />

Statistical analysis<br />

To compare the parameters <strong>of</strong> the studied groups we<br />

used analysis <strong>of</strong> variance (ANOVA). When there was a<br />

significant difference we used Tukey’s test. For this study<br />

we used the Prism s<strong>of</strong>tware version 3.0. Results were considered<br />

significant when P < 0.05. The results were shown<br />

as mean ± SE, n indicating the number <strong>of</strong> samples in each<br />

group.<br />

RESULTS<br />

Streptozotocin caused diabetic syndrome onset in animal<br />

groups D and DT, as evidenced by the significant increase<br />

in blood glucose, as well as a significant reduction in body<br />

weight, when compared to group C (Table 1). Other typical<br />

symptoms <strong>of</strong> the disease (polyuria, polydipsia and<br />

polyphagia) were observed during the experimental period.<br />

Neuronal density<br />

There was a significant reduction (P < 0.05) in the neuronal<br />

density <strong>of</strong> myenteric neurons in the jejunum in group<br />

D when compared to C (Table 2). There was no significant<br />

difference in the DT group when compared to groups C<br />

and D. The neuronal density <strong>of</strong> submucosal neurons decreased<br />

significantly (P < 0.05) in group D when compared<br />

to C. No significant difference in the neuronal density was<br />

observed when group DT was compared to C (Table 2).<br />

The neuronal density <strong>of</strong> myenteric neurons in the ileum<br />

decreased significantly (P < 0.05) in group D when<br />

compared to C (Table 3). No significant difference was<br />

seen when comparing group DT to C. There was no<br />

significant reduction in the neuronal density in the ileum<br />

submucous plexus when the three groups were compared<br />

(Table 3).<br />

Areas <strong>of</strong> neuronal cell bodies<br />

The results obtained with the measurements <strong>of</strong> 500 neurons<br />

per studied group were distributed according to<br />

the relative frequency <strong>of</strong> areas <strong>of</strong> neuronal cell bodies<br />

at intervals <strong>of</strong> 10 μm 2 (Figures 1 and 2). The cell body<br />

area in the jejunum ranged between 81.33 and 538.9 μm 2<br />

for animals in group C; between 119.9 and 588.9 μm 2 in<br />

group D; and between 101.0 and 609.2 μm 2 in group DT.<br />

There were no significant differences in the mean areas <strong>of</strong><br />

the jejunum myenteric neurons when comparing groups<br />

C and D. However, there was a significant reduction in the<br />

mean area (P < 0.05) <strong>of</strong> the DT group when compared to<br />

the other two groups (Table 2). The cell body area in the<br />

900 February 21, 2011|Volume 17|Issue 7|

---

Table 2 Neuronal density and mean area <strong>of</strong> cell bodies <strong>of</strong> myenteric and submucosal neurons in the jejunum <strong>of</strong> rat<br />

groups: control, diabetic and EGb 761-treated diabetic (mean ± SE)<br />

Group Myenteric plexus Submucous plexus<br />

Neuronal density (cm 2 ) Mean area <strong>of</strong> cell body (μm 2 ) Neuronal density (cm 2 ) Mean area <strong>of</strong> cell body (μm 2 )<br />

C 15 884 ± 712.0 234.2 ± 88.10 12 602 ± 233.8 230.6 ± 62.89<br />

D 13 483 ± 617.9 245.6 ± 77.19 11 383 ± 159.6 235.4 ± 67.99<br />

DT 14 426 ± 301.2 218.2 ± 72.10 12 682 ± 353.4 216.2 ± 62.03<br />

n = 5/myenteric plexus group; n = 3/submucous plexus group. C: Control; D: Diabetic; DT: EGb 76-treated diabetic.<br />

Table 3 Neuronal density and mean area <strong>of</strong> cell bodies <strong>of</strong> myenteric and submucosal neurons in the ileum <strong>of</strong> rat<br />

groups: control, diabetic and EGb 761-treated diabetic (mean ± SE)<br />

Group Myenteric plexus Submucous plexus<br />

Neuronal density (cm²) Mean area <strong>of</strong> cell body (μm²) Neuronal density (cm²) Mean area <strong>of</strong> cell body (μm²)<br />

C 16 522 ± 625.5 232.7 ± 82.97 11 657 ± 403.9 210.0 ± 59.18<br />

D 14 568 ± 424.7 251.4 ± 98.23 11 275 ± 281.9 231.3 ± 74.37<br />

DT 16 884 ± 366.1 239.3 ± 81.19 11 943 ± 299.3 204.5 ± 57.36<br />

n = 5/myenteric plexus group; n = 3/submucous plexus group. C: Control; D: Diabetic; DT: EGb 76-treated diabetic.<br />

A<br />

% Mean <strong>of</strong> neurons<br />

B<br />

% Mean <strong>of</strong> neurons<br />

0.075<br />

0.050<br />

0.025<br />

0.000<br />

0.075<br />

0.050<br />

0.025<br />

0.000<br />

submucosal neurons in the jejunum ranged between 106.1<br />

and 474.4 μm 2 in group C, between 102.3 to 523.4 μm 2 in<br />

group D and between 91.73 to 401.1 μm 2 in group DT.<br />

There were no significant differences between the mean<br />

cell body areas in groups C and D (P > 0.05). However,<br />

there was a significant reduction (P < 0.05) in group DT<br />

when compared to groups C and D (Table 2).<br />

WJG|www.wjgnet.com<br />

C<br />

D<br />

DT<br />

0 150 300 450 600 750 900<br />

Neuronal cell bodies areas in μm 2<br />

C<br />

D<br />

DT<br />

0 150 300 450 600 750 900<br />

Neuronal cell bodies areas in μm 2<br />

Figure 1 Neuronal behavior: area <strong>of</strong> cell body <strong>of</strong> myenteric (A) and submucosal<br />

(B) neurons, myosin-V immunoreactive in the jejunum, <strong>of</strong> control<br />

(C), diabetic (D) and diabetic-treated with EGb 761 (DT).<br />

da Silva GGP et al . Neuroprotection in enteric neurons<br />

A<br />

% Mean <strong>of</strong> neurons<br />

B<br />

% Mean <strong>of</strong> neurons<br />

0.075<br />

0.050<br />

0.025<br />

0.000<br />

0.075<br />

0.050<br />

0.025<br />

0.000<br />

C<br />

D<br />

DT<br />

0 150 300 450 600 750 900<br />

Neuronal cell bodies areas in μm 2<br />

C<br />

D<br />

DT<br />

0 150 300 450 600 750 900<br />

Neuronal cell bodies areas in μm 2<br />

Figure 2 Neuronal behavior: area <strong>of</strong> cell body <strong>of</strong> myenteric (A) and submucosal<br />

(B) neurons, myosin-V immunoreactive in the ileum, <strong>of</strong> control<br />

(C), diabetic (D) and diabetic-treated with EGb 761 (DT).<br />

The cell body area <strong>of</strong> myenteric neurons in the ileum<br />

ranged between 97.70 and 725.7 μm 2 in group C, between<br />

101.5 and 595.5 μm 2 in group D, and between 96.32 and<br />

512.9 μm 2 in group DT. There was a significant increase<br />

(P < 0.05) in group D when compared to C. No significant<br />

difference was observed when comparing group DT<br />

to groups C or D (Table 3). As for the ileum submucous<br />

901 February 21, 2011|Volume 17|Issue 7|

---

A<br />

da Silva GGP et al . Neuroprotection in enteric neurons<br />

D<br />

plexus, the area ranged between 89.54 and 426.2 μm 2 ,<br />

between 99.52 and 534.0 μm 2 in group D, and between<br />

72.77 and 435.0 μm 2 in group DT. There was a significant<br />

increase in the mean cell body area in group D (P < 0.05)<br />

when compared to C. The DT group showed no significant<br />

difference in mean cell body area when compared to<br />

group C (Table 3). In the submucous plexus, reduction<br />

in neuronal pr<strong>of</strong>ile area was greater than in the myenteric<br />

plexus; the values in the submucous plexus just below<br />

those <strong>of</strong> the control group.<br />

The distribution <strong>of</strong> the relative frequency <strong>of</strong> areas<br />

<strong>of</strong> cell bodies in the jejunum showed a displacement<br />

curve to the right in the myenteric plexus; thus showing<br />

a higher relative frequency <strong>of</strong> neurons at about 160 μm 2<br />

in both plexuses (Figure 1). There was a similarity in the<br />

curves <strong>of</strong> groups C and DT in both plexuses in the ileum<br />

(Figure 2). Group D showed a displacement to the right<br />

in both plexuses.<br />

DISCUSSION<br />

Streptozotocin (STZ) is widely used in experimental animal<br />

models to induce DM. Its cellular action includes<br />

irreversible changes in genetic material causing lethal<br />

alterations in the metabolism <strong>of</strong> β cells [24] . There is a reduction<br />

in overall myenteric plexus neuron population in<br />

animal models with chronic STZ-diabetes [11,12,25,26] . There<br />

are no studies <strong>of</strong> changes caused by diabetes in the overall<br />

neuronal population <strong>of</strong> the submucous plexus. Our study<br />

showed that the 120-d treatment with purified Ginkgo biloba<br />

extract (EGb 761) has a neuroprotective effect on the<br />

ileum myenteric plexus and on the jejunum submucous<br />

plexus <strong>of</strong> STZ-diabetic rats.<br />

Characteristic diabetic symptoms (polydipsia, polyuria<br />

WJG|www.wjgnet.com<br />

B<br />

20 μm 20 μm<br />

20 μm<br />

20 μm<br />

E<br />

Figure 3 Myosin-V immunoreactive myenteric neurons in the jejunum (A-C) and myosin-V immunoreactive submucosal neurons in the jejunum (D-F).<br />

There is a significant reduction in the neuronal density in the myenteric (B) and submucous (E) plexus in group diabetic. The neuronal density in the submucous<br />

plexus (F) was preserved in group EGb 76-treated (DT) (F). There was a significant reduction in the neuronal cell body area in group DT <strong>of</strong> both plexuses (C and F).<br />

20 μm<br />

C<br />

F<br />

20 μm<br />

and polyphagia) were observed in animals <strong>of</strong> D and DT<br />

groups. These data support the experimental model <strong>of</strong><br />

streptozotocin-induced diabetes [27-29] . The immunohistochemical<br />

technique, anti-myosin-V (Figures 3 and 4), was<br />

used to assess the effect <strong>of</strong> Ginkgo biloba extract (EGb<br />

761) on the enteric neuronal population. The protein myosin-V<br />

is present in cell bodies and projections <strong>of</strong> enteric<br />

neurons [30] and is being used as a pan-neuronal marker.<br />

The reduction <strong>of</strong> the myenteric neuron density in the<br />

jejunum was 15.12% in group D when compared to C (P<br />

< 0.05). The submucosal neuron density was 9.61% lower<br />

in group D when compared to C (P < 0.05). A reduction<br />

<strong>of</strong> 11.83% in myenteric neuron density was observed in<br />

the ileum in group D when compared to C (P < 0.05).<br />

The submucosal neuron density in the ileum was similar<br />

among the three groups. Several authors report the reduction<br />

<strong>of</strong> myenteric neuron density in rats with STZdiabetes<br />

in different regions <strong>of</strong> the gastrointestinal tract,<br />

including the cecum [31] , ileum [11,26] , jejunum [25] and proximal<br />

colon [12] . There are no studies in the submucosal plexus<br />

<strong>of</strong> the total neuronal population in STZ-diabetes models.<br />

Pereira et al [26] reported a 24% reduction in the number<br />

<strong>of</strong> myosin-V myenteric neurons in the ileum (after<br />

120 d) <strong>of</strong> diabetic rats when compared to non-diabetic<br />

ones. De Freitas et al [25] observed a 37.9% neuronal loss <strong>of</strong><br />

myosin-V myenteric neurons in the jejunum <strong>of</strong> diabetic rats<br />

when compared to non-diabetic animals, also after 120 d.<br />

These studies used 90-d-old animals at the beginning <strong>of</strong><br />

the experiment and our study was carried out with 150-dold<br />

rats, which may have contributed to the neuronal loss<br />

variation due to age.<br />

The degenerative changes that affect the enteric nervous<br />

system seen in DM are due to metabolic disorders.<br />

High oxidative stress, resulting from the imbalance be-<br />

902 February 21, 2011|Volume 17|Issue 7|

---

A<br />

D<br />

tween ROS production and neutralization, is a well established<br />

mechanism <strong>of</strong> diabetic neuropathy pathogenesis<br />

and other complications [32,33] . The levels <strong>of</strong> endogenous<br />

and exogenous antioxidants are reduced in this condition.<br />

New studies have confirmed the destruction <strong>of</strong> endogenous<br />

antioxidants in peripheral nerves and the increased<br />

production <strong>of</strong> free radicals in the vasa nervorum [4] .<br />

Ginkgo biloba extract is widely used for its neuroprotective<br />

and antioxidant activity in several cardiovascular and<br />

neurologic disorders [34,35] . The Ginkgo biloba extract (EGb<br />

761) was given at a daily dose <strong>of</strong> 50 mg/kg body weight<br />

for 120 d in this experiment. This standardized extract<br />

contains 24% flavonoid glycosides (quercetin, kaempferol,<br />

isorhamnetin) and 6% terpene lactones (ginkgolides, bilobalides).<br />

The EGb 761 extract components eliminate<br />

free radicals such as the hydroxyl radical and the superoxide<br />

anion [36] . Quercetin is a powerful antioxidant within<br />

the flavonoid family due to its molecular configuration<br />

which is capable <strong>of</strong> eliminating free radicals [37] .<br />

The myenteric neuronal density in the jejunum in the<br />

DT group was 9.17% lower when compared to C, though<br />

this reduction is not significant. On the other hand, the<br />

submucosal neuronal density in DT had very similar values<br />

to those <strong>of</strong> group C. The treatment with EGb 671<br />

resulted in the preservation <strong>of</strong> the neuronal population<br />

in the ileum, represented by very similar values to those<br />

<strong>of</strong> the control group (Table 2), thus demonstrating a<br />

neuroprotective effect on this complex. The submucosal<br />

neuronal density in this segment was similar in all three<br />

groups. The Ginkgo biloba extract reduces the oxidative<br />

stress in diabetic rats by increasing the activity <strong>of</strong> antioxidant<br />

enzymes [38] . Wu et al [39] reported that this extract may<br />

be vital to postpone diabetic cataract, since their studies<br />

showed that, besides inhibiting aldose reductase activity,<br />

Ginkgo biloba also inhibits apoptosis induced by high glu-<br />

WJG|www.wjgnet.com<br />

B<br />

20 μm 20 μm<br />

20 μm<br />

20 μm<br />

E<br />

da Silva GGP et al . Neuroprotection in enteric neurons<br />

Figure 4 Myosin-V immunoreactive myenteric neurons in the ileum (A-C) and myosin-V immunoreactive submucosal neurons in the jejunum (D-F). There<br />

is a significant reduction in the neuronal density in the myenteric plexus (B), but the neuronal density was preserved in this plexus in group EGb 76-treated (DT) (C).<br />

There is a significant increase in the neuronal cell body area in group diabetic in the myenteric (B) and submucous (E) plexuses. There was a significant reduction in<br />

the neuronal cell body area in group DT in the submucous plexus (F).<br />

20 μm<br />

C<br />

F<br />

20 μm<br />

cose levels by reducing the Bax/Bcl2 ratio. This high ratio<br />

harms the mitochondria which release apoptosis-inducing<br />

proteins, such as the apoptosis-inducing factor, leading to<br />

the activation <strong>of</strong> caspase-3 via caspase 9. The myenteric<br />

plexus neuroprotection, seen only in the ileum, is similar<br />

to results in aging models [40] where 120-d treatment <strong>of</strong> rats<br />

with the same dose <strong>of</strong> Ginkgo biloba extract was more efficient<br />

in the ileum myenteric plexus than in the jejunum.<br />

Few studies have been carried out in the submucous<br />

plexus due to the difficulty <strong>of</strong> dissection. Some authors<br />

have reported changes in neuronal subpopulations through<br />

the neurotransmitter immunoreactivity. Belai et al [41] observed<br />

an increase in VIP and neuropeptide Y immunoreactivity<br />

when analyzing the submucous plexus in the<br />

ileum <strong>of</strong> STZ-diabetic rats aged 8 and 16 wk. They also<br />

observed a reduction in calcitonin gene-related peptide<br />

(CGRP) immunoreactivity. However, no change in substance<br />

P immunoreactivity or dopamine beta hydroxylase<br />

was seen. VIP-ergic neurons <strong>of</strong> diabetic rats show increased<br />

immunoreactivity in the jejunum [42] and ileum [43]<br />

submucous plexus.<br />

The mean cell body areas <strong>of</strong> myenteric neurons in the<br />

jejunum were similar in groups C and D. These results are<br />

similar to those observed by De Freitas et al [25] , who did<br />

not observe an increase in the mean area <strong>of</strong> the cell body<br />

<strong>of</strong> immunoreactive myosin-V neurons in the jejunum <strong>of</strong><br />

diabetic rats when compared to non-diabetic rats. The<br />

mean areas <strong>of</strong> cell bodies <strong>of</strong> submucosal neurons in the<br />

jejunum were similar in groups C and D. Studies on morphometric<br />

changes in the submucosal plexus caused by<br />

diabetic syndrome report an increase in the mean area <strong>of</strong><br />

the cell body <strong>of</strong> neuronal subpopulations. Defani et al [42]<br />

observed an increase in the mean area <strong>of</strong> the cell body <strong>of</strong><br />

submucous VIP-ergic neurons in the jejunum. The technique<br />

used to stain the total population showed no change<br />

903 February 21, 2011|Volume 17|Issue 7|

---

da Silva GGP et al . Neuroprotection in enteric neurons<br />

in the mean area <strong>of</strong> submucosal neurons in the jejunum.<br />

The mean area <strong>of</strong> the cell body <strong>of</strong> myenteric neurons in<br />

the ileum was 7.44% (P < 0.05) higher in group D than<br />

in group C in our study. This increase was also observed<br />

by Zanoni et al [11] and Pereira et al [26] in Wistar rats after a<br />

120-d experimental period. The mean area <strong>of</strong> the body<br />

cell <strong>of</strong> submucosal neurons in the ileum showed a statistically<br />

significant increase <strong>of</strong> 9.2% (P < 0.05) in group D<br />

when compared to C. Zanoni et al [43] reported an increase<br />

in the mean area <strong>of</strong> the body cell <strong>of</strong> submucous VIP-ergic<br />

neurons in the ileum.<br />

The increase in the neuronal cell body area in rats with<br />

chronic diabetes may be the result <strong>of</strong> neuronal edema [11] .<br />

The aldose reductase hyperactivity observed in diabetes<br />

is associated with increased levels <strong>of</strong> sorbitol [44] which increases<br />

the intracellular osmolarity, resulting in edema and<br />

neuronal lesions [43] .<br />

The EGb 761 treatment induced a reduction <strong>of</strong> 6.8%<br />

in the mean area <strong>of</strong> the cell body in the jejunum myenteric<br />

neurons in DT when compared to C (P < 0.05).<br />

The mean area <strong>of</strong> the cell body <strong>of</strong> submucosal neurons<br />

decreased 6.2% in group DT when compared to C (P <<br />

0.05). The mean area <strong>of</strong> the cell body <strong>of</strong> myenteric and<br />

submucosal neurons in the ileum in DT was reduced to<br />

values similar to group C. Schneider et al [40] observed that<br />

the EGb 761 treatment reduced the mean area <strong>of</strong> myenteric<br />

neuronal cell bodies in the jejunum and ileum <strong>of</strong><br />

aging rats. However, studies by Perez et al [45] in the large<br />

intestine treated with EGb 761 at a dose <strong>of</strong> 50 mg/kg <strong>of</strong><br />

body weight observed that the EGb 761 extract promotes<br />

an increase in the mean area <strong>of</strong> myenteric neurons in rats<br />

in the aging process. These results show that the response<br />

to the use <strong>of</strong> antioxidants such as the Gingko biloba extract<br />

may be different according to the segment evaluated.<br />

This study showed that treatment with Ginkgo biloba<br />

extract reduced the area <strong>of</strong> the cell body <strong>of</strong> myenteric and<br />

submucosal neurons in the jejunum and ileum <strong>of</strong> diabetictreated<br />

rats (group DT) when compared to non-treated diabetic<br />

rats (group D). However, the reduction in the mean<br />

area <strong>of</strong> the cell body <strong>of</strong> myenteric neurons in the ileum<br />

was not significant. The inhibitory action <strong>of</strong> Ginkgo biloba<br />

on aldose redutase [19] enzyme activity may be responsible<br />

for the reduction in the mean area <strong>of</strong> neuronal cell bodies<br />

observed in rats treated with EGb 761 (DT group).<br />

In conclusion, our results show that the 50 mg/kg <strong>of</strong><br />

body weight dose <strong>of</strong> standardized Ginkgo biloba extract<br />

(EGb761) has a neuroprotective effect on the ileum myenteric<br />

plexus and on the jejunum submucous plexus <strong>of</strong><br />

STZ-diabetic rats.<br />

ACKNOWLEDGMENTS<br />

The authors wish to thank Dr. Enilza Maria Espreafico<br />

(USP-Ribeirão Preto, Brazil) for her invaluable assistance<br />

and support in the production <strong>of</strong> the anti-myosin-V antibody,<br />

Maria Eurides do Carmo Cancino, Maria dos Anjos<br />

Fortunato, Valdir Trombeli and José Antônio de Souza<br />

(UEM, Brazil) for their excellent technical support, and<br />

WJG|www.wjgnet.com<br />

Ali Suleiman Mahmoud for translating the text. We gratefully<br />

acknowledge Altana Pharma for supplying the Ginkgo<br />

biloba extract (EGb 761).<br />

COMMENTS<br />

Background<br />

Gingko biloba extract possesses various biological activities and has been<br />

shown to be useful in diabetes treatment. Oxidative stress has been known to<br />

play an important role in the development and progression <strong>of</strong> diabetes mellitus<br />

(DM), and reactive oxygen species (ROS) production is a direct consequence <strong>of</strong><br />

hyperglycemia. Chronic hyperglycemia in diabetes is involved in direct neuronal<br />

damage caused by intracellular glucose which leads to altered neurotransmitter<br />

functions and reduced motor activity. Oxygen free radicals are also thought to<br />

play an important role in the diabetic and hypoxic condition <strong>of</strong> cells. Success <strong>of</strong><br />

Ginkgo biloba application is determined by its main active substances, flavonoids<br />

(flavone glycosides, primarily composed <strong>of</strong> quercetin) and terpenoids (ginkgolides<br />

and bilobalides). Ginkgo biloba can improve hemodynamics, scavenge ROS,<br />

suppress platelet-activating factor (PAF) and relax vascular smooth muscle.<br />

Research frontiers<br />

Gastrointestinal (GI) afflictions are not normally life threatening but do pr<strong>of</strong>oundly<br />

affect quality <strong>of</strong> life. Diabetic patients experience a wide range <strong>of</strong> GI discomforts including<br />

nausea, vomiting, heartburn, diarrhea, constipation, abdominal pain and fecal<br />

incontinence. The high morbidity, high socioeconomic costs and lack <strong>of</strong> specific<br />

treatments are key factors that define the relevance <strong>of</strong> DM for human health and<br />

the importance <strong>of</strong> research on neuronal protective agents. Some studies provide a<br />

strong case for the application <strong>of</strong> Ginkgo biloba in diabetic nephropathy therapy.<br />

Innovations and breakthroughs<br />

Ginkgo biloba has been ascertained to be protective against DM. However,<br />

there has been little in the literature reporting on the protective effects <strong>of</strong> Ginkgo<br />

biloba on the enteric nervous system <strong>of</strong> the small intestine <strong>of</strong> streptozotocininduced<br />

diabetic rats in vivo.<br />

Applications<br />

This study indicated that standardized extract <strong>of</strong> Ginkgo biloba (EGb 761) could<br />

improve antioxidant ability and protect the enteric nervous system <strong>of</strong> the small<br />

intestine <strong>of</strong> streptozotocin-induced diabetic rats in vivo. These biological activities<br />

have considerable potential in diabetes mellitus treatment.<br />

Peer review<br />

The authors investigated the effect <strong>of</strong> Ginkgo biloba extract on the enteric neurons<br />

on the small intestine <strong>of</strong> diabetic rats. They found purified Ginkgo biloba<br />

extract has a neuroprotective effect on the jejunum submucous plexus and the<br />

myenteric plexus <strong>of</strong> the ileum <strong>of</strong> diabetic rats. This is a well written paper.<br />

REFERENCES<br />

1 American Diabetes Association. Diagnosis and classification<br />

<strong>of</strong> diabetes mellitus. Diabetes Care 2008; 31 Suppl 1: S55-S60<br />

2 Bortolotto LA. [Modifications <strong>of</strong> structural and functional<br />

properties <strong>of</strong> large arteries in diabetes mellitus]. Arq Bras Endocrinol<br />

Metabol 2007; 51: 176-184<br />

3 Aguiar LG, Villela NR, Bouskela E. [Microcirculation in diabetes:<br />

implications for chronic complications and treatment<br />

<strong>of</strong> the disease]. Arq Bras Endocrinol Metabol 2007; 51: 204-211<br />

4 Obrosova IG. Diabetes and the peripheral nerve. Biochim Biophys<br />

Acta 2009; 1792: 931-940<br />

5 Rang HP, Dali MM, Ritter JM. O pâncreas endócrino e o<br />

controle da glicemia In: Farmacologia. 4th ed. Rio de Janeiro:<br />

Guanabara Koogan, 2000: 318-329<br />

6 Boucek P. Advanced Diabetic Neuropathy: A Point <strong>of</strong> no Return?<br />

Rev Diabet Stud 2006; 3: 143-150<br />

7 Vinik AI, Mehrabyan A. Diabetic neuropathies. Med Clin<br />

North Am 2004; 88: 947-999, xi<br />

8 Chandrasekharan B, Srinivasan S. Diabetes and the enteric<br />

nervous system. Neurogastroenterol Motil 2007; 19: 951-960<br />

9 Pasricha PJ, Pehlivanov ND, Gomez G, Vittal H, Lurken MS,<br />

Farrugia G. Changes in the gastric enteric nervous system<br />

and muscle: a case report on two patients with diabetic gas-<br />

904 February 21, 2011|Volume 17|Issue 7|

---

troparesis. BMC Gastroenterol 2008; 8: 21<br />

10 Belai A, Lincoln J, Milner P, Burnstock G. Progressive<br />

changes in adrenergic, serotonergic, and peptidergic nerves<br />

in proximal colon <strong>of</strong> streptozotocin-diabetic rats. Gastroenterology<br />

1988; 95: 1234-1241<br />

11 Zanoni JN, Buttow NC, Bazotte RB, Miranda Neto MH.<br />

Evaluation <strong>of</strong> the population <strong>of</strong> NADPH-diaphorase-stained<br />

and myosin-V myenteric neurons in the ileum <strong>of</strong> chronically<br />

streptozotocin-diabetic rats treated with ascorbic acid. Auton<br />

Neurosci 2003; 104: 32-38<br />

12 Tashima CM, Tronchini EA, Pereira RV, Bazotte RB, Zanoni<br />

JN. Diabetic rats supplemented with L-glutamine: a study <strong>of</strong><br />

immunoreactive myosin-V myenteric neurons and the proximal<br />

colonic mucosa. Dig Dis Sci 2007; 52: 1233-1241<br />

13 Figueroa-Romero C, Sadidi M, Feldman EL. Mechanisms <strong>of</strong><br />

disease: the oxidative stress theory <strong>of</strong> diabetic neuropathy.<br />

Rev Endocr Metab Disord 2008; 9: 301-314<br />

14 Ramakrishna V, Jailkhani R. Evaluation <strong>of</strong> oxidative stress in<br />

Insulin Dependent Diabetes Mellitus (IDDM) patients. Diagn<br />

Pathol 2007; 2: 22<br />

15 Bonnefont-Rousselot D. Glucose and reactive oxygen species.<br />

Curr Opin Clin Nutr Metab Care 2002; 5: 561-568<br />

16 Vincent AM, Russell JW, Low P, Feldman EL. Oxidative<br />

stress in the pathogenesis <strong>of</strong> diabetic neuropathy. Endocr Rev<br />

2004; 25: 612-628<br />

17 Shirpoor A, Ansari MH, Salami S, Pakdel FG, Rasmi Y. Effect<br />

<strong>of</strong> vitamin E on oxidative stress status in small intestine <strong>of</strong><br />

diabetic rat. <strong>World</strong> J Gastroenterol 2007; 13: 4340-4344<br />

18 Aksoy N, Vural H, Sabuncu T, Arslan O, Aksoy S. Beneficial<br />

effects <strong>of</strong> vitamins C and E against oxidative stress in diabetic<br />

rats. Nutr Res 2005; 25: 625-630<br />

19 Head KA. Natural therapies for ocular disorders, part two:<br />

cataracts and glaucoma. Altern Med Rev 2001; 6: 141-166<br />

20 Calapai G, Crupi A, Firenzuoli F, Marciano MC, Squadrito<br />

F, Inferrera G, Parisi A, Rizzo A, Crisafulli C, Fiore A, Caputi<br />

AP. Neuroprotective effects <strong>of</strong> Ginkgo biloba extract in brain<br />

ischemia are mediated by inhibition <strong>of</strong> nitric oxide synthesis.<br />

Life Sci 2000; 67: 2673-2683<br />

21 Maclennan KM, Darlington CL, Smith PF. The CNS effects <strong>of</strong><br />

Ginkgo biloba extracts and ginkgolide B. Prog Neurobiol 2002;<br />

67: 235-257<br />

22 Husstedt IW, Grotemeyer KH, Evers S, Staschewski F, Wertelewski<br />

R. Progression <strong>of</strong> distal symmetric polyneuropathy<br />

during diabetes mellitus: clinical, neurophysiological,<br />

haemorheological changes and self-rating scales <strong>of</strong> patients.<br />

Eur Neurol 1997; 37: 90-94<br />

23 Buttow NC, Santin M, Macedo LC, Neres Teixeira AC, Novakowski<br />

GC, Bolonheis Armelin TR, Assmann K. Study <strong>of</strong> the<br />

myenteric and submucous plexuses after BAC treatment in<br />

the intestine <strong>of</strong> rats. Biocell 2004; 28: 135-142<br />

24 Delfino VDA, Figueiredo JF, Matsuo T, Favero ME, Matni<br />

AM, Mocelin AJ. Streptozotocin-induced diabetes mellitus:<br />

long-term comparison <strong>of</strong> two drug administration routes. J<br />

Bras Nefrol 2002; 24: 31-36<br />

25 De Freitas P, Natali MR, Pereira RV, Miranda Neto MH, Zanoni<br />

JN. Myenteric neurons and intestinal mucosa <strong>of</strong> diabetic<br />

rats after ascorbic acid supplementation. <strong>World</strong> J Gastroenterol<br />

2008; 14: 6518-6524<br />

26 Pereira RV, de Miranda-Neto MH, da Silva Souza ID, Zanoni<br />

JN. Vitamin E supplementation in rats with experimental diabetes<br />

mellitus: analysis <strong>of</strong> myosin-V and nNOS immunoreactive<br />

myenteric neurons from terminal ileum. J Mol Histol 2008;<br />

39: 595-603<br />

27 Romano EB, Miranda-Neto MH, Cardoso RCS. Preliminary<br />

investigation about the effects <strong>of</strong> streptozotocin-induced<br />

WJG|www.wjgnet.com<br />

da Silva GGP et al . Neuroprotection in enteric neurons<br />

chronic diabetes on the nerve cell number and size <strong>of</strong> myenteric<br />

ganglia in rat colon. Rev Chil Anat 1996; 14: 139-145<br />

28 Büttow NC, Miranda Neto MH, Bazotte RB. Morphological<br />

and quantitative study <strong>of</strong> the myenteric plexus <strong>of</strong> the duodenum<br />

<strong>of</strong> streptozotocin-induced diabetic rats. Arq Gastroenterol<br />

1997; 34: 34-42<br />

29 Hernandes L, Bazotte RB, Gama P, Miranda-Neto MH.<br />

Streptozotocin-induced diabetes duration is important to<br />

determine changes in the number and basophily <strong>of</strong> myenteric<br />

neurons. Arq Neuropsiquiatr 2000; 58: 1035-1039<br />

30 Drengk AC, Kajiwara JK, Garcia SB, Carmo VS, Larson RE,<br />

Zucoloto S, Espreafico EM. Immunolocalisation <strong>of</strong> myosin-V<br />

in the enteric nervous system <strong>of</strong> the rat. J Auton Nerv Syst<br />

2000; 78: 109-112<br />

31 Zanoni JN, de Miranda Neto MH, Bazotte RB, de Souza RR.<br />

Morphological and quantitative analysis <strong>of</strong> the neurons <strong>of</strong><br />

the myenteric plexus <strong>of</strong> the cecum <strong>of</strong> streptozotocin-induced<br />

diabetic rats. Arq Neuropsiquiatr 1997; 55: 696-702<br />

32 Van Dam PS, Van Asbeck BS, Erkelens DW, Marx JJ, Gispen<br />

WH, Bravenboer B. The role <strong>of</strong> oxidative stress in neuropathy<br />

and other diabetic complications. Diabetes Metab Rev 1995; 11:<br />

181-192<br />

33 Figueroa-Romero C, Sadidi M, Feldman EL. Mechanisms <strong>of</strong><br />

disease: the oxidative stress theory <strong>of</strong> diabetic neuropathy.<br />

Rev Endocr Metab Disord 2008; 9: 301-314<br />

34 Diamond BJ, Shiflett SC, Feiwel N, Matheis RJ, Noskin O,<br />

Richards JA, Schoenberger NE. Ginkgo biloba extract: mechanisms<br />

and clinical indications. Arch Phys Med Rehabil 2000; 81:<br />

668-678<br />

35 Defeudis FV. Bilobalide and neuroprotection. Pharmacol Res<br />

2002; 46: 565-568<br />

36 Ni Y, Zhao B, Hou J, Xin W. Preventive effect <strong>of</strong> Ginkgo<br />

biloba extract on apoptosis in rat cerebellar neuronal cells induced<br />

by hydroxyl radicals. Neurosci Lett 1996; 214: 115-118<br />

37 Boots AW, Haenen GR, Bast A. Health effects <strong>of</strong> quercetin:<br />

from antioxidant to nutraceutical. Eur J Pharmacol 2008; 585:<br />

325-337<br />

38 Lu Q, Yin XX, Wang JY, Gao YY, Pan YM. Effects <strong>of</strong> Ginkgo<br />

biloba on prevention <strong>of</strong> development <strong>of</strong> experimental diabetic<br />

nephropathy in rats. Acta Pharmacol Sin 2007; 28: 818-828<br />

39 Wu ZM, Yin XX, Ji L, Gao YY, Pan YM, Lu Q, Wang JY.<br />

Ginkgo biloba extract prevents against apoptosis induced by<br />

high glucose in human lens epithelial cells. Acta Pharmacol Sin<br />

2008; 29: 1042-1050<br />

40 Schneider LC, Perez GG, Banzi SR, Zanoni JN, Natali MR,<br />

Buttow NC. Evaluation <strong>of</strong> the effect <strong>of</strong> Ginkgo biloba extract<br />

(EGb 761) on the myenteric plexus <strong>of</strong> the small intestine <strong>of</strong><br />

Wistar rats. J Gastroenterol 2007; 42: 624-630<br />

41 Belai A, Burnstock G. Changes in adrenergic and peptidergic<br />

nerves in the submucous plexus <strong>of</strong> streptozocin-diabetic rat<br />

ileum. Gastroenterology 1990; 98: 1427-1436<br />

42 Defani MA, Zanoni JN, Natali MR, Bazotte RB, de Miranda-<br />

Neto MH. Effect <strong>of</strong> acetyl-L-carnitine on VIP-ergic neurons in<br />

the jejunum submucous plexus <strong>of</strong> diabetic rats. Arq Neuropsiquiatr<br />

2003; 61: 962-967<br />

43 Zanoni JN, Hernandes L, Bazotte RB, Miranda Neto MH.<br />

Terminal ileum submucous plexus: Study <strong>of</strong> the VIP-ergic<br />

neurons <strong>of</strong> diabetic rats treated with ascorbic acid. Arq Neuropsiquiatr<br />

2002; 60: 32-37<br />

44 Obrosova IG. Increased sorbitol pathway activity generates<br />

oxidative stress in tissue sites for diabetic complications. Antioxid<br />

Redox Signal 2005; 7: 1543-1552<br />

45 Perez GG, Schneider LC, Buttow NC. Ginkgo biloba (EGb<br />

761) extract: effects on the myenteric plexus <strong>of</strong> the large intestine<br />

in Wistar rats. Dig Dis Sci 2009; 54: 232-237<br />

S- Editor Tian L L- Editor Logan S E- Editor Zheng XM<br />

905 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.906<br />

ORIGINAL ARTICLE<br />

Outcome <strong>of</strong> non surgical hepatic decompression procedures<br />

in Egyptian patients with Budd-Chiari<br />

Ahmed Eldorry, Eman Barakat, Heba Abdella, Sara Abdelhakam, Mohamed Shaker, Amr Hamed,<br />

Mohammad Sakr<br />

Ahmed Eldorry, Mohamed Shaker, Department <strong>of</strong> Radiodiagnosis<br />

and Interventional Radiology, Faculty <strong>of</strong> Medicine, Ain<br />

Shams University, Cairo 11341, Egypt<br />

Eman Barakat, Heba Abdella, Sara Abdelhakam, Amr<br />

Hamed, Mohammad Sakr, Department <strong>of</strong> Tropical Medicine,<br />

Faculty <strong>of</strong> Medicine, Ain Shams University, Cairo 11341, Egypt<br />

Author contributions: Eldorry A and Sakr M contributed<br />

equally to this work; Sakr M, Eldorry A, Barakat E, Abdella<br />

H, Abdelhakam S and Hamed A designed the research; Abdelhakam<br />

S, Hamed A and Shaker M performed the research;<br />

Eldorry A, Sakr M, Barakat E, Abdella H, Abdelhakam S and<br />

Shaker M contributed analytic tools; Sakr M, Eldorry A, Barakat<br />

E, Abdella H, Abdelhakam S and Hamed A analyzed the<br />

data; Barakat E, Abdella H and Abdelhakam S wrote the paper.<br />

Correspondence to: Sara Abdelhakam, MD, Department <strong>of</strong><br />

Tropical Medicine, Faculty <strong>of</strong> Medicine, Ain Shams University,<br />

Cairo 11341, Egypt. saratropical@yahoo.com<br />

Telephone: +20-101601548 Fax: +20-2-22598751<br />

Received: August 4, 2010 Revised: September 29, 2010<br />

Accepted: October 6, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To evaluate outcome <strong>of</strong> patients with Budd-<br />

Chiari syndrome after balloon angioplasty ± stenting<br />

or transjugular intrahepatic portosystemic shunt (TIPS).<br />

METHODS: Twenty five patients with Budd-Chiari<br />

syndrome admitted to Ain Shams University Hospitals,<br />

Tropical Medicine Department were included. Twelve<br />

patients (48%) with short segment occlusion were<br />

candidates for angioplasty; with stenting in ten cases<br />

and without stenting in two. Thirteen patients (52%)<br />

had Transjugular Intrahepatic Portosystemic Shunt. Patients<br />

were followed up for 12-32 mo.<br />

RESULTS: Patency rate in patients who underwent<br />

angioplasty ± stenting was 83.3% at one year and at<br />

end <strong>of</strong> follow up. The need <strong>of</strong> revision was 41.6% with<br />

one year survival <strong>of</strong> 100%, dropped to 91.6% at end<br />

WJG|www.wjgnet.com<br />

906<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 906-913<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

<strong>of</strong> follow up. In patients who had Transjugular Intrahepatic<br />

Portosystemic Shunt, patency rate was 92.3% at<br />

one year, dropped to 84.6% at end <strong>of</strong> follow up. The<br />

need <strong>of</strong> revision was 38.4% with one year and end <strong>of</strong><br />

follow up survival <strong>of</strong> 100%. Patients with patent shunts<br />

showed marked improvement compared to those with<br />

occluded shunts.<br />

CONCLUSION: Morbidity and mortality following angioplasty<br />

± stenting and TIPS are low with satisfactory<br />

outcome. Proper patient selection and management <strong>of</strong><br />

shunt dysfunction are crucial in improvement.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Angioplasty; Stenting; Transjugular Intrahepatic<br />

portosystemic shunt; Patency rate<br />

Peer reviewer: Bijan Eghtesad, Dr, Associate Pr<strong>of</strong>essor, Department<br />

<strong>of</strong> General Surgery, Cleveland Clinic Foundation,<br />

9500 Euclid Avenue, Cleveland, OH 44195, United States<br />

Eldorry A, Barakat E, Abdella H, Abdelhakam S, Shaker M,<br />

Hamed A, Sakr M. Outcome <strong>of</strong> non surgical hepatic decompression<br />

procedures in Egyptian patients with Budd-Chiari. <strong>World</strong><br />

J Gastroenterol 2011; 17(7): 906-913 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/full/v17/i7/906.htm DOI:<br />

http://dx.doi.org/10.3748/wjg.v17.i7.906<br />

INTRODUCTION<br />

Budd-Chiari syndrome (BCS) results from hepatic venous<br />

outflow obstruction at any level, from hepatic<br />

venules to the right atrium [1] . If obstruction is due to endoluminal<br />

venous lesion like thrombosis, primary BCS is<br />

considered. In secondary BCS, the cause originates from<br />

neighboring structures like extrinsic compression or tumor<br />

invasion [2] .<br />

Imaging studies combined with clinical information<br />

February 21, 2011|Volume 17|Issue 7|

---

Table 2 Details <strong>of</strong> patients who needed revisions and their follow up (n = 10)<br />

Patient Intervention Time <strong>of</strong> dysfunction Action taken No <strong>of</strong> revisions 1 yr patency End <strong>of</strong> FUP patency<br />

23 yr F Angioplasty without<br />

stenting<br />

Table 3 Patient survival n (%)<br />

Figure 1 shows frequency <strong>of</strong> all complications in total<br />

procedures done [Twenty six angioplasty ± stenting procedures<br />

(12 as primary intervention and 14 as a trial for<br />

maintenance <strong>of</strong> previously occluded angioplasty or TIPS)<br />

and 16 TIPS procedures (13 as primary intervention and<br />

3 in patients with occluded stents following angioplasty in<br />

whom redilatation was not possible)].<br />

In total procedures done (whether primary or revision<br />

procedures), the frequency <strong>of</strong> angioplasty dysfunction<br />

was 53.85% (14 out <strong>of</strong> 26 procedures) and the<br />

frequency <strong>of</strong> TIPS dysfunction was 43.75% (7 out <strong>of</strong> 16<br />

procedures).<br />

Statistical analysis<br />

The mean duration <strong>of</strong> follow up was 20.04 ± 7.817 mo<br />

(ranging from 12-32 mo). One year survival rate was<br />

100% for all patients and at the end <strong>of</strong> follow up survival<br />

rate was 96% due to death <strong>of</strong> one patient at the 17th<br />

mo <strong>of</strong> follow up as shown in Table 3.<br />

Figure 2A shows patency rate in patients who underwent<br />

angioplasty ± stenting procedures; it was 11/12<br />

(91.7%) at 9 mo (due to persistent shunt occlusion in one<br />

WJG|www.wjgnet.com<br />

Day 7 and Day 10 TIPS was done, occluded at<br />

day 10; then re-angioplasty was<br />

done 1<br />

2 Patent Patent at 20th mo<br />

27 yr M Angioplasty and stenting Day 7 and 2nd yr Angioplasty was done-then<br />

angioplasty + thrombectomy<br />

2 Patent Patent at 24th mo<br />

28 yr F Angioplasty and stenting 4th mo Angioplasty + local<br />

thrombolytic therapy<br />

1 Patent Patent at 12th mo<br />

30 yr F Angioplasty and stenting 1st, 4th, 6th and 9th mo TIPS was done-then angioplasty<br />

(3 times)<br />

4 Occluded at 9th mo Occluded at 24th mo<br />

28 yr M Angioplasty and stenting 3rd mo and 14th mo Angioplasty + stent was donethen<br />

mesoatrial shunt<br />

1 Occluded at 1 yr Dead 2 at 17th mo<br />

27 yr F TIPS Day 1 (stent occlusion and migration<br />

to portal vein) - Re (TIPS)<br />

1 Patent Patent at 20th m<br />

33 yr F TIPS Day 3 Angioplasty + thrombectomy +<br />

systemic thrombolytic therapy<br />

1 Patent Patent at 32nd mo<br />

37 yr F TIPS Day 7 and 1st mo Angioplasty (2 times) 2 Patent Patent at 12th mo<br />

27 yr M TIPS Day 7, 3rd and 8th mo Angioplasty (3 times) 3 Patent Occluded at 20th mo<br />

17 yr M TIPS 1st mo Patient refused intervention 0 Occluded Occluded at 12th mo<br />

1 Patient had angioplasty dysfunction at Day 7, so transjugular intrahepatic portosystemic shunt (TIPS) was done but was occluded at Day 10, so angioplasty<br />

<strong>of</strong> TIPS stent was done; 2 Cause <strong>of</strong> death: Intraperitoneal bleeding. Follow up period: Minimum (12 mo), Maximum (32 mo). F: Female; M: Male; yr: Years<br />

old; FUP: Follow up.<br />

Angioplasty TIPS Total<br />

One year<br />

Alive 12 (100) 13 (100) 25 (100)<br />

Dead 0 (0) 0 (0) 0 (0)<br />

End <strong>of</strong> follow up<br />

Alive 11 (91.6) 13 (100) 24 (96)<br />

Dead 1 (8.4) 0 (0) 1 (4)<br />

Because <strong>of</strong> death <strong>of</strong> one patient only out <strong>of</strong> 25; Kaplan–Meier curve couldn’t<br />

be drawn for patient survival. TIPS: Transjugular intrahepatic portosystemic<br />

shunt.<br />

Eldorry A et al . Non surgical hepatic decompression in Budd-Chiari<br />

%<br />

60<br />

50<br />

40<br />

30<br />

20<br />

10<br />

0<br />

11.53%<br />

Angioplasty<br />

TIPS<br />

18.75%<br />

0%<br />

12.50% 11.53%<br />

25%<br />

3.84% 6.25%<br />

53.85%<br />

Sepsis Transient HE Bleeding Stent Shunt<br />

43.75%<br />

migration dysfunction<br />

Figure 1 Procedure complications. Transient hepatic encephalopathy (HE):<br />

HE lasting 2-3 d after procedure with rapid response to treatment. Bleeding was<br />

either intra-peritoneal or hemobilia. TIPS: Transjugular intrahepatic portosystemic<br />

shunt.<br />

patient). Patency rate dropped to 10/12 (83.3%) at one<br />

year and continued till the end <strong>of</strong> follow up at 32 mo. (There<br />

was persistent shunt occlusion in 2 patients in spite <strong>of</strong> repeated<br />

revisions and optimal anticoagulation therapy).<br />

Figure 2B shows patency rate in patients who had TIPS<br />

procedures; it was 12/13 (92.3%) at one year (due to persistent<br />

shunt occlusion in one patient despite repeated revisions).<br />

Patency rate dropped to 11/13 (84.6%) at 20 mo<br />

and this continued till the end <strong>of</strong> follow up at 32 mo (due<br />

to persistent shunt occlusion in another patient).<br />

At one year <strong>of</strong> follow up, only three patients <strong>of</strong><br />

25 (12%) had occluded shunts. Patients with occluded<br />

shunts showed no improvement regarding their clinical<br />

manifestations, laboratory pr<strong>of</strong>ile and performance<br />

status. On the contrary, patients with patent shunts (22<br />

<strong>of</strong> 25; 88%) showed marked improvement as shown in<br />

Tables 4 and 5.<br />

909 February 21, 2011|Volume 17|Issue 7|

---

A 1.0<br />

Survival function Survival function<br />

0<br />

B 1.0<br />

Cum survival<br />

Eldorry A et al . Non surgical hepatic decompression in Budd-Chiari<br />

0.8<br />

0.6<br />

0.4<br />

0.2<br />

0.0<br />

DISCUSSION<br />

0 10 20 30 40<br />

Occlusion time or end <strong>of</strong> followup<br />

This is the first study that addresses the short term outcome<br />

<strong>of</strong> interventional radiology procedures in management<br />

<strong>of</strong> Egyptian patients with BCS. In this study, 12<br />

patients (48%) had short segment occlusion that enabled<br />

us to perform angioplasty with stenting in ten cases and<br />

without stenting in two cases. Thirteen patients (52%)<br />

were not suited for angioplasty and had TIPS.<br />

According to Xu et al [13] , short-term results <strong>of</strong> balloon<br />

angioplasty alone without stenting were excellent but the<br />

sustained patency rate was only 50% at two years after the<br />

procedure. In this study, one <strong>of</strong> the cases that had angioplasty<br />

alone was still having patent shunt at 24 mo after<br />

the procedure without any need for shunt revision; the<br />

other one had occluded shunt on the seventh day that necessitated<br />

re-intervention in the form <strong>of</strong> TIPS which was<br />

still patent at 20 mo after procedure.<br />

Patency rate in patients who underwent angioplasty ±<br />

stenting procedures was 10/12 (83.3%) at one year and<br />

at the end <strong>of</strong> follow up due to persistent shunt occlusion<br />

in 2 patients in spite <strong>of</strong> repeated revisions and optimal<br />

WJG|www.wjgnet.com<br />

Cum survival<br />

0.8<br />

0.6<br />

0.4<br />

0.2<br />

0.0<br />

Survival function Survival function<br />

0 10 20 30 40<br />

Occlusion time or end <strong>of</strong> followup<br />

Censored<br />

Figure 2 Patency rate in patients who underwent angioplasty ± stenting (A) and transjugular intrahepatic portosystemic shunt (B). A: Type <strong>of</strong> intervention: angioplasty<br />

± stenting <strong>of</strong> hepatic veins, it was 91.7% at 9 mo and dropped to 83.3% at one year till the end <strong>of</strong> follow up at 32 mo; B: Type <strong>of</strong> intervention: transjugular intrahepatic<br />

portosystemic shunt, it was 92.3% at one year and dropped to 84.6% at 20 mo till the end <strong>of</strong> follow up at 32 mo.<br />

Table 4 Clinical data <strong>of</strong> patients before and after intervention<br />

Before intervention One year after intervention P value Sig<br />

+VE -VE +VE -VE<br />

Patients with occluded shunts (n = 3)<br />

Abdominal pain 3 0 2 1 > 0.05 NS<br />

Jaundice 1 2 0 3 > 0.05 NS<br />

Lower limb edema 2 1 1 2 > 0.05 NS<br />

Dilated veins 1 2 0 3 > 0.05 NS<br />

Ascites 3 0 3 0 > 0.05 NS<br />

Patients with patent shunts (n = 22)<br />

Abdominal pain 20 2 1 21 < 0.001 VHS<br />

Jaundice 8 14 0 22 < 0.01 HS<br />

Lower limb edema 8 14 1 21 < 0.05 S<br />

Dilated veins 4 18 0 22 > 0.05 NS<br />

Ascites 21 1 1 21 < 0.001 VHS<br />

Sig: Significance; NS: Non significant; S: Significant; HS: Highly significant; VHS: Very highly significant; -VE: Negative; +VE: Positive.<br />

anticoagulation therapy. This is a more or less satisfactory<br />

outcome; however it might have been influenced by<br />

the relatively short follow up period (ranging from 12 to<br />

32 mo) as well as most <strong>of</strong> the patients having good or<br />

intermediate prognosis according to Rotterdam score.<br />

The need <strong>of</strong> revision in cases with angioplasty ± stenting<br />

was 41.6% (5 out <strong>of</strong> 12 cases). One year survival was<br />

100% and at the end <strong>of</strong> follow up, survival dropped to<br />

91.6% due to death <strong>of</strong> one patient who had occluded<br />

shunt after one year and was also referred for mesoatrial<br />

shunt due to occlusion <strong>of</strong> IVC.<br />

Although angioplasty is considered a simple procedure;<br />

some complications were reported in the current study.<br />

Twenty six angioplasty ± stenting procedures have been<br />

done (12 procedures as primary intervention and 14 procedures<br />

as a trial for maintenance <strong>of</strong> previously occluded<br />

angioplasty or TIPS); <strong>of</strong> these procedures, angioplasty dysfunction<br />

was reported in 53.85%. This is consistent with<br />

Senzolo et al [14] who stated that although long-term patency<br />

rates can reach 80%-90% in angioplasty ± stenting procedures;<br />

angioplasty may later be required in 50% <strong>of</strong> these<br />

cases to overcome angioplasty dysfunction.<br />

910 February 21, 2011|Volume 17|Issue 7|

---

Table 5 Lab data and performance status <strong>of</strong> patients before and after intervention<br />

Stent migration, which is very rare, occurred in one<br />

angioplasty procedure (3.84%) where stent migrated to<br />

the heart just after insertion. However, no serious complications<br />

occurred and stent was embedded in the wall<br />

<strong>of</strong> right atrium and the patient was quite well.<br />

Post procedure (angioplasty ± stenting) bleeding was<br />

encountered in 3 procedures (11.53%), 2 <strong>of</strong> which were<br />

intraperitoneal and one <strong>of</strong> which was hemobilia. All 3 cases<br />

were managed conservatively by temporary stoppage<br />

<strong>of</strong> anticoagulation and blood transfusion when indicated.<br />

This complication could be attributed to the application<br />

<strong>of</strong> a transhepatic approach in these procedures. Beckett<br />

and Olliff [5] stated that this approach has the merit <strong>of</strong><br />

simplicity over a transjugular or transfemoral approach, as<br />

well as feasibility with major superior vena caval obstruction<br />

but with a potentially greater risk <strong>of</strong> bleeding.<br />

Post procedure sepsis occurred in 3 procedures (11.53%)<br />

in spite <strong>of</strong> antibiotic prophylaxis with cefotaxime in combination<br />

with ampicillin-sulbactam. This could be due to infection<br />

from resistant organisms. According to McDermott<br />

et al [15] , pathogens that precipitated infection after angio-<br />

WJG|www.wjgnet.com<br />

Before intervention One year after intervention P value Sig<br />

mean SD mean SD<br />

Patients with occluded shunts (n = 3)<br />

ALT (N = 7-40 IU/L) 70.33 75.070 29.66 24.66 > 0.05 NS<br />

AST (N = 7-37 IU/L) 42 24.240 42.33 32.51 > 0.05 NS<br />

Total bilirubin (N = 0.2-1.2 mg/dL) 2.9 2.940 1.26 0.832 > 0.05 NS<br />

Direct bilirubin (N = 0-0.3 mg/dL) 1.53 1.560 0.53 0.577 > 0.05 NS<br />

Albumin (N = 3.5-5.3 g/dL) 3.7 0.800 3.56 0.901 > 0.05 NS<br />

Performance status 3.33 0.577 2.00 1.730 > 0.05 NS<br />

Patients with patent shunts (n = 22)<br />

ALT (N = 7-40 IU/L) 66.95 117.265 26.45 8.528 < 0.05 S<br />

AST (N = 7-37 IU/L) 53.95 33.832 32.22 9.586 < 0.01 HS<br />

Total bilirubin (N = 0.2-1.2 mg/dL) 2.818 3.198 1.21 0.414 < 0.01 HS<br />

Direct bilirubin (N = 0-0.3 mg/dL) 1.29 2.022 0.51 0.296 < 0.01 HS<br />

Albumin (N = 3.5-5.3 g/dL) 3.5 0.475 3.93 0.576 < 0.01 HS<br />

Performance status 2.59 1.007 0.18 0.664 < 0.001 VHS<br />

N: Normal range; ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; Sig: Significance; NS: Non significant; S: Significant; HS: Highly significant;<br />

VHS: Very highly significant.<br />

Table 6 Comparison <strong>of</strong> different transjugular intrahepatic portosystemic shunt studies in Budd-Chiari syndrome with the current study<br />

Points <strong>of</strong> comparison Mancuso et al [18]<br />

Perelló et al [19]<br />

Rössle et al [20]<br />

Hernández-Guerra et al [21] Current study<br />

No. <strong>of</strong> patients 15 13 35 25 (9 covered stents) 13<br />

Mean age in years (range) 40 (20-73) 36 (17-67) 43 (12-74) 40 (17-54) 29 (14-57)<br />

Median child score 11 9 9 9 8<br />

Acute, fulminant/chronic presentation 8/6 4/6 11/13 ND 2/11<br />

Mean follow-up (mo) 24 48 37 20 18<br />

Stent stenosis (%) 36 72 47 67 (19% covered stents) 38.4<br />

Anticoagulation (%) 100 95 100 ND 100<br />

Patients with acute presentation who died 4 ND 2 ND 0<br />

Patients with chronic presentation who died 0 ND 1 ND 0<br />

Death total (%) 30 10 9 0 0<br />

Liver transplantation 0 1 2 0 0<br />

Surgical portocaval shunt 0 2 0 0 0<br />

ND: Not determined; Anticoagulation: Percent <strong>of</strong> patients who were adherent to anticoagulation therapy.<br />

Eldorry A et al . Non surgical hepatic decompression in Budd-Chiari<br />

plasty and stent were Staphylococcus aureus and S. epidermidis,<br />

which were sensitive to cefazolin.<br />

In this study, the results <strong>of</strong> angioplasty ± stenting<br />

agreed with Fisher et al [16] who stated that, with appropriate<br />

case selection, many patients with BCS caused by short<br />

length HV stenosis or occlusion may be managed successfully<br />

by angioplasty ± stenting with a good outcome<br />

following the procedure, provided that anticoagulation is<br />

maintained. According to the authors’ comparative study<br />

between percutaneous angioplasty and operative shunt<br />

surgery; both groups had the same re-occlusion rate and<br />

both were related to suboptimal dose <strong>of</strong> anticoagulation.<br />

In the current study, 13 patients (52%) were not candidates<br />

for angioplasty and underwent TIPS. The need<br />

for revision was 38.4% (compared to 41.6% in angioplasty<br />

± stenting). One year and end <strong>of</strong> follow up survival<br />

rates following TIPS were 100%. This could be attributed<br />

to the relatively short follow up duration (ranging<br />

from 12 to 32 mo) and good selection <strong>of</strong> cases, as most<br />

<strong>of</strong> our patients had good or intermediate predictable<br />

prognosis according to Rotterdam score.<br />

911 February 21, 2011|Volume 17|Issue 7|

---

Eldorry A et al . Non surgical hepatic decompression in Budd-Chiari<br />

Patency rate in patients who had TIPS procedures was<br />

12/13 (92.3%) at one year due to persistent shunt occlusion<br />

in one patient despite repeated revisions. At the end<br />

<strong>of</strong> follow up; patency rate dropped to 11/13 (84.6%) due<br />

to persistent shunt occlusion in another patient.<br />

The results <strong>of</strong> the current study are much better than<br />

what had been reported by Valla [17] , namely that secondary<br />

thrombosis or shunt dysfunction requiring revision<br />

occurs in about 70% <strong>of</strong> cases by 6 mo. However, the results<br />

<strong>of</strong> this study are more or less comparable to those<br />

reported by Senzolo et al [14] who stated that 36%-72% <strong>of</strong><br />

patients needed reintervention after TIPS. The authors<br />

also reported a long-term patency rate <strong>of</strong> about 50% despite<br />

<strong>of</strong> routine anticoagulation therapy.<br />

Comparison between the results <strong>of</strong> the current study,<br />

regarding TIPS, with other studies is shown in Table 6.<br />

Sixteen TIPS procedures have been done throughout<br />

the current study (13 as primary intervention and 3 in<br />

patients with occluded stents following angioplasty in<br />

which predilatation was not possible).<br />

Post TIPS sepsis occurred in 3 procedures (18.75%),<br />

in spite <strong>of</strong> prophylactic antibiotics. According to Dravid<br />

et al [22] ; an infection rate <strong>of</strong> 13% following TIPS was reported.<br />

According to Ryan et al [11] , acute infection related to<br />

TIPS placement appears to be uncommon. Whether or<br />

not prophylactic antibiotics are <strong>of</strong> value remains undetermined.<br />

Options for prophylactic antibiotics for TIPS<br />

are: (1) no prophylaxis; (2) 1 g ceftriaxone single dose intravenously<br />

before procedure; and (3) 1.5-3 g ampicillin/<br />

sulbactam single dose intravenously before procedure.<br />

We adopted the third strategy successfully in combination<br />

with cefotaxime 1 gm IV and completed the course<br />

<strong>of</strong> antibiotics for five days after intervention.<br />

Hepatic encephalopathy after TIPS occurred in 2 patients<br />

(12.5%) and was transient, lasting only for 2-3 d and<br />

responded well to anti hepatic encephalopathy measures.<br />

Post procedure bleeding was encountered in 4 procedures<br />

(25%), 2 intraperitoneal and 2 hemobilia; all were<br />

managed conservatively with temporary stoppage <strong>of</strong><br />

anticoagulation and blood transfusion if indicated.<br />

In the current study, the overall 1 year shunt patency<br />

<strong>of</strong> all procedures (angioplasty ± stenting and TIPS) was<br />

22/25 (88%) as 3 patients had occluded shunts in spite <strong>of</strong><br />

repeated trials <strong>of</strong> dilatation and adherence to anticoagulation<br />

therapy. We compared clinical and laboratory characteristics<br />

before and after intervention in patients with patent<br />

shunts (22 patients) and in those with occluded shunts<br />

(3 patients) irrespective <strong>of</strong> the type <strong>of</strong> procedure performed.<br />

We observed that patients with occluded shunts<br />

showed no improvement compared to those with patent<br />

shunts even after multiple revisions in terms <strong>of</strong> clinical<br />

manifestations, laboratory pr<strong>of</strong>ile and performance status.<br />

These observations are consistent with Bachet et al [23]<br />

who concluded that, in patients with BCS treated with<br />

portosystemic shunting, shunt dysfunction has a major<br />

impact on morbidity and mortality and maintenance <strong>of</strong><br />

shunt patency is <strong>of</strong> major importance for better long-term<br />

outcome.<br />

WJG|www.wjgnet.com<br />

In conclusion; Budd Chiari syndrome is a potentially<br />

life-threatening disorder that requires a multidisciplinary<br />

approach with hepatologist, hematologist, interventional<br />

radiologist and vascular surgeon. Morbidity and mortality<br />

following both angioplasty ± stenting and TIPS are<br />

low with satisfactory stent and patient survival. Proper<br />

selection <strong>of</strong> procedure candidates and maintenance <strong>of</strong><br />

shunt patency by strict adherence to anticoagulation<br />

and early management <strong>of</strong> shunt dysfunction are crucial<br />

in clinical, laboratory and radiological improvement <strong>of</strong><br />

BCS patients.<br />

COMMENTS<br />

Background<br />

Budd-Chiari syndrome (BCS) results from hepatic venous outflow obstruction<br />

at any level from hepatic venules to the right atrium. Few patients respond to<br />

medical treatment (anticoagulation ± thrombolytic therapy, diuretics). However,<br />

most patients need intervention to restore the hepatic blood flow. Restoring<br />

outflow in one <strong>of</strong> the major hepatic veins by balloon dilatation ± stenting is the<br />

management <strong>of</strong> choice. When not possible or failed, Transjugular Intrahepatic<br />

Portosystemic Shunt is used.<br />

Research frontiers<br />

Follow up <strong>of</strong> patients after radiological intervention is crucial in order to assess<br />

patient improvement, shunt patency and function and to manage any procedure<br />

related complications. In this study, the authors demonstrate that morbidity and<br />

mortality following angioplasty ± stenting and transjugular intrahepatic portosystemic<br />

shunt (TIPS) are low with satisfactory outcome.<br />

Innovations and breakthroughs<br />

This is the first Egyptian study that addresses the short term outcome <strong>of</strong> interventional<br />

radiology procedures in management <strong>of</strong> BCS.<br />

Applications<br />

This study may represent a future strategy for good selection <strong>of</strong> procedure<br />

candidates, maintenance <strong>of</strong> shunt patency by strict adherence to anticoagulation<br />

and early management <strong>of</strong> shunt dysfunction which are all crucial in clinical,<br />

laboratory and radiological improvement <strong>of</strong> BCS patients.<br />

Terminology<br />

Angioplasty means balloon dilatation <strong>of</strong> hepatic vein; it may be with or without<br />

stent insertion. This procedure is performed in BCS patients with short segment<br />

stenosis or occlusion <strong>of</strong> the hepatic veins with significant patent segments. This<br />

approach will re-establish hepatic venous outflow via the physiological route. In<br />

cases where blood flow cannot be restored or where the approach fails (usually<br />

because the remaining patent veins are too small or have insufficient flow),<br />

Transjugular Intrahepatic Portosystemic Shunt is used; in which the shunt connects<br />

the hepatic vein to the portal vein to bypass the obstruction.<br />

Peer review<br />

The authors evaluated the outcome <strong>of</strong> patients with BCS after non surgical<br />

hepatic decompression procedures (either balloon angioplasty ± stenting or<br />

TIPS). It revealed that morbidity and mortality following both procedures are low<br />

with satisfactory stent and patient survival. Thus, proper selection <strong>of</strong> procedure<br />

candidates and maintenance <strong>of</strong> shunt patency by strict adherence to anticoagulation<br />

and early management <strong>of</strong> shunt dysfunction are crucial in clinical, laboratory<br />

and radiological improvement <strong>of</strong> those patients. Their results are excellent<br />

on managing a very challenging group <strong>of</strong> patients and their program should be<br />

commended for this outcome.<br />

REFERENCES<br />

1 Zimmerman MA, Cameron AM, Ghobrial RM. Budd-Chiari<br />

syndrome. Clin Liver Dis 2006; 10: 259-273, viii<br />

2 Aydinli M, Bayraktar Y. Budd-Chiari syndrome: etiology,<br />

pathogenesis and diagnosis. <strong>World</strong> J Gastroenterol 2007; 13:<br />

2693-2696<br />

3 Brancatelli G, Vilgrain V, Federle MP, Hakime A, Lagalla<br />

R, Iannaccone R, Valla D. Budd-Chiari syndrome: spectrum<br />

<strong>of</strong> imaging findings. AJR Am J Roentgenol 2007; 188:<br />

912 February 21, 2011|Volume 17|Issue 7|

---

W168-W176<br />

4 Slakey DP, Klein AS, Venbrux AC, Cameron JL. Budd-<br />

Chiari syndrome: current management options. Ann Surg<br />

2001; 233: 522-527<br />

5 Beckett D, Olliff S. Interventional radiology in the management<br />

<strong>of</strong> Budd Chiari syndrome. Cardiovasc Intervent Radiol<br />

2008; 31: 839-847<br />

6 Boyer TD, Haskal ZJ. The role <strong>of</strong> transjugular intrahepatic<br />

portosystemic shunt in the management <strong>of</strong> portal hypertension.<br />

Hepatology 2005; 41: 386-400<br />

7 Oken MM, Creech RH, Tormey DC, Horton J, Davis TE,<br />

McFadden ET, Carbone PP. Toxicity and response criteria <strong>of</strong><br />

the Eastern Cooperative Oncology Group. Am J Clin Oncol<br />

1982; 5: 649-655<br />

8 Darwish Murad S, Valla DC, de Groen PC, Zeitoun G, Hopmans<br />

JA, Haagsma EB, van Hoek B, Hansen BE, Rosendaal<br />

FR, Janssen HL. Determinants <strong>of</strong> survival and the effect <strong>of</strong><br />

portosystemic shunting in patients with Budd-Chiari syndrome.<br />

Hepatology 2004; 39: 500-508<br />

9 Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC, Williams<br />

R. Transection <strong>of</strong> the oesophagus for bleeding oesophageal<br />

varices. Br J Surg 1973; 60: 646-649<br />

10 Madura JA, Rookstool M, Wease G. The management <strong>of</strong> patients<br />

on chronic Coumadin therapy undergoing subsequent<br />

surgical procedures. Am Surg 1994; 60: 542-546; discussion<br />

546-547<br />

11 Ryan JM, Ryan BM, Smith TP. Antibiotic prophylaxis in interventional<br />

radiology. J Vasc Interv Radiol 2004; 15: 547-556<br />

12 Kraai EP, Lopes RD, Alexander JH, Garcia D. Perioperative<br />

management <strong>of</strong> anticoagulation: guidelines translated for<br />

the clinician. J Thromb Thrombolysis 2009; 28: 16-22<br />

13 Xu K, He FX, Zhang HG, Zhang XT, Han MJ, Wang CR,<br />

Kaneko M, Takahashi M, Okawada T. Budd-Chiari syndrome<br />

caused by obstruction <strong>of</strong> the hepatic inferior vena<br />

cava: immediate and 2-year treatment results <strong>of</strong> transluminal<br />

angioplasty and metallic stent placement. Cardiovasc<br />

Intervent Radiol 1996; 19: 32-36<br />

14 Senzolo M, Cholongitas EC, Patch D, Burroughs AK. Up-<br />

WJG|www.wjgnet.com<br />

Eldorry A et al . Non surgical hepatic decompression in Budd-Chiari<br />

date on the classification, assessment <strong>of</strong> prognosis and therapy<br />

<strong>of</strong> Budd-Chiari syndrome. Nat Clin Pract Gastroenterol<br />

Hepatol 2005; 2: 182-190<br />

15 McDermott VG, Schuster MG, Smith TP. Antibiotic prophylaxis<br />

in vascular and interventional radiology. AJR Am J<br />

Roentgenol 1997; 169: 31-38<br />

16 Fisher NC, McCafferty I, Dolapci M, Wali M, Buckels JA,<br />

Olliff SP, Elias E. Managing Budd-Chiari syndrome: a retrospective<br />

review <strong>of</strong> percutaneous hepatic vein angioplasty<br />

and surgical shunting. Gut 1999; 44: 568-574<br />

17 Valla DC. The diagnosis and management <strong>of</strong> the Budd-<br />

Chiari syndrome: consensus and controversies. Hepatology<br />

2003; 38: 793-803<br />

18 Mancuso A, Fung K, Mela M, Tibballs J, Watkinson A,<br />

Burroughs AK, Patch D. TIPS for acute and chronic Budd-<br />

Chiari syndrome: a single-centre experience. J Hepatol 2003;<br />

38: 751-754<br />

19 Perelló A, García-Pagán JC, Gilabert R, Suárez Y, Moitinho E,<br />

Cervantes F, Reverter JC, Escorsell A, Bosch J, Rodés J. TIPS<br />

is a useful long-term derivative therapy for patients with<br />

Budd-Chiari syndrome uncontrolled by medical therapy.<br />

Hepatology 2002; 35: 132-139<br />

20 Rössle M, Olschewski M, Siegerstetter V, Berger E, Kurz<br />

K, Grandt D. The Budd-Chiari syndrome: outcome after<br />

treatment with the transjugular intrahepatic portosystemic<br />

shunt. Surgery 2004; 135: 394-403<br />

21 Hernández-Guerra M, Turnes J, Rubinstein P, Olliff S, Elias<br />

E, Bosch J, García-Pagán JC. PTFE-covered stents improve<br />

TIPS patency in Budd-Chiari syndrome. Hepatology 2004; 40:<br />

1197-1202<br />

22 Dravid VS, Gupta A, Zegel HG, Morales AV, Rabinowitz B,<br />

Freiman DB. Investigation <strong>of</strong> antibiotic prophylaxis usage<br />

for vascular and nonvascular interventional procedures. J<br />

Vasc Interv Radiol 1998; 9: 401-406<br />

23 Bachet JB, Condat B, Hagège H, Plessier A, Consigny Y,<br />

Belghiti J, Valla D. Long-term portosystemic shunt patency<br />

as a determinant <strong>of</strong> outcome in Budd-Chiari syndrome. J<br />

Hepatol 2007; 46: 60-68<br />

S- Editor Cheng JX L- Editor Rutheford A E- Editor Ma WH<br />

913 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.914<br />

ORIGINAL ARTICLE<br />

Body mass index is associated with age-at-onset <strong>of</strong> HCVinfected<br />

hepatocellular carcinoma patients<br />

Takumi Akiyama, Toshihiko Mizuta, Seiji Kawazoe, Yuichiro Eguchi, Yasunori Kawaguchi, Hirokazu Takahashi,<br />

Iwata Ozaki, Kazuma Fujimoto<br />

Takumi Akiyama, Toshihiko Mizuta, Yuichiro Eguchi, Yasunori<br />

Kawaguchi, Hirokazu Takahashi, Iwata Ozaki, Kazuma<br />

Fujimoto, Department <strong>of</strong> Internal Medicine, Saga Medical<br />

School, Saga 8498501, Japan<br />

Takumi Akiyama, Seiji Kawazoe, Department <strong>of</strong> Hepatology,<br />

Saga Prefectural Hospital, Saga 8408571, Japan<br />

Author contributions: Akiyama T and Mizuta T designed research<br />

and analyzed data; Kawazoe S, Eguchi Y, Kawaguchi Y,<br />

Takahashi H and Ozaki I provided the patient data; Fujimoto K<br />

reviewed the manuscript; Akiyama T wrote the paper; Mizuta T<br />

reviewed and edited the manuscript.<br />

Correspondence to: Toshihiko Mizuta, MD, PhD, Department<br />

<strong>of</strong> Internal Medicine, Saga Medical School, 5-1-1<br />

Nabeshima, Saga 8498501, Japan. mizutat@med.saga-u.ac.jp<br />

Telephone: +81-952-342362 Fax: +81-952-342017<br />

Received: August 10, 2010 Revised: September 29, 2010<br />

Accepted: October 6, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To identify factors associated with the age at<br />

onset <strong>of</strong> hepatitis C virus (HCV)-related hepatocellular<br />

carcinoma (HCC).<br />

METHODS: Five hundred and fifty-six consecutive<br />

patients positive for HCV antibody and treatmentnaïve<br />

HCC diagnosed between 1995 and 2004 were<br />

analyzed. Patients were classified into three groups<br />

according to age at HCC onset: < 60 years (n = 79),<br />

60-79 years (n = 439), or ≥ 80 years (n = 38). Differences<br />

among groups in terms <strong>of</strong> sex, body mass<br />

index (BMI), lifestyle characteristics, and liver function<br />

were assessed. Factors associated with HCC onset in<br />

patients < 60 or ≥ 80 years were analyzed by logistic<br />

regression analysis.<br />

RESULTS: Significant differences emerged for sex, BMI,<br />

degree <strong>of</strong> smoking and alcohol consumption, mean bilirubin,<br />

alanine aminotransferase (ALT), and γ-glutamyl<br />

transpeptidase (GGT) levels, prothrombin activity, and<br />

WJG|www.wjgnet.com<br />

914<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 914-921<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

platelet counts. The mean BMI values <strong>of</strong> male patients<br />

> 60 years old were lower and mean BMI values <strong>of</strong><br />

female patients < 60 years old were higher than those<br />

<strong>of</strong> the general Japanese population. BMI > 25 kg/m 2<br />

[hazard ratio (HR), 1.8, P = 0.045], excessive alcohol<br />

consumption (HR, 2.5, P = 0.024), male sex (HR, 3.6, P<br />

= 0.002), and GGT levels > 50 IU/L (HR, 2.4, P = 0.014)<br />

were independently associated with HCC onset in patients<br />

< 60 years. Low ALT level was the only factor associated<br />

with HCC onset in patients aged ≥ 80 years.<br />

CONCLUSION: Increased BMI is associated with increased<br />

risk for early HCC development in HCV-infected<br />

patients. Achieving recommended BMI and reducing alcohol<br />

intake could help prevent hepatic carcinogenesis.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Age-at-onset; Hepatocellular carcinoma;<br />

Hepatitis C virus; Body mass index; Alcohol consumption;<br />

Sex difference<br />

Peer reviewers: Heitor Rosa, Pr<strong>of</strong>essor, Department <strong>of</strong> Gastroenterology<br />

and Hepatology, Federal University School <strong>of</strong><br />

Medicine, Rua 126 n.21, Goiania - GO 74093-080, Brazil; Jian<br />

Wu, Associate Pr<strong>of</strong>essor <strong>of</strong> Medicine, Internal Medicine/Transplant<br />

Research Program, University <strong>of</strong> California, Davis Medical<br />

Center, 4635 2nd Ave. Suite 1001, Sacramento, CA 95817,<br />

United States<br />

Akiyama T, Mizuta T, Kawazoe S, Eguchi Y, Kawaguchi Y,<br />

Takahashi H, Ozaki I, Fujimoto K. Body mass index is associated<br />

with age-at-onset <strong>of</strong> HCV-infected hepatocellular carcinoma<br />

patients. <strong>World</strong> J Gastroenterol 2011; 17(7): 914-921 Available<br />

from: URL: http://www.wjgnet.com/1007-9327/full/v17/i7/<br />

914.htm DOI: http://dx.doi.org/10.3748/wjg.v17.i7.914<br />

INTRODUCTION<br />

Hepatocellular carcinoma (HCC) is the fifth most com-<br />

February 21, 2011|Volume 17|Issue 7|

---

A<br />

BMI<br />

28<br />

26<br />

24<br />

22<br />

20<br />

18<br />

40-49 50-59 60-69 70-79 80 <<br />

Age <strong>of</strong> HCC occurrence<br />

Figure 2 Mean body mass index in each age group at onset <strong>of</strong> hepatocellular carcinoma (A: Men; B: Women). The bars show the mean body mass index (BMI)<br />

± SD in patients with hepatocellular carcinoma (HCC). The dashed lines show the mean BMI for the general Japanese population in 2005 and 2006, which was surveyed<br />

by the Ministry <strong>of</strong> Health, Labour and Welfare, Japan.<br />

P = 0.033), habitual smoking (HR, 2.7; 95% CI, 1.67-4.39;<br />

P < 0.0001), heavy drinking (HR, 3.9; 95% CI, 1.93-7.87;<br />

P = 0.0002), total bilirubin > 2.0 mg/dL (HR, 2.2; 95%<br />

CI, 1.00-4.96; P = 0.049), prothrombin activity > 70%<br />

(HR, 1.9; 95% CI, 1.11-3.26; P = 0.019), and GGT level<br />

> 50 IU/L (HR, 3.2; 95% CI, 1.73-6.05; P = 0.0002). In<br />

multivariate analysis, independent risk factors for earlier<br />

age at onset <strong>of</strong> HCC were male sex (HR, 3.6; 95% CI,<br />

WJG|www.wjgnet.com<br />

BMI<br />

28<br />

26<br />

24<br />

22<br />

20<br />

18<br />

50-59 60-69 70-79 80 <<br />

Age <strong>of</strong> HCC occurrence<br />

Table 2 Analysis <strong>of</strong> factors affecting development <strong>of</strong> hepatocellular carcinoma at younger age (under 60 yr old)<br />

Variables Univariate analysis Multivariate analysis<br />

B<br />

HR 95% CI P HR 95% CI P<br />

Sex<br />

Female 1 1<br />

Male 5.43 2.647-11.120 < 0.0001 3.58 1.580-8.133 0.002<br />

BMI<br />

< 25 1 1<br />

≥ 25 1.73 1.044-2.851 0.033 1.82 1.015-3.270 0.045<br />

Diabetes mellitus<br />

Without 1 1<br />

With 1.12 0.619-2.037 0.703 1.00 0.516-1.952 0.991<br />

Smoking (packs year)<br />

< 20 1 1<br />

≥ 20 2.71 1.669-4.393 < 0.0001 1.64 1.904-2.991 0.104<br />

Alcohol (g/d)<br />

< 60 1 1<br />

≥ 60 3.89 1.926-7.874 0.0002 2.51 1.130-5.563 0.024<br />

Total bilirubin (mg/dL)<br />

< 2.0 1 1<br />

≥ 2.0 2.23 1.003-4.958 0.049 2.33 0.898-6.033 0.082<br />

Prothrombin activity (%)<br />

≥ 70 1 1<br />

< 70 1.91 1.111-3.262 0.019 1.60 0.859-2.987 0.139<br />

Platelet (× 10 4 /μL)<br />

≥ 10 1 1<br />

< 10 1.34 0.829-2.166 0.232 1.60 0.877-2.886 0.118<br />

ALT (IU/L)<br />

< 80 1 1<br />

≥ 80 1.44 0.884-2.350 0.142 1.17 0.656-2.090 0.542<br />

GGT (IU/L)<br />

< 50 1 1<br />

≥ 50 3.24 1.731-6.053 0.0002 2.38 1.194-4.727 0.014<br />

HR: Hazard ratio; BMI: Body mass index; ALT: Alanine aminotransferase; GGT: γ-glutamyl transpeptidase.<br />

Akiyama T et al . BMI and age at HCC onset<br />

1.58-8.13; P = 0.002), BMI > 25 kg/m 2 (HR, 1.8; 95%<br />

CI, 1.015-3.270; P = 0.045), heavy drinking (HR, 2.5; 95%<br />

CI, 1.13-5.56; P = 0.024), and GGT > 50 IU/L (HR, 2.4;<br />

95% CI, 1.19-4.73; P = 0.014).<br />

Factors associated with the development <strong>of</strong> HCC at ≥<br />

80 years <strong>of</strong> age<br />

We also investigated factors associated with the develop-<br />

917 February 21, 2011|Volume 17|Issue 7|

---

Akiyama T et al . BMI and age at HCC onset<br />

Table 3 Analysis <strong>of</strong> factors affecting development <strong>of</strong> hepatocellular carcinoma at older age (over 80 yr old)<br />

Variables Univariate analysis Multivariate analysis<br />

ment <strong>of</strong> HCC at an older age (i.e. ≥ 80 years <strong>of</strong> age) (Table<br />

3). In univariate analysis, the following were significantly<br />

and negatively associated with age at onset <strong>of</strong> HCC ≥ 80<br />

years: male sex (HR, 0.45; 95% CI, 0.23-0.87; P = 0.017),<br />

diabetes mellitus (HR, 0.23; 95% CI, 0.05-0.96; P = 0.043),<br />

prothrombin activity < 70% (HR, 0.1; 95% CI, 0.01-0.76;<br />

P = 0.025), ALT > 80 IU/L (HR, 0.1; 95% CI, 0.02-0.43;<br />

P = 0.002), and GGT > 50 IU/L (HR, 0.51; 95% CI,<br />

0.26-0.98; P = 0.045). In multivariate analysis, ALT > 80<br />

IU/L was the only independent factor associated with age<br />

at onset <strong>of</strong> HCC ≥ 80 years (HR, 0.13; 95% CI, 0.03-0.57;<br />

P = 0.007).<br />

Age at onset <strong>of</strong> HCC stratified by BMI in relation to sex<br />

or alcohol consumption<br />

Differences in age at onset <strong>of</strong> HCC stratified by BMI<br />

were assessed in relation to sex or alcohol consumption.<br />

In men, age at onset decreased significantly with increasing<br />

BMI (mean age ± SD; underweight, 71.1 ± 7.4 years;<br />

normal weight, 67.0 ± 8.5 years; overweight, 63.6 ± 8.1<br />

years; obese, 57.0 ± 7.0 years) (Figure 3A). Although a<br />

similar trend was noted in women, this was not significant<br />

(underweight, 73.6 ± 7.8 years; normal weight, 70.4<br />

± 7.0 years; overweight, 68.9 ± 6.4 years; obese, 67.0 ± 7.5<br />

years) (Figure 3B).<br />

WJG|www.wjgnet.com<br />

HR 95% CI P HR 95% CI P<br />

Sex<br />

Female 1 1<br />

Male 0.45 0.229-0.867 0.017 0.47 0.200-1.119 0.089<br />

BMI<br />

---

A<br />

Age (yr)<br />

90<br />

80<br />

70<br />

60<br />

50<br />

40<br />

P < 0.05<br />

NS P < 0.05 NS<br />

as the core protein, cause oxidative damage by exposing<br />

the endoplasmic reticulum to oxidative stress [19-21] . Hepatic<br />

oxidative stress is strongly associated with increased risk<br />

for HCC in patients with chronic HCV [22] . Because oxidative<br />

stress is also caused by various host-related factors, it<br />

is expected to be influenced more strongly by host-related<br />

factors in HCV-infected patients than in those with HCVnegative<br />

liver disease. Indeed, we have previously reported<br />

that visceral fat accumulation was associated with greater<br />

insulin resistance in chronic HCV patients than in those<br />

with non-alcoholic fatty liver disease [23] . Therefore, it is<br />

plausible that the association between earlier onset <strong>of</strong><br />

HCC and increased BMI is due to the generation <strong>of</strong> hepatic<br />

oxidative stress.<br />

An interesting aspect <strong>of</strong> our results is that underweight<br />

patients, defined as those with a BMI <strong>of</strong> < 18.5 kg/m 2 ,<br />

tended to be older at HCC onset than patients within the<br />

WJG|www.wjgnet.com<br />

P < 0.05<br />

NS<br />

< 18.5 18.5-25 25-30 30 <<br />

BMI<br />

Figure 3 Differences in age at onset <strong>of</strong> hepatocellular carcinoma stratified by body mass index according to sex (A: Men; B: Women). Statistical analysis<br />

was performed using the Tukey-Kramer method. NS: Not significant; BMI: Body mass index.<br />

A<br />

Age (yr)<br />

90<br />

80<br />

70<br />

60<br />

50<br />

40<br />

P < 0.05<br />

P < 0.05<br />

< 18.5 18.5-25 25-30 30 <<br />

BMI<br />

NS<br />

P < 0.05 P < 0.05 NS<br />

B<br />

Age (yr)<br />

90<br />

80<br />

70<br />

60<br />

50<br />

40<br />

NS<br />

NS NS NS<br />

< 18.5 18.5-25 25-30 30 <<br />

Figure 4 Differences in age at onset <strong>of</strong> hepatocellular carcinoma stratified by body mass index according to degree <strong>of</strong> alcohol consumption (A: Non-heavy<br />

drinkers < 60 g/d; B: Heavy drinkers ≥ 60 g/d). Statistical analysis was performed using the Tukey-Kramer method. NS: Not significant; BMI: Body mass index.<br />

B<br />

Age (yr)<br />

90<br />

80<br />

70<br />

60<br />

50<br />

40<br />

Akiyama T et al . BMI and age at HCC onset<br />

NS<br />

normal weight range (BMI 18.5-25 kg/m 2 ). Recently, Ohki<br />

et al [11] reported that patients with a BMI < 18.5 kg/m 2<br />

had the lowest risk <strong>of</strong> developing HCC due to chronic<br />

HCV infection among all BMI groups. In general, the<br />

mortality rate associated with cardiovascular disease or<br />

<strong>cancer</strong> is higher in underweight patients than in normal<br />

weight patients [24,25] . Clearly, a larger cohort study is needed<br />

to investigate whether leanness confers a protective effect<br />

against hepatocarcinogenesis in HCV-infected patients.<br />

Excessive alcohol consumption is also known to exacerbate<br />

hepatic oxidative stress and evoke liver fibrosis<br />

or HCC [20,26] . In this study, there was no association between<br />

BMI and age at onset <strong>of</strong> HCC in heavy drinkers.<br />

We speculate that this group may include some patients<br />

who are malnourished and possibly losing weight.<br />

Sex modulates the natural history <strong>of</strong> chronic liver disease.<br />

Previous studies have suggested that chronic HCV<br />

919 February 21, 2011|Volume 17|Issue 7|<br />

NS<br />

BMI<br />

NS<br />

NS<br />

NS NS NS<br />

< 18.5 18.5-25 25-30 30 <<br />

BMI<br />

NS

---

Akiyama T et al . BMI and age at HCC onset<br />

infection progresses more rapidly in men than women,<br />

and that cirrhosis is predominately a disease <strong>of</strong> men and<br />

postmenopausal women [27] . Shimizu et al suggested that<br />

estrogens protect against oxidative stress in liver injury<br />

and hepatic fibrosis [28] . In this study, the effect <strong>of</strong> BMI<br />

on age at onset <strong>of</strong> HCC was more remarkable in men<br />

than women. We speculate two mechanisms to account<br />

for this difference: (1) estrogens mitigate oxidative stress<br />

or insulin resistance associated with obesity; and (2) subcutaneous<br />

fat accumulation is more dominant in obese<br />

women than visceral fat, which is known to produce several<br />

adipokines that cause insulin resistance [29] .<br />

In addition, we examined factors associated with onset<br />

<strong>of</strong> HCC at an older age (≥ 80 years). In this analysis,<br />

ALT level was the only independent factor associated with<br />

hepatocarcinogenesis in HCV-infected patients at an age<br />

≥ 80 years. It is well known that ALT levels are associated<br />

with liver inflammation and fibrosis progression, and<br />

Ishiguro et al recently reported that elevated ALT levels<br />

were strongly associated with the incidence <strong>of</strong> HCC, regardless<br />

<strong>of</strong> hepatitis virus positivity, in a large populationbased<br />

cohort study [30] . Therefore, lower ALT levels might<br />

indicate a slow course <strong>of</strong> progression <strong>of</strong> hepatic fibrosis<br />

or carcinogenesis.<br />

A limitation <strong>of</strong> this study is that it was a cross-sectional<br />

observation, rather than a cohort follow-up study.<br />

Further studies are needed to confirm our results.<br />

In conclusion, the results <strong>of</strong> the present study indicate<br />

that higher BMI, excessive alcohol consumption, and male<br />

sex are independent risk factors for onset <strong>of</strong> HCV-related<br />

HCC at an age <strong>of</strong> < 60 years. These results suggest that<br />

interventions to promote changes in the lifestyle <strong>of</strong> patients<br />

with chronic HCV may slow the progression <strong>of</strong><br />

HCV infection to HCC.<br />

ACKNOWLEDGMENTS<br />

The authors would like to thank Yukie Watanabe and<br />

Chieko Ogawa for their assistance.<br />

COMMENTS<br />

Background<br />

The incidence and mortality associated with hepatocellular carcinoma (HCC)<br />

have been increasing worldwide, and hepatitis C virus (HCV) infection plays an<br />

important role in the pathogenesis <strong>of</strong> HCC. However, the factors that influence<br />

the development <strong>of</strong> HCC in HCV-infected patients remain largely unknown. Previous<br />

studies have suggested that host factors, such as sex, alcohol consumption,<br />

smoking, diabetes mellitus, and obesity, are important risk factors for HCC.<br />

Meanwhile, it has been reported that HCV infection causes insulin resistance<br />

and leads to oxidative stress, potentiating fibrosis and hepatic carcinogenesis.<br />

Therefore, we hypothesized that body mass index (BMI) influences the onset<br />

age <strong>of</strong> HCC related to HCV infection.<br />

Research frontiers<br />

Many studies have indicated that obesity is an independent and a significant<br />

risk factor for HCC occurrence. Recently, several metabolic markers have been<br />

implicated in the development and progression <strong>of</strong> HCC.<br />

Innovations and breakthroughs<br />

This study indicated that higher BMI, heavy alcohol consumption, male sex, and<br />

high γ-glutamyl transpeptidase levels are independent risk factors for younger<br />

age at onset <strong>of</strong> HCV-related HCC. Interestingly, the underweight patients (BMI<br />

WJG|www.wjgnet.com<br />

< 18.5 kg/m 2 ), tended to be older at HCC onset than patients within the normal<br />

weight range (BMI 18.5-25 kg/m 2 ).<br />

Applications<br />

The results <strong>of</strong> this study suggest that achieving an adequate body weight along<br />

with a reduction <strong>of</strong> alcohol intake in patients with chronic hepatitis C could help<br />

prevent hepatic carcinogenesis.<br />

Peer review<br />

The study was reasonably designed and well conducted, and the data support<br />

their conclusions.<br />

REFERENCES<br />

1 El-Serag HB. Epidemiology <strong>of</strong> hepatocellular carcinoma in<br />

USA. Hepatol Res 2007; 37 Suppl 2: S88-S94<br />

2 El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology<br />

and molecular carcinogenesis. Gastroenterology<br />

2007; 132: 2557-2576<br />

3 Umemura T, Ichijo T, Yoshizawa K, Tanaka E, Kiyosawa K.<br />

Epidemiology <strong>of</strong> hepatocellular carcinoma in Japan. J Gastroenterol<br />

2009; 44 Suppl 19: 102-107<br />

4 El-Serag HB. Hepatocellular carcinoma and hepatitis C in<br />

the United States. Hepatology 2002; 36: S74-S83<br />

5 Fattovich G, Str<strong>of</strong>folini T, Zagni I, Donato F. Hepatocellular<br />

carcinoma in cirrhosis: incidence and risk factors. Gastroenterology<br />

2004; 127: S35-S50<br />

6 Sinn DH, Paik SW, Kang P, Kil JS, Park SU, Lee SY, Song<br />

SM, Gwak GY, Choi MS, Lee JH, Koh KC, Yoo BC. Disease<br />

progression and the risk factor analysis for chronic hepatitis<br />

C. Liver Int 2008; 28: 1363-1369<br />

7 Marrero JA, Fontana RJ, Fu S, Conjeevaram HS, Su GL, Lok<br />

AS. Alcohol, tobacco and obesity are synergistic risk factors<br />

for hepatocellular carcinoma. J Hepatol 2005; 42: 218-224<br />

8 Hara M, Tanaka K, Sakamoto T, Higaki Y, Mizuta T, Eguchi<br />

Y, Yasutake T, Ozaki I, Yamamoto K, Onohara S, Kawazoe<br />

S, Shigematsu H, Koizumi S. Case-control study on cigarette<br />

smoking and the risk <strong>of</strong> hepatocellular carcinoma among<br />

Japanese. Cancer Sci 2008; 99: 93-97<br />

9 Polesel J, Zucchetto A, Montella M, Dal Maso L, Crispo<br />

A, La Vecchia C, Serraino D, Franceschi S, Talamini R. The<br />

impact <strong>of</strong> obesity and diabetes mellitus on the risk <strong>of</strong> hepatocellular<br />

carcinoma. Ann Oncol 2009; 20: 353-357<br />

10 Aizawa Y, Shibamoto Y, Takagi I, Zeniya M, Toda G. Analysis<br />

<strong>of</strong> factors affecting the appearance <strong>of</strong> hepatocellular carcinoma<br />

in patients with chronic hepatitis C. A long term followup<br />

study after histologic diagnosis. Cancer 2000; 89: 53-59<br />

11 Ohki T, Tateishi R, Sato T, Masuzaki R, Imamura J, Goto T,<br />

Yamashiki N, Yoshida H, Kanai F, Kato N, Shiina S, Yoshida<br />

H, Kawabe T, Omata M. Obesity is an independent risk factor<br />

for hepatocellular carcinoma development in chronic hepatitis<br />

C patients. Clin Gastroenterol Hepatol 2008; 6: 459-464<br />

12 Vidali M, Tripodi MF, Ivaldi A, Zampino R, Occhino G, Restivo<br />

L, Sutti S, Marrone A, Ruggiero G, Albano E, Adinolfi<br />

LE. Interplay between oxidative stress and hepatic steatosis<br />

in the progression <strong>of</strong> chronic hepatitis C. J Hepatol 2008; 48:<br />

399-406<br />

13 Koike K. Steatosis, liver injury, and hepatocarcinogenesis in<br />

hepatitis C viral infection. J Gastroenterol 2009; 44 Suppl 19:<br />

82-88<br />

14 Sheikh MY, Choi J, Qadri I, Friedman JE, Sanyal AJ. Hepatitis<br />

C virus infection: molecular pathways to metabolic syndrome.<br />

Hepatology 2008; 47: 2127-2133<br />

15 Liver Cancer Study Group. The General Rules for the Clinical<br />

and Pathological Study <strong>of</strong> Primary Liver Cancer. 5th ed.<br />

Japan, 2008: 24-28<br />

16 <strong>World</strong> Health Organization. Obesity: Preventing and managing<br />

the global epidemic; Report <strong>of</strong> a WHO Consultation<br />

on Obesity, Geneva, 3-5, June 1997. Geneva: WHO, 1998<br />

17 Report <strong>of</strong> a WHO Consultation. Definition, diagnosis and<br />

classification <strong>of</strong> diabetes mellitus and its complication:<br />

920 February 21, 2011|Volume 17|Issue 7|

---

Part1. Diagnosis and classification <strong>of</strong> diabetes mellitus.<br />

<strong>World</strong> Health Organization, Department <strong>of</strong> Noncommunicable<br />

Disease Surveillance, Geneva, 1999<br />

18 Hamada H, Yatsuhashi H, Yano K, Daikoku M, Arisawa<br />

K, Inoue O, Koga M, Nakata K, Eguchi K, Yano M. Impact<br />

<strong>of</strong> aging on the development <strong>of</strong> hepatocellular carcinoma<br />

in patients with posttransfusion chronic hepatitis C. Cancer<br />

2002; 95: 331-339<br />

19 Tardif KD, Waris G, Siddiqui A. Hepatitis C virus, ER stress,<br />

and oxidative stress. Trends Microbiol 2005; 13: 159-163<br />

20 Ji C, Kaplowitz N. ER stress: can the liver cope? J Hepatol<br />

2006; 45: 321-333<br />

21 Ciccaglione AR, Costantino A, Tritarelli E, Marcantonio<br />

C, Equestre M, Marziliano N, Rapicetta M. Activation <strong>of</strong><br />

endoplasmic reticulum stress response by hepatitis C virus<br />

proteins. Arch Virol 2005; 150: 1339-1356<br />

22 Tanaka H, Fujita N, Sugimoto R, Urawa N, Horiike S, Kobayashi<br />

Y, Iwasa M, Ma N, Kawanishi S, Watanabe S, Kaito<br />

M, Takei Y. Hepatic oxidative DNA damage is associated<br />

with increased risk for hepatocellular carcinoma in chronic<br />

hepatitis C. Br J Cancer 2008; 98: 580-586<br />

23 Eguchi Y, Mizuta T, Ishibashi E, Kitajima Y, Oza N, Nakashita<br />

S, Hara M, Iwane S, Takahashi H, Akiyama T, Ario<br />

K, Kawaguchi Y, Yasutake T, Iwakiri R, Ozaki I, Hisatomi<br />

A, Eguchi T, Ono N, Fujimoto K. Hepatitis C virus infection<br />

enhances insulin resistance induced by visceral fat accumu-<br />

WJG|www.wjgnet.com<br />

Akiyama T et al . BMI and age at HCC onset<br />

lation. Liver Int 2009; 29: 213-220<br />

24 Whitlock G, Lewington S, Sherliker P, Clarke R, Emberson<br />

J, Halsey J, Qizilbash N, Collins R, Peto R. Body-mass index<br />

and cause-specific mortality in 900 000 adults: collaborative<br />

analyses <strong>of</strong> 57 prospective studies. Lancet 2009; 373: 1083-1096<br />

25 Calle EE, Thun MJ, Petrelli JM, Rodriguez C, Heath CW Jr.<br />

Body-mass index and mortality in a prospective cohort <strong>of</strong><br />

U.S. adults. N Engl J Med 1999; 341: 1097-1105<br />

26 de la Monte SM, Yeon JE, Tong M, Longato L, Chaudhry R,<br />

Pang MY, Duan K, Wands JR. Insulin resistance in experimental<br />

alcohol-induced liver disease. J Gastroenterol Hepatol<br />

2008; 23: e477-e486<br />

27 Farinati F, Sergio A, Giacomin A, Di Nolfo MA, Del Poggio<br />

P, Benvegnù L, Rapaccini G, Zoli M, Borzio F, Giannini EG,<br />

Caturelli E, Trevisani F. Is female sex a significant favorable<br />

prognostic factor in hepatocellular carcinoma? Eur J Gastroenterol<br />

Hepatol 2009; 21: 1212-1218<br />

28 Shimizu I, Ito S. Protection <strong>of</strong> estrogens against the progression<br />

<strong>of</strong> chronic liver disease. Hepatol Res 2007; 37: 239-247<br />

29 Geer EB, Shen W. Gender differences in insulin resistance,<br />

body composition, and energy balance. Gend Med 2009; 6<br />

Suppl 1: 60-75<br />

30 Ishiguro S, Inoue M, Tanaka Y, Mizokami M, Iwasaki M,<br />

Tsugane S. Serum aminotransferase level and the risk <strong>of</strong> hepatocellular<br />

carcinoma: a population-based cohort study in<br />

Japan. Eur J Cancer Prev 2009; 18: 26-32<br />

S- Editor Sun H L- Editor O’Neill M E- Editor Ma WH<br />

921 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.922<br />

Vitamin D deficiency in cirrhosis relates to liver dysfunction<br />

rather than aetiology<br />

Mikkel Malham, Søren Peter Jørgensen, Peter Ott, Jørgen Agnholt, Hendrik Vilstrup, Mette Borre,<br />

Jens F Dahlerup<br />

Mikkel Malham, Søren Peter Jørgensen, Peter Ott, Jørgen<br />

Agnholt, Hendrik Vilstrup, Mette Borre, Jens F Dahlerup,<br />

Department <strong>of</strong> Medicine V (Hepatology and Gastroenterology),<br />

Aarhus University Hospital, DK-8000, Aarhus C, Denmark<br />

Author contributions: Malham M wrote the protocol, carried<br />

out the study and wrote the first draft <strong>of</strong> the manuscript; All<br />

authors contributed to the study design, data interpretation and<br />

analysis, preparation <strong>of</strong> the manuscript, and critical review; All<br />

authors read and approved the final manuscript.<br />

Correspondence to: Mikkel Malham, MD, Department <strong>of</strong><br />

Medicine V (Hepatology and Gastroenterology), Aarhus University<br />

Hospital, 44 Noerrebrogade, Building 1C, DK-8000,<br />

Aarhus C, Denmark. mikkel.malham@gmail.com<br />

Telephone: +45-31121035 Fax: +45-89492740<br />

Received: August 26, 2010 Revised: October 16, 2010<br />

Accepted: October 23, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To examine the vitamin D status in patients with<br />

alcoholic cirrhosis compared to those with primary biliary<br />

cirrhosis.<br />

METHODS: Our retrospective case series comprised 89<br />

patients with alcoholic cirrhosis and 34 patients with primary<br />

biliary cirrhosis who visited our outpatient clinic in<br />

2005 and underwent a serum vitamin D status assessment.<br />

RESULTS: Among the patients with alcoholic cirrhosis,<br />

85% had serum vitamin D levels below 50 nmol/L and<br />

55% had levels below 25 nmol/L, as compared to 60%<br />

and 16% <strong>of</strong> the patients with primary biliary cirrhosis,<br />

respectively (P < 0.001). In both groups, serum vitamin<br />

D levels decreased with increasing liver disease severity,<br />

as determined by the Child-Pugh score.<br />

CONCLUSION: Vitamin D deficiency in cirrhosis relates<br />

WJG|www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 922-925<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

to liver dysfunction rather than aetiology, with lower<br />

levels <strong>of</strong> vitamin D in alcoholic cirrhosis than in primary<br />

biliary cirrhosis.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Alcoholic liver cirrhosis; Child-Pugh score;<br />

Primary biliary cirrhosis; Vitamin D deficiency<br />

Peer reviewer: Lixin Zhu, MD, State University <strong>of</strong> New York,<br />

3435 Main Street, 422 BRB, Buffalo, 14214 New York,<br />

United States<br />

Malham M, Jørgensen SP, Ott P, Agnholt J, Vilstrup H, Borre<br />

M, Dahlerup JF. Vitamin D deficiency in cirrhosis relates to<br />

liver dysfunction rather than aetiology. <strong>World</strong> J Gastroenterol<br />

2011; 17(7): 922-925 Available from: URL: http://www.wjgnet.com/1007-9327/full/v17/i7/922.htm<br />

DOI: http://dx.doi.<br />

org/10.3748/wjg.v17.i7.922<br />

INTRODUCTION<br />

BRIEF ARTICLE<br />

Patients with chronic liver disease have an increased<br />

risk for the development <strong>of</strong> osteoporosis and fractures,<br />

reduced muscle strength, an impaired inflammatory response,<br />

and malignancy [1-3] . These conditions have also<br />

been associated with vitamin D deficiency [4-6] . Vitamin D<br />

deficiency and osteomalacia have been described in chronic<br />

cholestatic liver disease, such as primary biliary cirrhosis<br />

(PBC) [7] . However, the frequency <strong>of</strong> vitamin D deficiency,<br />

specifically in alcoholic liver cirrhosis (ALC), has not been<br />

well described. The limited available data suggest that<br />

there is a high frequency <strong>of</strong> vitamin D deficiency in patients<br />

with chronic liver disease [8,9] .<br />

The main source <strong>of</strong> vitamin D in humans is the exposure<br />

<strong>of</strong> skin to sunlight. For further activation, vitamin<br />

D is hydroxylated in the liver to form 25-(OH) vitamin D<br />

922 February 21, 2011|Volume 17|Issue 7|

---

(25-OHD) and in the kidneys to form the active metabolite<br />

1,25(OH)2 vitamin D. The body stores <strong>of</strong> vitamin D<br />

are best reflected by the serum levels <strong>of</strong> 25-(OH)D [10] .<br />

The aim <strong>of</strong> the present study was to describe the<br />

serum vitamin D status in a retrospective case series <strong>of</strong><br />

patients with ALC compared to those with PBC. Patients<br />

with PBC were considered a priori to demonstrate a high<br />

incidence <strong>of</strong> vitamin D deficiency.<br />

MATERIALS AND METHODS<br />

We collected data from the medical records <strong>of</strong> all patients<br />

with a diagnosis <strong>of</strong> PBC or ALC who visited our outpatient<br />

clinic in 2005. A total <strong>of</strong> 205 patients were identified:<br />

58 had PBC, and 147 had ALC. The study population<br />

comprised patients for whom vitamin D measurements<br />

had been completed and for whom the Child-Pugh status<br />

could be assessed (34 and 89 patients, respectively). In patients<br />

who had undergone serial vitamin D measurements,<br />

the first blood sample collected in 2005 was used. The<br />

vitamin D status was defined according to the following<br />

levels <strong>of</strong> 25-(OH)D: severe deficiency: 0-12.5 nmol/L,<br />

deficiency: 12.5-25 nmol/L, insufficiency: 25-50 nmol/L,<br />

and vitamin D replete: > 50 nmol/L [11] . Data concerning<br />

previous and ongoing vitamin D supplementation were<br />

collected from the patients’ medical records. To assess the<br />

severity <strong>of</strong> liver disease, the patients were scored according<br />

to the Child-Pugh classification. This score is based<br />

on the degree <strong>of</strong> encephalopathy, the presence <strong>of</strong> ascites,<br />

prothrombin time, and the serum levels <strong>of</strong> bilirubin, and<br />

albumin. The score ranges from 5 to 15 with increasing<br />

severity. Accordingly, the patients had either compensated<br />

liver disease (Class A, 5-6 points), moderate liver disease<br />

(Class B, 7-9 points), or severe liver disease (Class C, 10-15<br />

points).<br />

Techniques<br />

Plasma 25(OH)D2 and 25(OH)D3 were analysed by<br />

isotope-dilution liquid chromatography-tandem mass spectrometry<br />

using an API3000 TM mass spectrometer (Applied<br />

Biosystems, Foster City, CA, USA) and a method adapted<br />

from Maunsell et al [12] . The interassay variation coefficients<br />

for plasma 25(OH)D2 were 8.5% at 23.4 nmol/L and 8.0%<br />

at 64.4 nmol/L, and for plasma 25(OH)D3 these values<br />

were 9.6% at 24.8 nmol/L and 8.1% at 47.7 nmol/L.<br />

Statistics<br />

Non-parametric statistics were used for the descriptions,<br />

and the Mann-Whitney U test was employed for comparisons<br />

between groups. The association between two variables<br />

was assessed by the contingency coefficient C, and<br />

statistical significance was determined using the χ 2 test.<br />

RESULTS<br />

In the patients with ALC, 18% had a severe vitamin D<br />

deficiency. In comparison, none <strong>of</strong> the patients with PBC<br />

had such a deficiency. Similarly, in a comparison <strong>of</strong> patients<br />

WJG|www.wjgnet.com<br />

25-OH vitamin D (nmol/L)<br />

Malham M et al . Vitamin D deficiency in liver cirrhosis<br />

160<br />

140<br />

120<br />

100<br />

80<br />

60<br />

40<br />

20<br />

0<br />

Table 1 Study group stratified according to the Child-Pugh<br />

class and the degree <strong>of</strong> vitamin D deficiency<br />

Vitamin D (nmol/L) Child-Pugh group<br />

with ALC and PBC, vitamin D deficiency was identified in<br />

37% vs 16% and vitamin D insufficiency was identified in<br />

30% vs 41% <strong>of</strong> patients, respectively. Only 15% <strong>of</strong> patients<br />

with ALC were vitamin D replete in comparison to 40%<br />

<strong>of</strong> patients with PBC. The median 25-OHD blood concentration<br />

in ALC patients was 24 nmol/L, or 53% <strong>of</strong> the<br />

median serum level <strong>of</strong> 45 nmol/L in PBC patients (P <<br />

0.001, Mann-Whitney U test) (Figure 1).<br />

Four patients with ALC and 13 patients with PBC<br />

were receiving vitamin D supplementation at the time<br />

<strong>of</strong> blood sampling. Their vitamin D levels did not differ<br />

from those determined in patients who did not receive<br />

supplementation.<br />

The distribution <strong>of</strong> Child-Pugh groups A, B, and C differed<br />

between ALC and PBC patients. Patients with ALC<br />

demonstrated more advanced disease (16 A, 36 B, and 37 C)<br />

compared to those with PBC (33 A, 1 B, and no C). In all<br />

the cirrhotic patients, there was an association between the<br />

Child-Pugh score and vitamin D status (contingency coefficient<br />

C = 0.29, P < 0.05, χ 2 test) (Table 1).<br />

DISCUSSION<br />

P < 0.0001<br />

PBC ALC<br />

50 nmol/L<br />

25 nmol/L<br />

12.5 nmol/L<br />

Figure 1 Vitamin D levels in the study group. Vitamin D levels in 37 patients<br />

with primary biliary cirrhosis and 89 patients with alcoholic liver cirrhosis. Patients<br />

with alcoholic liver cirrhosis demonstrated significantly lower overall vitamin D<br />

levels in comparison to patients with primary biliary cirrhosis (P < 0.0001, Mann-<br />

Whitney U test). PBC: Primary biliary cirrhosis; ALC: Alcoholic liver cirrhosis.<br />

A B C<br />

< 25 17 15 21<br />

25-50 14 16 12<br />

> 50 18 6 4<br />

The vast majority (85%) <strong>of</strong> patients with ALC presented<br />

a compromised vitamin D status. The same was found<br />

in fewer than half <strong>of</strong> the patients with PBC (47%). This<br />

finding is in contrast to the standard clinical knowledge<br />

that vitamin D deficiency is expected in PBC. Further-<br />

923 February 21, 2011|Volume 17|Issue 7|

---

Malham M et al . Vitamin D deficiency in liver cirrhosis<br />

more, this marked vitamin D deficiency has never been<br />

demonstrated in a study population <strong>of</strong> this size.<br />

Our study group included 60% <strong>of</strong> the cirrhotic patients<br />

who were seen at our clinic during 2005. This distribution<br />

does not introduce a selection bias because the<br />

vitamin D measurements were ordered without physician<br />

knowledge <strong>of</strong> the study purpose. Because the intensity<br />

<strong>of</strong> sunlight changes throughout the year, there might<br />

have been a seasonal difference in the vitamin D levels<br />

according to when the blood samples were drawn. However,<br />

patients were recruited throughout the year in both<br />

groups, and therefore, seasonal changes should not affect<br />

comparisons between the two groups.<br />

The observed deficiency in vitamin D might be related<br />

to several causes: an impaired hepatic hydroxylation <strong>of</strong><br />

vitamin D, dietary insufficiency, malabsorption, reduced<br />

hepatic production <strong>of</strong> vitamin D binding protein, and<br />

an impaired cutaneous production due to either reduced<br />

exposure to sunlight or jaundice [9,13] . The observation that<br />

the deficiency was less pronounced in PBC patients suggests<br />

that bile acid-related lipid malabsorption is not the<br />

only mechanism involved in vitamin D deficiency. It seems<br />

plausible that the mechanism <strong>of</strong> vitamin D deficiency is<br />

multifactorial and differs between the two groups <strong>of</strong> cirrhotic<br />

patients. When the results were stratified according<br />

to the Child-Pugh class, an association was observed<br />

between vitamin D deficiency and the severity <strong>of</strong> liver<br />

disease. This association has never been demonstrated in<br />

such a large study population. Thus, the better preservation<br />

<strong>of</strong> vitamin D status in patients with PBC might be<br />

ascribed to the diminished severity <strong>of</strong> their liver disease, as<br />

assessed by their Child-Pugh scores. Based on this finding,<br />

one could hypothesise that the risk for vitamin D deficiency<br />

or insufficiency might be influenced more by the degree<br />

<strong>of</strong> liver dysfunction than by the aetiology <strong>of</strong> the liver disease.<br />

However, our study was not designed to elucidate the<br />

exact mechanism underlying the vitamin D deficiency. The<br />

purpose <strong>of</strong> the study was to emphasise the importance <strong>of</strong><br />

monitoring the vitamin D status in all patients with cirrhosis,<br />

especially those with ALC for whom nutritional status<br />

has been a relatively neglected area <strong>of</strong> study.<br />

Our results imply that vitamin D deficiency is highly<br />

prevalent in patients with ALC. Because this was a retrospective<br />

study, we cannot extrapolate the results to the<br />

general population <strong>of</strong> cirrhotic patients. However, these<br />

results indicate that the frequency and severity <strong>of</strong> vitamin<br />

D deficiency in ALC patients warrant greater attention,<br />

similar to the usual clinical practice in patients with PBC.<br />

Although 17 <strong>of</strong> the study patients received vitamin D<br />

supplementation, this supplementation was clearly insufficient,<br />

as their vitamin D concentrations remained low.<br />

Thus, it appears that the vitamin D deficiency in these<br />

patients should be treated with higher doses <strong>of</strong> vitamin D<br />

than that used in standard clinical practice for repletion.<br />

The risk for bone disease in cirrhotic patients justifies<br />

the use <strong>of</strong> routine vitamin D therapy. Furthermore,<br />

the patients might also benefit from correction <strong>of</strong> their<br />

WJG|www.wjgnet.com<br />

vitamin D status with respect to reduced muscle function,<br />

<strong>cancer</strong> risk, and immune impairment.<br />

COMMENTS<br />

Background<br />

Patients with liver cirrhosis have an increased incidence <strong>of</strong> <strong>cancer</strong>, infections,<br />

osteoporosis, and decreased muscle strength. Vitamin D deficiency is associated<br />

with these complications in other patient groups and could be partially<br />

involved in the clinical complications related to cirrhosis.<br />

Research frontiers<br />

Vitamin D deficiency is a well reported complication in chronic cholestatic liver<br />

disease such as primary biliary cirrhosis. While the prevalence and treatment <strong>of</strong><br />

this deficiency has been addressed in many articles over the last decades, little<br />

is known <strong>of</strong> the vitamin D status in alcoholic liver cirrhosis.<br />

Innovations and breakthroughs<br />

Recent studies imply that vitamin D deficiency is frequent in all patients with<br />

cirrhosis. The current study shows that vitamin D deficiency is more frequent<br />

and severe in patients with alcoholic liver cirrhosis than in patients with primary<br />

biliary cirrhosis. Furthermore, it indicates that the degree <strong>of</strong> liver dysfunction,<br />

rather than the aetiology <strong>of</strong> cirrhosis, dictates the risk <strong>of</strong> vitamin D deficiency.<br />

Applications<br />

This study emphasizes the importance <strong>of</strong> monitoring vitamin D levels in all<br />

patients with cirrhosis. However, further studies are needed to find the most<br />

favourable form <strong>of</strong> vitamin D supplementation for these patients.<br />

Terminology<br />

Primary biliary cirrhosis and alcoholic cirrhosis are two different diseases that<br />

cause cirrhosis <strong>of</strong> the liver. While primary biliary cirrhosis is a cholestatic, autoimmune<br />

disease, alcoholic liver cirrhosis is an alcohol-induced liver disease usually<br />

without cholestatic features. The Child-Pugh score assesses the prognosis in patients<br />

with cirrhosis and is also used to quantitate the degree <strong>of</strong> liver dysfunction.<br />

Peer review<br />

This brief article nicely demonstrated the association <strong>of</strong> the liver damage severity<br />

with the level <strong>of</strong> 25-hydroxy vitamin D. This is a very important report, as many<br />

doctors do not realize that liver damage could cause significant vitamin D deficiency.<br />

REFERENCES<br />

1 Ormarsdóttir S, Ljunggren O, Mallmin H, Michaëlsson K,<br />

Lööf L. Increased rate <strong>of</strong> bone loss at the femoral neck in<br />

patients with chronic liver disease. Eur J Gastroenterol Hepatol<br />

2002; 14: 43-48<br />

2 Sorensen HT, Friis S, Olsen JH, Thulstrup AM, Mellemkjaer<br />

L, Linet M, Trichopoulos D, Vilstrup H, Olsen J. Risk <strong>of</strong> liver<br />

and other types <strong>of</strong> <strong>cancer</strong> in patients with cirrhosis: a nationwide<br />

cohort study in Denmark. Hepatology 1998; 28: 921-925<br />

3 Wasmuth HE, Kunz D, Yagmur E, Timmer-Stranghöner<br />

A, Vidacek D, Siewert E, Bach J, Geier A, Purucker EA,<br />

Gressner AM, Matern S, Lammert F. Patients with acute on<br />

chronic liver failure display "sepsis-like" immune paralysis. J<br />

Hepatol 2005; 42: 195-201<br />

4 Glerup H, Mikkelsen K, Poulsen L, Hass E, Overbeck S,<br />

Andersen H, Charles P, Eriksen EF. Hypovitaminosis D<br />

myopathy without biochemical signs <strong>of</strong> osteomalacic bone<br />

involvement. Calcif Tissue Int 2000; 66: 419-424<br />

5 Holick MF. Sunlight and vitamin D for bone health and<br />

prevention <strong>of</strong> autoimmune diseases, <strong>cancer</strong>s, and cardiovascular<br />

disease. Am J Clin Nutr 2004; 80: 1678S-1688S<br />

6 Lappe JM, Travers-Gustafson D, Davies KM, Recker RR, Heaney<br />

RP. Vitamin D and calcium supplementation reduces<br />

<strong>cancer</strong> risk: results <strong>of</strong> a randomized trial. Am J Clin Nutr<br />

2007; 85: 1586-1591<br />

7 Reed JS, Meredith SC, Nemchausky BA, Rosenberg IH,<br />

Boyer JL. Bone disease in primary biliary cirrhosis: reversal<br />

924 February 21, 2011|Volume 17|Issue 7|

---

<strong>of</strong> osteomalacia with oral 25-hydroxyvitamin D. Gastroenterology<br />

1980; 78: 512-517<br />

8 Crawford BA, Kam C, Donaghy AJ, McCaughan GW. The<br />

heterogeneity <strong>of</strong> bone disease in cirrhosis: a multivariate<br />

analysis. Osteoporos Int 2003; 14: 987-994<br />

9 Fisher L, Fisher A. Vitamin D and parathyroid hormone in<br />

outpatients with noncholestatic chronic liver disease. Clin<br />

Gastroenterol Hepatol 2007; 5: 513-520<br />

10 Crawford BA, Labio ED, Strasser SI, McCaughan GW. Vitamin<br />

D replacement for cirrhosis-related bone disease. Nat<br />

WJG|www.wjgnet.com<br />

Malham M et al . Vitamin D deficiency in liver cirrhosis<br />

Clin Pract Gastroenterol Hepatol 2006; 3: 689-699<br />

11 Lips P. Which circulating level <strong>of</strong> 25-hydroxyvitamin D is<br />

appropriate? J Steroid Biochem Mol Biol 2004; 89-90: 611-614<br />

12 Maunsell Z, Wright DJ, Rainbow SJ. Routine isotope-dilution<br />

liquid chromatography-tandem mass spectrometry assay for<br />

simultaneous measurement <strong>of</strong> the 25-hydroxy metabolites <strong>of</strong><br />

vitamins D2 and D3. Clin Chem 2005; 51: 1683-1690<br />

13 Pappa HM, Bern E, Kamin D, Grand RJ. Vitamin D status<br />

in gastrointestinal and liver disease. Curr Opin Gastroenterol<br />

2008; 24: 176-183<br />

S- Editor Sun H L- Editor Webster JR E- Editor Lin YP<br />

925 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.926<br />

BRIEF ARTICLE<br />

Natural orifice transluminal endoscopic wedge hepatic<br />

resection with a water-jet hybrid knife in a non-survival<br />

porcine model<br />

Hong Shi, Sheng-Jun Jiang, Bin Li, Deng-Ke Fu, Pei Xin, Yong-Guang Wang<br />

Hong Shi, Bin Li, Pei Xin, Yong-Guang Wang, Institute <strong>of</strong><br />

Minimally Invasive Medicine, Tongji University, Shanghai<br />

200092, China<br />

Hong Shi, Sheng-Jun Jiang, Bin Li, Deng-Ke Fu, Pei Xin,<br />

Yong-Guang Wang, Department <strong>of</strong> Minimally Invasive Surgery,<br />

Beijing Chuiyangliu Hospital, Beijing 100022, China<br />

Author contributions: Shi H, Jiang SJ and Wang YG designed<br />

the study; Shi H wrote the first draft <strong>of</strong> the paper; all the authors<br />

contributed to the design and interpretation <strong>of</strong> the study and to<br />

the final manuscript.<br />

Correspondence to: Yong-Guang Wang, MD, PhD, Department<br />

<strong>of</strong> Minimally Invasive Surgery, Beijing Chuiyangliu Hospital,<br />

No. 2, Chuiyangliu South Street, Chaoyang District, Beijing<br />

100022, China. endowang@vip.sina.com<br />

Telephone: +86-10-67718822 Fax: +86-10-67711960<br />

Received: October 6, 2010 Revised: November 17, 2010<br />

Accepted: November 24, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To explore the feasibility <strong>of</strong> a water-jet hybrid<br />

knife to facilitate wedge hepatic resection using a<br />

natural orifice transluminal endoscopic surgery (NOTES)<br />

approach in a non-survival porcine model.<br />

METHODS: The Erbe Jet2 water-jet system allows a<br />

needleless, tissue-selective hydro-dissection with a preselected<br />

pressure. Using this system, wedge hepatic<br />

resection was performed through three natural routes<br />

(trans-anal, trans-vaginal and trans-umbilical) in three female<br />

pigs weighing 35 kg under general anesthesia. Entry<br />

into the peritoneal cavity was via a 15-mm incision using<br />

a hook knife. The targeted liver segment was marked<br />

by an APC probe, followed by wedge hepatic resection<br />

performed using a water-jet hybrid knife with the aid <strong>of</strong><br />

a 4-mm transparent distance s<strong>of</strong>t cap mounted onto the<br />

tip <strong>of</strong> the endoscope for holding up the desired plane.<br />

The exposed vascular and ductal structures were clipped<br />

with Endoclips. Hemostasis was applied to the bleeding<br />

WJG|www.wjgnet.com<br />

926<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 926-931<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

cut edges <strong>of</strong> the liver parenchyma by electrocautery. After<br />

the procedure, the incision site was left open, and the<br />

animal was euthanized followed by necropsy.<br />

RESULTS: Using the Erbe Jet2 water-jet system, transanal<br />

and trans-vaginal wedge hepatic resection was successfully<br />

performed in two pigs without laparoscopic assistance.<br />

Trans-umbilical attempt failed due to an unstable<br />

operating platform. The incision for peritoneal entry took<br />

1 min, and about 2 h was spent on excision <strong>of</strong> the liver<br />

tissue. The intra-operative blood loss ranged from 100 to<br />

250 mL. Microscopically, the hydro-dissections were relatively<br />

precise and gentle, preserving most vessels.<br />

CONCLUSION: The Erbe Jet2 water-jet system can<br />

safely accomplish non-anatomic wedge hepatic resection<br />

in NOTES, which deserves further studies to shorten<br />

the dissection time.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Natural orifice transluminal endoscopic surgery;<br />

Hepatic resection; Water-jet; Hybrid knife; Triangulation<br />

Peer reviewer: Chih-Chi Wang, MD, Department <strong>of</strong> Surgery,<br />

Chang Gung Memorial Hospital-Kaohsiung Medical Center,<br />

123 Ta-Pei Road, Niao-Sung, Kaohsiung 833, Taiwan, China<br />

Shi H, Jiang SJ, Li B, Fu DK, Xin P, Wang YG. Natural orifice<br />

transluminal endoscopic wedge hepatic resection with a water-jet<br />

hybrid knife in a non-survival porcine model. <strong>World</strong> J Gastroenterol<br />

2011; 17(7): 926-931 Available from: URL: http://www.<br />

wjgnet.com/1007-9327/full/v17/i7/926.htm DOI: http://dx.doi.<br />

org/10.3748/wjg.v17.i7.926<br />

INTRODUCTION<br />

Liver resection, a surgical procedure consisting <strong>of</strong> he-<br />

February 21, 2011|Volume 17|Issue 7|

---

patic parenchymal dissection as well as precise identification<br />

followed by control <strong>of</strong> intra/extra-hepatic vascular<br />

and biliary anatomy, is technically challenging due to the<br />

risk <strong>of</strong> massive bleeding during operation. Since excessive<br />

hemorrhage and subsequent blood transfusion are<br />

strongly associated with increased peri-operative morbidity<br />

and mortality, technical innovations have mainly focused<br />

on minimizing blood loss [1] . Besides inflow occlusion<br />

and low central pressure used to prevent bleeding<br />

from inflow vessels and hepatic veins in the transaction<br />

surface since the early 20th century, the development <strong>of</strong><br />

specific devices for separating hepatic parenchyma, such<br />

as the ultrasonic dissector, water jet, Harmonic scalpel,<br />

Ligasure, and Tissue-Link dissecting sealer, has also<br />

contributed to bloodless transection. A meta-analysis [2]<br />

assessing the benefits and risks <strong>of</strong> current techniques <strong>of</strong><br />

parenchymal transection showed that there were no significant<br />

differences in terms <strong>of</strong> the mortality, morbidity,<br />

markers <strong>of</strong> liver parenchymal injury or liver dysfunction<br />

in pairwise comparisons including cavitron ultrasound<br />

surgical aspirator, radi<strong>of</strong>requency dissecting sealer, sharp<br />

dissection and hydro-jet. Among them, the water-jet dissector<br />

employs a pressurized jet <strong>of</strong> water to fragment the<br />

liver parenchyma tissue, with intact vascular and ductal<br />

structures, which can be ligated with staplers or clipped<br />

with titanium hemoclips, resulting in reduced blood loss,<br />

transfusion requirement, and biliary leak [3] .<br />

High-pressure water-jet dissection technology was<br />

originally developed in the steel and glass industries,<br />

where ultra-precise cutting and engraving were considered<br />

as pr<strong>of</strong>essional demands [4] . Since introduced to<br />

medical application in 1982 [5] , this technology (Hydro-<br />

Jet ® ; ERBE, Tuebingen, Germany) has been successfully<br />

employed in open and laparoscopic operations, achieving<br />

favorable results in precise, controllable tissue-selective<br />

(indicating water-rich tissue such as liver parenchyma)<br />

dissection with excellent visualization and minimal injury<br />

to the surrounding fibrous structures (such as ductal and<br />

vessel systems with a high content <strong>of</strong> collagen and elastin)<br />

[6] . The above-mentioned Helix Hydro-Jet device with<br />

a rigid hand-held applicator is not designed with sufficient<br />

flexibility for natural orifice transluminal endoscopic<br />

surgery (NOTES) procedures, and can not be passed<br />

through a standard working channel <strong>of</strong> the current flexible<br />

endoscope because its outer-diameter is larger than<br />

the endoscopic operative channel. Now a new water-jet<br />

hybrid knife [7] incorporating with high-pressure water-jet<br />

and radi<strong>of</strong>requency may overcome this drawback. It has<br />

a smaller size, being easy to handle, and showing more<br />

preciseness, with almost linear correlation <strong>of</strong> pressure<br />

and dissection depth, and less foaming compared with<br />

the precursor model Helix Hydro-Jet [5] .<br />

As is known, trans-luminal liver resection is technically<br />

demanding and its expansion has been lagged behind<br />

other NOTES procedures. Phee et al [8] demonstrated for<br />

the first time how a dexterous master and slave transluminal<br />

endoscopic robot could efficiently perform the<br />

wedge hepatic resection without laparoscopic assistance.<br />

Unfortunately, this technology is still an unexplored field<br />

WJG|www.wjgnet.com<br />

Shi H et al . Water-jet system in NOTES liver resection<br />

in China. The aim <strong>of</strong> our study was to explore the safety<br />

and efficacy <strong>of</strong> a water-jet hybrid knife to facilitate wedge<br />

hepatic resection using a NOTES approach in a nonsurvival<br />

porcine model.<br />

MATERIALS AND METHODS<br />

Experimental design<br />

This non-survival study evaluated the performance <strong>of</strong><br />

the water-jet hybrid knife during NOTES procedure in<br />

a live porcine model. A pilot experiment in an isolated<br />

liver was conducted first, and followed by an open procedure<br />

in a 35-kg female porcine model. The formal<br />

study included three operations <strong>of</strong> wedge hepatic resection<br />

using NOTES and water-jet technology through<br />

three respective natural routes (trans-anal, trans-vaginal<br />

and trans-umbilical). The outcome measures were the<br />

time spent in performing a trans-visceral incision, the<br />

time spent in excising the liver segment, and the blood<br />

loss including oozing and brisk vascular hemorrhage, determined<br />

as blood accumulation in the suction device.<br />

This study was conducted with prior approval by the<br />

Institutional Animal Care and Use Committee <strong>of</strong> Tongji<br />

University <strong>of</strong> China.<br />

Experimental animal and instrument<br />

Transluminal hepatic wedge hydro-dissection was performed<br />

in three 35-kg female pigs. The pigs were food<br />

deprived but allowed liquids for 24 h before the procedure.<br />

Urethral catheterization and warm saline enema<br />

were conducted immediately before surgery. The animals<br />

were then transferred to an operating table, and placed<br />

in supine position.<br />

The water-jet hybrid knife (Erbe Elektromedizin) used<br />

in this study is a stainless-steel tube that incorporates a<br />

microcapillary with a diameter <strong>of</strong> 150 mm [7] . The flexible<br />

instrument has an outer diameter <strong>of</strong> 2.1 mm and a length<br />

<strong>of</strong> 2.20 mm so that it can pass through the operating<br />

channels (diameter, 2.8 and 3.7 mm) <strong>of</strong> a forward-viewing<br />

dual-channel therapeutic endoscope (GIF-2T160; Olympus<br />

Medical Systems Corporation, Tokyo, Japan). The hybrid<br />

knife can be used for hydro-dissection, rinsing blood<br />

clot and rinsing for a better endoscopic view by waterjet<br />

application, as well as coagulation by radi<strong>of</strong>requency<br />

application. The foaming with the use <strong>of</strong> the hybridknife<br />

can be scavenged by the suction mechanism <strong>of</strong> the<br />

endoscope. In NOTES procedure, a 4-mm transparent<br />

distance s<strong>of</strong>t cap was mounted onto the tip <strong>of</strong> the endoscope<br />

for holding up the desired surface, subsequently<br />

avoiding the deviation in the direction <strong>of</strong> the water-jet.<br />

However, it was not used in the previous open procedure,<br />

because distraction (with surgical retractors) could allow<br />

the water-jet hybrid knife to effectively dissect the tissue<br />

by exposing the base <strong>of</strong> the cutting plane.<br />

Rau et al [6] found that a pressure <strong>of</strong> 30-40 bar was very<br />

effective to dissect normal human liver tissues, and the<br />

long-distance transmission attenuation was about 10%.<br />

Therefore, we set the pressure at 45 bar, which was proved<br />

to be effective in our pilot experiment and open operation.<br />

927 February 21, 2011|Volume 17|Issue 7|

---

Shi H et al . Water-jet system in NOTES liver resection<br />

Figure 1 Colostomy on anterior wall <strong>of</strong> <strong>rectal</strong> junction and sigmoid colon.<br />

At the beginning <strong>of</strong> trans-annual natural orifice transluminal endoscopic surgery<br />

procedure, entry into the peritoneal cavity was via a 15-mm linear incision using<br />

the hook knife (cutting width set at 6 units and cutting interval set at 1 unit). The<br />

ideal access point was the junction <strong>of</strong> rectum and sigmoid colon at a distance <strong>of</strong><br />

15-20 cm away from the anus.<br />

Figure 2 Hydro-dissection <strong>of</strong> liver segment in natural orifice transluminal<br />

endoscopic surgery procedure. Hepatic parenchyma dissection was performed<br />

using the water-jet hybrid knife kept away from the tissue in a no-touch<br />

fashion and perpendicular to but not tangentially against the predetermined<br />

surface, keeping in a smooth, reproducible, back-and-forth waving motion. A<br />

4-mm transparent distance s<strong>of</strong>t cap was mounted onto the tip <strong>of</strong> the endoscope<br />

for holding up the desired surface, subsequently avoiding the deviation in the<br />

direction <strong>of</strong> the water-jet.<br />

Other instruments used were as follows: a flexible sterile<br />

overtube (MD48618, Sumitomo Bakelite, Tokyo, Japan),<br />

a transparent distance flat s<strong>of</strong>t cap (D-201-13404, Olympus),<br />

a hook knife (KD-620LR, Olympus), endoscopic hemostatic<br />

forceps (FD-410LR, Olympus), endoclips (HX-<br />

610-135L OLYMPUS, Olympus), a foreign forcep (FQ-<br />

46L-1, Olympus), APC probe (argon plasma coagulation,<br />

APC) (ERBE Elektromedizin), and the modular VIO<br />

generator (VIO 300D; Erbe Elektromedizin, Tubingen,<br />

Germany).<br />

Experimental procedure<br />

Anesthesia was induced with 5% is<strong>of</strong>lurane administered<br />

intravenously. The animal was then intubated with endoendotracheal<br />

tube, followed by general anesthesia with<br />

1%-2% is<strong>of</strong>lurane. Throughout the operation, oxygen<br />

was administered to the animal at a flow rate according<br />

to oxygen saturation, and both pulse rate and oxygen<br />

WJG|www.wjgnet.com<br />

Figure 3 Hydro-dissection <strong>of</strong> liver segment in open procedure. Hepatic parenchyma<br />

dissection was performed using the water-jet hybrid knife in a similar<br />

natural orifice transluminal endoscopic surgery procedure, except that the 4-mm<br />

transparent distance s<strong>of</strong>t cap was not used.<br />

saturation were monitored continuously using the pulse<br />

oximeter clamped to the animal tougue. Then normal<br />

saline enema was administered to each animal. Residual<br />

stool would be removed with aggressive washing, and<br />

suctioning during endoscopic inspection.<br />

At the beginning <strong>of</strong> the procedure, entry into the peritoneal<br />

cavity was via a 15-mm linear incision made by the<br />

hook knife (a cutting width was set at 6 units and cutting<br />

interval was set at 1 unit). The ideal access point was the<br />

abdominal site 1 cm away from the umbilicus in transumbilical<br />

route, the bottom <strong>of</strong> the vagina in trans-vaginal<br />

route, the junction <strong>of</strong> rectum and sigmoid colon at a distance<br />

<strong>of</strong> 15-20 cm away from the anus in trans-anal route<br />

(Figure 1). Then the endoscope with a 4-mm transparent<br />

distance s<strong>of</strong>t cap mounted onto the tip <strong>of</strong> the endoscope<br />

beforehand was passed through the access to reach the<br />

peritoneum using the air inflation mechanism <strong>of</strong> the endoscope.<br />

After the target liver segment was identified, hepatic<br />

parenchymal dissection with the water-jet hybrid knife was<br />

performed in the following steps (Figure 2), which were<br />

generally similar to those in the previous open operation<br />

except the assistance <strong>of</strong> manual retraction (Figure 3). The<br />

range to be separated was marked by an APC probe. The<br />

Glisson’s capsule was scored 2-3 mm deep along the demarcated<br />

plane <strong>of</strong> transaction with the hook knife. Then<br />

hepatic parenchyma dissection was performed using the<br />

water-jet hybrid knife kept away from the tissue in a notouch<br />

fashion. The tip <strong>of</strong> the knife was perpendicular to<br />

but not tangentially against the predetermined surface (this<br />

was achieved with a 4-mm transparent distance s<strong>of</strong>t cap<br />

mounted onto the tip <strong>of</strong> the endoscope for holding up<br />

the desired surface, subsequently avoiding the deviation<br />

in the direction <strong>of</strong> the water-jet). A smooth, reproducible,<br />

back-and-forth waving motion was used. Minor slow<br />

oozing from the cutting surface was controlled using the<br />

same knife, the hook knife or APC probe to initiate bursts<br />

<strong>of</strong> coagulation. Visible intra-hepatic vascular and ductal<br />

structures were clipped with endoscopic hemoclips. Once<br />

the liver segment was completely free and after checking<br />

for hemostasis, the incision was slightly enlarged, then an<br />

928 February 21, 2011|Volume 17|Issue 7|

---

Table 1 Comparisons <strong>of</strong> three routes for natural orifice transluminal endoscopic surgery procedure<br />

Items Trans-umbilical route Trans-anal route Trans-vaginal route<br />

Access position Visually inspected at para-umbilical region Verified by finger<br />

pressing<br />

endoscopic retrieval net was inserted through the endoscopic<br />

working channel and the specimen was introduced<br />

into the net and was retrieved intactly. After the procedure,<br />

the incision site was left open, and the animal was<br />

euthanized followed by necropsy.<br />

Histopathological examination<br />

Histologic examination was performed for all dissected<br />

specimens. The results were observed under microscope<br />

after hematoxylin and eosin staining based on the characteristics<br />

<strong>of</strong> the dissection margins, vessel preservation and<br />

dissection impact on the surrounding tissues. Thermal<br />

alterations such as edema and structural changes <strong>of</strong> different<br />

layers <strong>of</strong> the specimen were also microscopically<br />

analyzed.<br />

RESULTS<br />

It took 20 min to complete the excision <strong>of</strong> a liver segment<br />

50 mm × 30 mm × 10 mm in size during the pilot<br />

experiment, and 45 min to complete the excision <strong>of</strong> a<br />

liver segment 45 mm × 25 mm × 10 mm in size during<br />

the open procedure. The blood loss was 100 mL in the<br />

open operation.<br />

As for the NOTES procedure, using the Erbe Jet2 water-jet<br />

system, trans-anal and trans-vaginal wedge hepatic<br />

resections were successfully performed in two pigs without<br />

WJG|www.wjgnet.com<br />

laparoscopic assistance. Trans-umbilical attempt failed due<br />

to an unstable operating platform. Each incision for peritoneal<br />

entry took 1 min, and 2 h was spent on excision <strong>of</strong><br />

the liver tissue, indicating a hugely time-consuming part <strong>of</strong><br />

the entire procedure. There was neither hemodynamic nor<br />

pulmonary instability throughout the NOTES procedure,<br />

and target visualization within the peritoneum was always<br />

kept clear. No untoward incident such as injury to surrounding<br />

organs occurred, and the whole intra-operative<br />

blood loss ranged from 100 to 250 mL. Parenchymal<br />

bleeding from resection could be adequately controlled by<br />

electrocautery with the hybrid knife itself, the hook knife<br />

or the APC probe (Table 1, Figure 4). Since all the exposed<br />

ductal structures were successfully clipped with Endoclips,<br />

no bile leak from the remnant liver occurred.<br />

There were relatively smooth and precise cutting margins<br />

in all histological preparations. The cutting width at<br />

the bottom <strong>of</strong> the cut was similar to the dissection width<br />

at tissue surface, with little vessel damage (Figure 5). Some<br />

thermal alterations were obtained due to intra-operative<br />

electrocautery (Figure 6).<br />

DISCUSSION<br />

Located by surrounding anatomic<br />

landmarks<br />

Time to complete a trans-visceral incision About 1 min<br />

Time to reach peritoneum About 2 min<br />

Liver exposure Antero-lateral segments could be easily detected, while posterosuperior segments were hard to be explored<br />

Working platform Unstable Relatively stable<br />

Time to hydro-dissection Abandoned 1 h later 2 h 2 h and 40 min<br />

Size <strong>of</strong> resected liver segment No resected specimen was obtained due to<br />

failure in trans-umbilical hepatic resection<br />

50 mm × 25 mm ×<br />

5 mm<br />

45 mm × 30 mm × 7 mm<br />

Bile leak Not found<br />

Blood loss 100 mL 200 mL 250 mL<br />

Injury to surrounding organs Not occurred<br />

Figure 4 A resected liver segment compared with the reserved part. A<br />

resected liver segment was picked out with white gauze.<br />

Shi H et al . Water-jet system in NOTES liver resection<br />

Figure 5 Microscopic findings <strong>of</strong> water-jet dissection in liver tissues (HE<br />

stain, × 40). A smooth and gentle cutting margin was presented. The cutting<br />

width at the bottom <strong>of</strong> the cut was similar to the dissection width at tissue surface,<br />

with little vessel damage.<br />

To the best <strong>of</strong> our knowledge, this is the first study in<br />

929 February 21, 2011|Volume 17|Issue 7|

---

Shi H et al . Water-jet system in NOTES liver resection<br />

Figure 6 Thermal alterations due to intra-operative coagulation (HE stain,<br />

× 100). Removal <strong>of</strong> the liver capsule could be seen in an example <strong>of</strong> thermal<br />

damage.<br />

a non-survival porcine model evaluating the feasibility<br />

and safety <strong>of</strong> wedge hepatic resection merely using a<br />

NOTES approach, Erbe Jet2 water-jet technology and<br />

endoscopic instrument.<br />

Since first described by Kalloo et al [9] , natural orifice<br />

transluminal endoscopic surgery (NOTES) has become<br />

the newest minimally invasive surgical procedure in contrast<br />

to open and laparoscopic technology. It involves<br />

passing flexible endoscopic systems through natural orifices<br />

(per-oral, trans-vaginal, trans-anal, trans-umbilical or<br />

trans-vesical routes), approaching target organs and performing<br />

intra-abdominal procedures. For the entry into<br />

the peritoneal cavity, a trans-luminal incision is mostly created<br />

by endoscopic needle knife followed by balloon dilation.<br />

However, in our study, it was achieved just in about<br />

1 min via a hook knife, with the same desirable effect. The<br />

air-inflation mechanism <strong>of</strong> the endoscope was used to<br />

induce and maintain peritoneum, and the suction mechanism<br />

<strong>of</strong> the endoscope was used intermittently to avoid a<br />

high intra-abdominal pressure. Overall, there was neither<br />

hemodynamic nor pulmonary instability during NOTES,<br />

as described elsewhere [10] .<br />

Similar to laparoscopic liver resection, NOTES hepatic<br />

procedures must confront one and the same Achilles’<br />

heel, difficulty in obtaining hemostasis. Given the facts<br />

that protection <strong>of</strong> blood vessels is essential to minimize<br />

hemorrhage and blood transfusion, and smooth dissection<br />

margins might minimize adhesion formation [11] , the waterjet<br />

hybrid knife was taken into consideration. Hydro-dissection<br />

was accomplished with the hybrid knife kept away<br />

from the tissue in a no-touch fashion and perpendicular<br />

to but not tangentially against the predetermined surface.<br />

Minor slow oozing from the cutting surface was controlled<br />

using the same knife, the hook knife or APC probe<br />

to initiate bursts <strong>of</strong> coagulation. Visible intra-hepatic vascular<br />

and ductal structures were clipped with endoscopic<br />

hemoclip. Certainly, the need for coagulation or clipping<br />

<strong>of</strong> individual vessels led to a prolonged operative time.<br />

Current flexible endoscopes have significant limitations<br />

when used for complex therapeutic procedures. Stable<br />

platform and <strong>of</strong>f-axis operation are <strong>of</strong>ten necessary for<br />

the NOTES. However, standard endoscopic shafts are too<br />

WJG|www.wjgnet.com<br />

flexible and prone to looping, if these unfavorable factors<br />

caused the failure in transumbilical endoscopic hepatic<br />

resection. As for triangulation <strong>of</strong> endoscopically deployed<br />

instruments to approach the same target, internal double<br />

channels are small and in close proximity, producing parallelism<br />

and limiting possible triangulating interactions [12] .<br />

The operator interface parallelism does not allow satisfactory<br />

traction/countertraction for effective dissection <strong>of</strong><br />

tissue and organs. To counteract the negative impact on<br />

dissection efficiency, a 4-mm transparent distance s<strong>of</strong>t cap<br />

was mounted onto the tip <strong>of</strong> the endoscope for holding<br />

up the desired plane, subsequently avoiding the deviation<br />

in the direction <strong>of</strong> the water-jet. Unfortunately, its<br />

effect was limited due to the heavy weight <strong>of</strong> the porcine<br />

liver and the restricted field <strong>of</strong> view. As a result, excision<br />

<strong>of</strong> one piece <strong>of</strong> the same size from the porcine liver was<br />

more difficult in NOTES than in open procedure (more<br />

than 2 h was spent in NOTES, but only 45 min spent in<br />

open procedure).<br />

Notably, non-anatomic wedge hepatic resection by a<br />

NOTES approach in either our or Phee’s [8] study is still at<br />

a primary <strong>stage</strong>. As NOTES using current endoscopic instruments<br />

is technically difficult to realize pedicle control<br />

with an intrahepatic Glissonian approach [13] , it is suitable<br />

only for superficial lesions <strong>of</strong> the liver mostly with the fine<br />

trabecular infrastructures and medium caliber structures.<br />

In order to achieve the same level <strong>of</strong> segment-based laparoscopic<br />

liver resection [14] , advance in NOTES technology<br />

still has a long way to go.<br />

In conclusion, the water-jet hybrid knife with the capacity<br />

<strong>of</strong> selective vessel-sparing tissue dissection can<br />

safely accomplish non-anatomic wedge hepatic resection<br />

through a NOTES approach. At the same time, its efficiency<br />

may be discounted by endoscopic deficiencies: lack<br />

<strong>of</strong> surgical triangulation, unstable operating platform as<br />

well as transmission attenuation caused by long distance<br />

and endoscopic looping. Although this technology is only<br />

at its beginning <strong>stage</strong>, as the old saying goes: well begun is<br />

half done.<br />

ACKNOWLEDGMENTS<br />

We thank Dr. Jiang-Fan Zhu for his editorial assistance.<br />

COMMENTS<br />

Background<br />

Liver resection is technically challenging due to the risk <strong>of</strong> massive bleeding<br />

during operation. Since the early 20th century, the development <strong>of</strong> specific<br />

devices for separating hepatic parenchyma has contributed to bloodless transection.<br />

Furthermore, trans-luminal liver resection is technically demanding and<br />

its expansion has been lagged behind other natural orifice transluminal endoscopic<br />

surgery (NOTES) procedures.<br />

Research frontiers<br />

Phee described for the first time how a dexterous master and slave transluminal<br />

endoscopic robot could efficiently perform the wedge hepatic resection without<br />

laparoscopic assistance. This technology is still an unexplored field in China.<br />

Innovations and breakthroughs<br />

This is the first study to evaluate the feasibility and safety <strong>of</strong> non-anatomic<br />

wedge hepatic resection in a non-survival porcine model using a NOTES<br />

approach, Erbe Jet2 water-jet technology and endoscopic instruments. The<br />

930 February 21, 2011|Volume 17|Issue 7|

---

study demonstrated that the water-jet hybrid knife with the capacity <strong>of</strong> selective<br />

vessel-sparing tissue dissection can safely accomplish non-anatomic wedge<br />

hepatic resection through a NOTES approach.<br />

Applications<br />

Currently, non-anatomic wedge hepatic resection using NOTES approach and<br />

water-jet technology is suitable only for superficial lesions <strong>of</strong> the liver mostly<br />

with the fine trabecular infrastructures and medium caliber structures.<br />

Terminology<br />

High-pressure water-jet dissection technology was originally developed in the<br />

steel and glass industries, where ultra-precise cutting and engraving were<br />

considered as pr<strong>of</strong>essional demands [4] . Since introduced to medical application<br />

in 1982 [5] , this technology has been successfully employed in open and<br />

laparoscopic operations, achieving favorable results in precise, controllable<br />

tissue-selective dissection with excellent visualization and minimal injury to the<br />

surrounding fibrous structures (such as ductal and vessel systems with a high<br />

content <strong>of</strong> collagen and elastin).<br />

Peer review<br />

This is the study in a non-survival porcine model evaluating the feasibility and<br />

safety <strong>of</strong> wedge hepatic resection by using pure NOTES approach.<br />

REFERENCES<br />

1 Lesurtel M, Belghiti J. Open hepatic parenchymal transection<br />

using ultrasonic dissection and bipolar coagulation.<br />

HPB (Oxford) 2008; 10: 265-270<br />

2 Gurusamy KS, Pamecha V, Sharma D, Davidson BR. Techniques<br />

for liver parenchymal transection in liver resection.<br />

Cochrane Database Syst Rev 2009; CD006880<br />

3 Rau HG, Wichmann MW, Schinkel S, Buttler E, Pickelmann S,<br />

Schauer R, Schildberg FW. [Surgical techniques in hepatic resections:<br />

Ultrasonic aspirator versus Jet-Cutter. A prospective<br />

randomized clinical trial]. Zentralbl Chir 2001; 126: 586-590<br />

4 Vollmer CM, Dixon E, Sahajpal A, Cattral MS, Grant DR,<br />

Gallinger S, Taylor BR, Greig PD. Water-jet dissection for<br />

parenchymal division during hepatectomy. HPB (Oxford)<br />

2006; 8: 377-385<br />

5 Tschan CA, Tschan K, Krauss JK, Oertel J. First experimental<br />

results with a new waterjet dissector: Erbejet 2. Acta Neurochir<br />

(Wien) 2009; 151: 1473-1482<br />

WJG|www.wjgnet.com<br />

Shi H et al . Water-jet system in NOTES liver resection<br />

6 Rau HG, Duessel AP, Wurzbacher S. The use <strong>of</strong> water-jet<br />

dissection in open and laparoscopic liver resection. HPB<br />

(Oxford) 2008; 10: 275-280<br />

7 Neuhaus H, Wirths K, Schenk M, Enderle MD, Schumacher<br />

B. Randomized controlled study <strong>of</strong> EMR versus endoscopic<br />

submucosal dissection with a water-jet hybrid-knife <strong>of</strong><br />

esophageal lesions in a porcine model. Gastrointest Endosc<br />

2009; 70: 112-120<br />

8 Phee SJ, Ho KY, Lomanto D, Low SC, Huynh VA, Kencana<br />

AP, Yang K, Sun ZL, Chung SC. Natural orifice transgastric<br />

endoscopic wedge hepatic resection in an experimental model<br />

using an intuitively controlled master and slave transluminal<br />

endoscopic robot (MASTER). Surg Endosc 2010; 24: 2293-2298<br />

9 Kalloo AN, Singh VK, Jagannath SB, Niiyama H, Hill SL,<br />

Vaughn CA, Magee CA, Kantsevoy SV. Flexible transgastric<br />

peritoneoscopy: a novel approach to diagnostic and therapeutic<br />

interventions in the peritoneal cavity. Gastrointest<br />

Endosc 2004; 60: 114-117<br />

10 von Delius S, Sager J, Feussner H, Wilhelm D, Thies P,<br />

Huber W, Schuster T, Schneider A, Schmid RM, Meining A.<br />

Carbon dioxide versus room air for natural orifice transluminal<br />

endoscopic surgery (NOTES) and comparison with<br />

standard laparoscopic pneumoperitoneum. Gastrointest Endosc<br />

2010; 72: 161-169, 169.e1-2<br />

11 Dubcenco E, Grantcharov T, Streutker C. A pilot study in a<br />

survival Porcine model evaluating the feasibility and safety<br />

<strong>of</strong> adhesiolysis by using transgastric NOTES® approach,<br />

waterjet technology and endoscopic instruments. Gastrointest<br />

Endosc 2010; 71: AB198<br />

12 Thompson CC, Ryou M, Soper NJ, Hungess ES, Rothstein<br />

RI, Swanstrom LL. Evaluation <strong>of</strong> a manually driven, multitasking<br />

platform for complex endoluminal and natural<br />

orifice transluminal endoscopic surgery applications (with<br />

video). Gastrointest Endosc 2009; 70: 121-125<br />

13 Machado MA, Makdissi FF, Galvão FH, Machado MC.<br />

Intrahepatic Glissonian approach for laparoscopic right segmental<br />

liver resections. Am J Surg 2008; 196: e38-e42<br />

14 Yoon YS, Han HS, Cho JY, Ahn KS. Total laparoscopic liver<br />

resection for hepatocellular carcinoma located in all segments<br />

<strong>of</strong> the liver. Surg Endosc 2010; 24: 1630-1637<br />

S- Editor Tian L L- Editor Ma JY E- Editor Ma WH<br />

931 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.932<br />

BRIEF ARTICLE<br />

Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon<br />

<strong>cancer</strong> cells<br />

Zhi-Li Yang, Qi Zheng, Jun Yan, Ye Pan, Zhi-Gang Wang<br />

Zhi-Li Yang, Qi Zheng, Jun Yan, Ye Pan, Zhi-Gang Wang,<br />

Department <strong>of</strong> Surgery, Affiliated Sixth People’s Hospital <strong>of</strong><br />

Shanghai Jiao Tong University, Shanghai 200233, China<br />

Author contributions: Yang ZL analyzed the CD133 expression<br />

in a panel <strong>of</strong> colon <strong>cancer</strong> cell lines and spheroid culture<br />

and drafted the manuscript; Zheng Q, Yan J and Pan Y participated<br />

in the study design and performed the RT-qPCR analysis;<br />

Wang ZG conceived the study and revised the manuscript.<br />

Correspondence to: Zhi-Gang Wang, MD, Assistant Pr<strong>of</strong>essor,<br />

Department <strong>of</strong> Surgery, Affiliated Sixth People’s Hospital<br />

<strong>of</strong> Shanghai Jiao Tong University, Shanghai 200233,<br />

China. surlab@hotmail.com<br />

Telephone: +86-21-64369181 Fax: +86-21-64701361<br />

Received: August 7, 2010 Revised: November 12, 2010<br />

Accepted: November 19, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To analyze the upregulated CD133 expression in<br />

tumorigenesis <strong>of</strong> primary colon <strong>cancer</strong> cells.<br />

METHODS: Upregulated CD133 expression in tumorigenesis<br />

<strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cell lines (Lovo, Colo205,<br />

Caco-2, HCT116 and SW620) was analyzed by flow<br />

cytometry. Human colon <strong>cancer</strong> tissue samples were<br />

stained with anti-human CD133. SW620 cells were<br />

sorted according to the CD133 expression level measured<br />

by fluorescence-activated cell sorting. Spheroids<br />

<strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells were cultured with the hanging<br />

drop. Expression <strong>of</strong> CD133 and Lgr5 in spheroids<br />

<strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells and monolayer culture was<br />

detected by RT-qPCR. Spheroids <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong><br />

cells were analyzed using anti-human CD133 with immunohistochemical<br />

staining.<br />

RESULTS: CD133 antigen was expressed in colo<strong>rectal</strong><br />

<strong>cancer</strong> cell lines (Lovo, Colo205, Caco-2, HCT116 and<br />

SW620) as well as in primary and metastatic human<br />

colon <strong>cancer</strong> tissues. However, the CD133 was differently<br />

expressed in these cell lines and tissues. The<br />

expression levels <strong>of</strong> CD133 and Lgr5 were significantly<br />

WJG|www.wjgnet.com<br />

932<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 932-937<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

higher in spheroids <strong>of</strong> parental, CD133 hi and CD133 -<br />

cells than in their monolayer culture at the mRNA level<br />

(P < 0.05). Immunohistochemical staining <strong>of</strong> spheroids<br />

<strong>of</strong> CD133 - cells showed that CD133 was highly expressed<br />

in colo<strong>rectal</strong> <strong>cancer</strong> cell lines.<br />

CONCLUSION: Upregulated CD133 expression plays<br />

a role in tumorigenesis colo<strong>rectal</strong> <strong>cancer</strong> cells, which<br />

may promote the expression <strong>of</strong> other critical genes<br />

that can drive tumorigenesis.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: CD133; Colon <strong>cancer</strong> cells; Tumorigenesis;<br />

Cancer stem cells<br />

Peer reviewer: Ioannis Kanellos, Pr<strong>of</strong>essor, 4th Surgical Department,<br />

Aristotle University <strong>of</strong> Thessaloniki, Antheon 1, Panorama,<br />

Thessaloniki 55236, Greece<br />

Yang ZL, Zheng Q, Yan J, Pan Y, Wang ZG. Upregulated CD133<br />

expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells. <strong>World</strong> J Gastroenterol<br />

2011; 17(7): 932-937 Available from: URL: http://<br />

www.wjgnet.com/1007-9327/full/v17/i7/932.htm DOI: http://<br />

dx.doi.org/10.3748/wjg.v17.i7.932<br />

INTRODUCTION<br />

CD133, also known as prominin-1, a transmembrane pentaspan<br />

protein, is originally described as a surface antigen<br />

specific for human hematopoietic stem and progenitor<br />

cells [1,2] . Later, CD133 is recognized as a stem cell marker<br />

for other normal tissues <strong>of</strong> brain [3] , kidney [4] , prostate [5] ,<br />

liver [6] , pancreas [7] , and skin [8] . It has been increasingly reported<br />

that CD133 is a marker <strong>of</strong> putative <strong>cancer</strong> stem<br />

cells (CSC) in brain tumor [9,10] , prostate <strong>cancer</strong> [11] , colon<br />

<strong>cancer</strong> [12-14] , lung <strong>cancer</strong> [15] , hepatocellular carcinoma [16] ,<br />

melanoma [17] , ovarian <strong>cancer</strong> [18] , and pancreatic <strong>cancer</strong> [19] .<br />

Accordingly, CD133 has been referred to as “the molecule<br />

<strong>of</strong> the moment” [20] .<br />

February 21, 2011|Volume 17|Issue 7|

---

It has been recently shown that CD133 expression is<br />

broadly distributed in primary colon <strong>cancer</strong> cells including<br />

<strong>cancer</strong> stem cells, both CD133 + and CD133 - metastatic<br />

colon <strong>cancer</strong> cells initiate tumors [21-23] . However,<br />

whether CD133 expression plays a role in tumorigenesis<br />

<strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells is unknown.<br />

In the present study, upregulated CD133 expression in<br />

several colo<strong>rectal</strong> <strong>cancer</strong> cell lines as well as in human primary<br />

and metastatic colon <strong>cancer</strong> tissue samples was analyzed.<br />

SW620 cell line was sorted using CD133 antigen.<br />

Spheroids <strong>of</strong> parental, CD133 - and CD133 hi cells were cultured<br />

with the hanging drop. Expressions <strong>of</strong> CD133 and<br />

Lgr5 were detected in spheroids <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells.<br />

CD133 was widely expressed in human colo<strong>rectal</strong> <strong>cancer</strong><br />

cell lines as well as in primary and metastatic colon <strong>cancer</strong><br />

tissues and upregulated CD133 expression was detected<br />

in spheroids <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells, indicating that upregulated<br />

CD133 expression may promote the expression<br />

<strong>of</strong> other critical genes that can drive tumorigenesis.<br />

MATERIALS AND METHODS<br />

Cell lines and cell culture and tissue samples<br />

Human colo<strong>rectal</strong> <strong>cancer</strong> cell lines (Lovo, Colo205, Caco-2,<br />

HCT116 and SW620) were cultured in RPMI1640 medium<br />

containing 10% fetal bovine serum (FBS), 2 mmol/L<br />

L-glutamine, 10 μmol/L thioglycerol, 12.5 U insulin,<br />

0.5 mg hydrocostisone, and 30mg penicillin G/0.05 g<br />

streptomycin. Colo<strong>rectal</strong> <strong>cancer</strong> cells were cultured at<br />

37℃ in a humidified atmosphere containing 10% CO2.<br />

CD133 expression was detected in formalin-fixed, paraffinembedded<br />

primary and metastatic colo<strong>rectal</strong> <strong>cancer</strong> tissue<br />

samples from Affiliated Sixth People’s Hospital <strong>of</strong> Shanghai<br />

Jiaotong University. The study was approved by the<br />

Ethics Committee <strong>of</strong> Affiliated Sixth People’s Hospital <strong>of</strong><br />

Shanghai Jiaotong University.<br />

Fluorescence-activated cell sorting<br />

Single-cell suspensions were stained with antibodies against<br />

human CD133 (AC133, 1:40) and human CD133/1 and<br />

CD133/2(1:10, APC conjugated, Miltenyi Biotech, Germany).<br />

Dead cells, cell debris, doublets and aggregates were<br />

excluded by forward and side scattering and pulse-width<br />

gating. Colo<strong>rectal</strong> <strong>cancer</strong> ells (1 × 10 5 ) were stained in an eppendorf<br />

tube. Primary antibody was incubated for 45 min<br />

on ice and second antibody (anti-mouse Alexa488, 1:400)<br />

was incubated for 30 min on ice in the dark. Flow cytometry<br />

analysis was carried out on a fluorescence-activated cell<br />

sorting (FACS) caliber (BD). Colo<strong>rectal</strong> <strong>cancer</strong> ells (1 × 10 6 )<br />

were prepared for sorting, stained with human CD133/1<br />

(1:10, APC conjugated, Miltenyi Biotech) and 1 μg/mL<br />

propidium iodide (PI) to exclude dead cells during sorting.<br />

The cells were sorted using FACSAria (BD). Matched isotype<br />

antibodies were applied in parallel as controls.<br />

Colon spheroids were culture with hanging drop<br />

SW620 colo<strong>rectal</strong> <strong>cancer</strong> cells and their sorted CD133 -<br />

and CD133 hi cells were prepared as a single cell suspension.<br />

The cells were counted and diluted in RPMI1640<br />

WJG|www.wjgnet.com<br />

Yang ZL et al . Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells<br />

containing 20% FBS and antibiotics to a concentration <strong>of</strong><br />

500 cells per 20 μL/drop in a sterile basin. The lid was lifted,<br />

inverted and placed on top <strong>of</strong> the dish containing 10<br />

mL PBS. An 8-channel pipette was used to make rows <strong>of</strong><br />

20 μL drops on the up-turned inner surface <strong>of</strong> the tissue<br />

culture dish lid. The drops were incubated at 37℃ in an<br />

atmosphere containing 10% CO2 for 10 d.<br />

Immunohistochemistry<br />

Frozen sections <strong>of</strong> the spheroids <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells<br />

were fixed in acetone at -20℃ for 10 min and rehydrated<br />

in PBS. Endogenous peroxidase was inactivated by immersing<br />

the sections in 0.3% hydrogen peroxide for 20<br />

min. The primary antibody for frozen sections <strong>of</strong> the<br />

spheroids <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells and paraffin-embedded<br />

sections <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> tissue samples was a mouse<br />

anti-human monoclonal CD133/2 (1:40, Miltenyi Biotech,<br />

Germany) and a rabbit anti-human polyclonal CD133<br />

(1:100, Abcam, England), respectively. The sections were<br />

incubated overnight at 4℃ in a humidified chamber, then<br />

with biotinylated secondary antibody (VECTASTAIN<br />

ABC kit, Vector Laboratories) for 30 min at room temperature.<br />

Each section was incubated with the VECTASTAIN<br />

ABC reagent for 30 min at room temperature. The sections<br />

were developed using the DAB (Vector Laboratories)<br />

as the substrate and then counterstained with hematoxylin.<br />

The negative control was performed by incubating samples<br />

with PBS.<br />

Quantification <strong>of</strong> CD133 expression by quantitative<br />

polymerase chain reaction<br />

Total RNA was isolated from cultured colo<strong>rectal</strong> <strong>cancer</strong><br />

cells and their spheroids using the RNeasy extraction<br />

kit (GE Healthcare) and reverse transcribed using<br />

high-capacity cDNA reverse transcription kit (Applied<br />

Biosystems) according to their manufacturer’s instructions,<br />

respectively. Relative quantitative polymerase chain<br />

reaction (PCR) was performed on a 7300 fast real-time<br />

PCR system (Applied Biosystems) using SYBR green<br />

PCR master mix (Applied Biosystems). The humanspecific<br />

intron spanning primer pairs for CD133 were<br />

provided by QIAGEN (Catalog number: QT00075586).<br />

The sequences <strong>of</strong> primer pairs used for GAPDH and<br />

Lgr5 are CAATGACCCCTTCATTGACC (forward) and<br />

TGATGACAAGCTTCCCGTTC (reverse), and CTTC-<br />

CAACCTCAGCGTCTTC (forward) and TTTCCCG-<br />

CAAGACGTAACTC (reverse), respectively. PCR was<br />

performed for 1 cycle at 50℃ for 2 min and 1 cycle at<br />

95℃ for 10 min, followed by 40 cycles at 95℃ for 15 s<br />

and 60℃ for 1 min. Specificity <strong>of</strong> PCR products was<br />

tested according to the dissociation curves. Relative values<br />

<strong>of</strong> transcripts were calculated using the equation: 2 -ΔΔCt ,<br />

where ΔCt is equal to the difference in threshold cycles<br />

for target and reference.<br />

Statistical analysis<br />

Results were expressed as mean ± SD for three repeated<br />

individual experiments in each group. Statistical analyses<br />

were conducted using the SPSS s<strong>of</strong>tware (version 10.0).<br />

933 February 21, 2011|Volume 17|Issue 7|

---

A<br />

Count<br />

Yang ZL et al . Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells<br />

200<br />

160<br />

120<br />

80<br />

40<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

Figure 1 Fluorescence-activated cell sorting showing CD133 expression in different colo<strong>rectal</strong> <strong>cancer</strong> cell lines (A), CD133 staining <strong>of</strong> human primary<br />

colo<strong>rectal</strong> <strong>cancer</strong> tissue (B) and metastatic colo<strong>rectal</strong> <strong>cancer</strong> tissue (C) (Original magnification × 100). Brown indicates positive staining.<br />

Correlation between sample groups and molecular variables<br />

was assayed with paired t test. P < 0.05 was considered<br />

statistically significant.<br />

RESULTS<br />

200<br />

200<br />

200<br />

200<br />

Lovo Colo 205 SW 620 Caco-2 HCT116<br />

FL4-H<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

CD133 expression in colon <strong>cancer</strong> cell lines and human<br />

colon <strong>cancer</strong> tissues<br />

CD133 antigen was expressed in all colo<strong>rectal</strong> <strong>cancer</strong> cell<br />

lines with a difference <strong>of</strong> 30%-95% (Figure 1A). CD133<br />

in human colo<strong>rectal</strong> <strong>cancer</strong> tissue samples was stained<br />

with polyclonal antibody. CD133 expression was detected<br />

in 18 <strong>of</strong> the 20 primary <strong>cancer</strong> tissue samples, exclusively<br />

on the membrane <strong>of</strong> the vast majority <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong><br />

gland cells (Figure 1B), and in 9 <strong>of</strong> the 10 metastatic<br />

colo<strong>rectal</strong> <strong>cancer</strong> tissue samples with positive staining in<br />

cytoplasm <strong>of</strong> <strong>cancer</strong> cells (Figure 1C).<br />

CD133 expression in spheroids <strong>of</strong> sorted colo<strong>rectal</strong><br />

<strong>cancer</strong> cell subpopulations<br />

To minimize the contamination between the sorted<br />

CD133 + and CD133 - cells, a high CD133 expression cell<br />

subpopulation (CD133 hi ) and a CD133 - cell subpopulation<br />

sorted from the SW620 cells could be persistently<br />

passed. CD133 antigen was stably expressed in the monolayer<br />

culture (Figure 2A). To mimic the tumorigenesis <strong>of</strong><br />

colo<strong>rectal</strong> <strong>cancer</strong> cells in vivo, spheroids <strong>of</strong> the sorted cells<br />

were cultured with hanging drop. The parental, CD133 hi<br />

and CD133 - cells could grow into spheroids. CD133 expression<br />

was upregulated in spheroids <strong>of</strong> CD133 - cells.<br />

Although the CD133 expression rate was not changed,<br />

WJG|www.wjgnet.com<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

B C<br />

M1<br />

M2<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

M1<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

M2<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

the mean fluorescence intensity (MFI) was significantly<br />

increased in spheroids <strong>of</strong> CD133 hi cells, and the CD133<br />

expression rate and MFI were significantly increased in<br />

spheroids <strong>of</strong> parental cells detected by FACS assay (Figure<br />

2B). Immunohistochemical staining <strong>of</strong> CD133 antigen<br />

was observed in spheroids <strong>of</strong> CD133 - cells (Figure 2C).<br />

The CD133 gene expression level was significantly higher<br />

in spheroids <strong>of</strong> SW620, CD133 hi and CD133 - cells than in<br />

their monolayer culture at the mRNA level (4.224 ± 0.063<br />

vs 2.680 ± 0.117, 3.653 ± 0.061 vs 1.325 ± 0.044, 8.746 ±<br />

0.029 vs 3.761 ± 0.065, P < 0.05) (Figure 2D).<br />

Lgr5 expression in spheroids <strong>of</strong> sorted colo<strong>rectal</strong><br />

<strong>cancer</strong> cell subpopulations<br />

Lgr5 expression was analyzed by RT-qPCR in order to<br />

observe the role <strong>of</strong> the expression <strong>of</strong> other colon stem<br />

cell genes in tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells.<br />

The results showed that the Lgr5 expression level was<br />

significantly higher in spheroids <strong>of</strong> parental, CD133 hi<br />

and CD133 - cells than in their monolayer cells (5.942 ±<br />

0.091 vs 4.003 ± 0.039, 6.611 ± 0.214 vs 3.645 ± 0.046,<br />

5.910 ± 0.035 vs 3.903 ± 0.083, P < 0.05) (Figure 3).<br />

DISCUSSION<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

Whether CD133 antigen can be used as a marker <strong>of</strong><br />

colo<strong>rectal</strong> <strong>cancer</strong> stem cells is still controversial. The focus<br />

is that CD133 expression is not restricted to just a<br />

small number <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells. In this study, the<br />

CD133 expression was upregulated in colo<strong>rectal</strong> <strong>cancer</strong><br />

cell lines and primary or metastatic colo<strong>rectal</strong> <strong>cancer</strong> tissue<br />

934 February 21, 2011|Volume 17|Issue 7|<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H

---

A<br />

B<br />

C<br />

Count<br />

Count<br />

200<br />

160<br />

120<br />

80<br />

40<br />

200<br />

200<br />

SW 620 cells CD133 hi cells CD133 - cells<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

200<br />

160<br />

120<br />

80<br />

40<br />

D 2.40<br />

log10 (relative quantitation)<br />

M1<br />

FL4-H<br />

M2<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

2.00<br />

1.60<br />

1.20<br />

0.80<br />

0.40<br />

0.00<br />

FL4-H<br />

Count<br />

160<br />

120<br />

Figure 2 Fluorescence-activated cell sorting showing CD133 expression in SW620, CD133 - and CD133 hi cells (A) and in their spheroids (B), CD133 staining in<br />

spheroids <strong>of</strong> SW620, CD133 - and CD133 hi cells (original magnification × 100, brown indicates positive staining) (C), and reverse transcription-polymerase chain<br />

reaction showing CD133 expression in SW620, CD133 - and CD133 hi cells and their spheroids. a P < 0.05 vs monolayer cells. SP: Spheroid.<br />

samples, showing that CD133 antigen can be expressed in<br />

colo<strong>rectal</strong> <strong>cancer</strong> cell lines with a difference <strong>of</strong> 30%-95%.<br />

CD133 expression was detected in 18 <strong>of</strong> the 20 primary<br />

colo<strong>rectal</strong> <strong>cancer</strong> tissue samples, exclusively on the membrane<br />

<strong>of</strong> a large number <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> gland cells,<br />

and in 9 <strong>of</strong> the 10 metastatic colo<strong>rectal</strong> <strong>cancer</strong> tissue<br />

samples with a positive staining in cytoplasm <strong>of</strong> colorec-<br />

80<br />

40<br />

WJG|www.wjgnet.com<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

M1<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

200<br />

200<br />

SW620-spheroids CD133 hi -spheroids CD133 - -spheroids<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

Count<br />

160<br />

120<br />

80<br />

40<br />

M2<br />

0<br />

10 0 10 1 10 2 10 3 10 4<br />

FL4-H<br />

Control SW620-spheroids CD133 hi -spheroids CD133 - -spheroids<br />

1.290<br />

1.447<br />

Yang ZL et al . Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells<br />

a<br />

2.115<br />

Gene expression<br />

0.000<br />

SW620 CD133 hi CD133 hi _SP CD133- CD133 - _SP SW620_SP H2O<br />

CD133<br />

a<br />

1.404<br />

a<br />

1.711<br />

a<br />

tal <strong>cancer</strong> cells, which is consistent with the reported<br />

findings [21-23] . The different CD133 expression levels in<br />

colo<strong>rectal</strong> caner cell lines may be related to the different<br />

glycosylation to the mask specific epitopes <strong>of</strong> CD133 antigen<br />

in colo<strong>rectal</strong> <strong>cancer</strong> cell differentiation [24] . Therefore,<br />

our data indicate that CD133 is commonly expressed in<br />

colo<strong>rectal</strong> <strong>cancer</strong> cells.<br />

935 February 21, 2011|Volume 17|Issue 7|

---

Yang ZL et al . Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells<br />

log10 (relative quantitation)<br />

1.00<br />

0.80<br />

0.60<br />

0.40<br />

0.20<br />

0.00<br />

-0.20<br />

0.210<br />

0.000<br />

Figure 3 Quantitative reverse transcription-polymerase chain reaction showing Lgr5 expression in SW620, CD133 - and CD133 hi cells and their spheroids.<br />

a P < 0.05 vs monolayer cells. SP: Spheroid.<br />

To investigate whether the upregulated CD133 expression<br />

plays a role in tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells,<br />

SW620 cell line containing two cell subpopulations (CD-<br />

133 hi , CD133 - ) was selected and sorted using CD133 antigen,<br />

the spheroids <strong>of</strong> parental, CD133 hi and CD133 - cells<br />

were cultured with the hanging drop in vitro, which is based<br />

on the natural disposition <strong>of</strong> cells to aggregate without the<br />

need for polymer scaffolds such as matrigel, polyglycolic<br />

acid or microporous supports to achieve homogeneous<br />

multicellular tumor spheroids [25] . The spheroids represent<br />

a popular in vitro 3D tissue structure that mimics in vivo tumor<br />

tissue organization and microenvironment [26,27] . In the<br />

present study, CD133 hi and CD133 - cells could be cultured<br />

into their spheroids, CD133 expression was upregulated in<br />

spheroids <strong>of</strong> CD133 - cells. Although the CD133 expression<br />

was not changed, the mean fluorescence intensity<br />

(MFI) was significantly increased in spheroids <strong>of</strong> CD133 hi<br />

cells as detected by FACS assay. Immunohistochemical<br />

staining <strong>of</strong> CD133 antigen was observed in spheroids <strong>of</strong><br />

CD133 - cells, indicating that CD133 antigen expression<br />

is upregulated in spheroids <strong>of</strong> CD133 - and CD133 hi cells.<br />

Further analysis revealed that the CD133 gene expression<br />

level was significantly higher in spheroids <strong>of</strong> SW620,<br />

CD133 hi and CD133 - cells than in their monolayer culture<br />

at the mRNA level, suggesting that the upregulated expression<br />

<strong>of</strong> CD133 including protein and gene plays a role in<br />

tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells.<br />

Since the upregulated CD133 expression plays a role in<br />

tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells, whether CD133<br />

protein supports the growth <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> is a subject<br />

that should be actively studied. As CD133 by itself<br />

may lack <strong>of</strong> a functional role in initiation <strong>of</strong> tumors and<br />

metastasis <strong>of</strong> human colo<strong>rectal</strong> <strong>cancer</strong> [28,29] , it has an impact<br />

on the survival <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> patients [22,29] . It has<br />

been recently demonstrated that prominin 1 (also called<br />

CD133)-marked mouse intestinal stem cells are susceptible<br />

to neoplastic transformation [30] , possibly due to the fact that<br />

upregulated CD133 expression may promote the expression<br />

<strong>of</strong> other critical genes that can drive tumorigenesis <strong>of</strong><br />

colo<strong>rectal</strong> <strong>cancer</strong> cells. In this study, the expression level<br />

<strong>of</strong> Lgr5 (leucine-rich-repeat-containing G-protein-coupled<br />

receptor 5), also known as Gpr49, a colon stem cell marker<br />

WJG|www.wjgnet.com<br />

a<br />

0.842<br />

Gene expression<br />

0.213<br />

SW620 CD133 hi CD133 hi _SP CD133- CD133 - _SP SW620_SP H2O<br />

Lgr5<br />

a<br />

0.779<br />

a<br />

0.736<br />

0.000<br />

gene [31] , was significantly higher in spheroids <strong>of</strong> parental,<br />

CD133 hi and CD133 - cells than in their monolayer cells.<br />

In conclusion, the upregulated CD133 expression plays<br />

a role in tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells, which<br />

may be related to the expression <strong>of</strong> other critical genes that<br />

can drive tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells. Further<br />

study is needed to confirm the present results in vivo.<br />

ACKNOWLEDGMENTS<br />

The authors thank Francesca Walker and Hui-Hua Zhang<br />

(Ludwig Institute, Melbourne) for their assistance to cell<br />

experiments and FACS studies, and You-Fang Zhang<br />

(Ludwig Institute, Melbourne) for his support in immunohistochemical<br />

studies.<br />

COMMENTS<br />

Background<br />

It has been recently shown that CD133 expression is broadly distributed in<br />

primary colo<strong>rectal</strong> <strong>cancer</strong> cells, and not restricted to <strong>cancer</strong> stem cells. Whether<br />

the upregulated CD133 expression plays a role in tumorigenesis <strong>of</strong> colo<strong>rectal</strong><br />

<strong>cancer</strong> cells is unknown.<br />

Research frontiers<br />

It has been increasingly reported that CD133 is a marker <strong>of</strong> putative <strong>cancer</strong> stem<br />

cells (CSC) in some <strong>cancer</strong>s. However, it has been recently shown that CD133<br />

expression is broadly distributed in primary colon <strong>cancer</strong> cells and not restricted to<br />

<strong>cancer</strong> stem cells, and both CD133 + and CD133 - metastatic colo<strong>rectal</strong> <strong>cancer</strong> cells<br />

initiate tumors. Whether the upregulated CD133 expression plays a role in tumorigenesis<br />

<strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells is unknown. In this study, the upregulated CD133<br />

expression was found to play a role in tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells.<br />

Innovations and breakthroughs<br />

Recent reports have shown that whether CD133 antigen can be used as a<br />

marker <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> stem cells is controversial. This is the first study to<br />

report the role <strong>of</strong> upregulated CD133 expression in tumorigenesis <strong>of</strong> colo<strong>rectal</strong><br />

<strong>cancer</strong> cells. Furthermore, our in vitro studies suggested that the upregulated<br />

CD133 expression may promote the expression <strong>of</strong> other critical genes that can<br />

drive tumorigenesis <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells.<br />

Applications<br />

Whether the upregulated CD133 expression plays a role in tumorigenesis <strong>of</strong><br />

colo<strong>rectal</strong> <strong>cancer</strong> cells was studied, the results may help to solve the controversy<br />

on CD133 antigen as a marker <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> stem cells.<br />

Terminology<br />

CD133, also known as prominin-1, a transmembrane pentaspan protein, is<br />

originally described as a surface antigen specific for human hematopoietic stem<br />

936 February 21, 2011|Volume 17|Issue 7|

---

and progenitor cells. Lgr5 (leucine-rich-repeat-containing G-protein-coupled<br />

receptor 5), also known as Gpr49, is a colon stem cell marker gene.<br />

Peer review<br />

The authors detected the expression <strong>of</strong> CD133 in a panel <strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong><br />

cell lines and human colo<strong>rectal</strong> <strong>cancer</strong> tissue samples. The expression <strong>of</strong><br />

CD133 and Lgr5 in spheroids <strong>of</strong> the sorted colo<strong>rectal</strong> <strong>cancer</strong> cell subpopulations<br />

suggests that the upregulated expression plays a role in tumorigenesis<br />

<strong>of</strong> colo<strong>rectal</strong> <strong>cancer</strong> cells, which may promote the expression <strong>of</strong> other critical<br />

genes that can drive tumorigenesis. The results are interesting.<br />

REFERENCES<br />

1 Yin AH, Miraglia S, Zanjani ED, Almeida-Porada G, Ogawa<br />

M, Leary AG, Olweus J, Kearney J, Buck DW. AC133, a novel<br />

marker for human hematopoietic stem and progenitor cells.<br />

Blood 1997; 90: 5002-5012<br />

2 Miraglia S, Godfrey W, Yin AH, Atkins K, Warnke R, Holden<br />

JT, Bray RA, Waller EK, Buck DW. A novel five-transmembrane<br />

hematopoietic stem cell antigen: isolation, characterization,<br />

and molecular cloning. Blood 1997; 90: 5013-5021<br />

3 Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV,<br />

Tsukamoto AS, Gage FH, Weissman IL. Direct isolation <strong>of</strong><br />

human central nervous system stem cells. Proc Natl Acad Sci<br />

USA 2000; 97: 14720-14725<br />

4 Sagrinati C, Netti GS, Mazzinghi B, Lazzeri E, Liotta F, Frosali<br />

F, Ronconi E, Meini C, Gacci M, Squecco R, Carini M, Gesualdo<br />

L, Francini F, Maggi E, Annunziato F, Lasagni L, Serio<br />

M, Romagnani S, Romagnani P. Isolation and characterization<br />

<strong>of</strong> multipotent progenitor cells from the Bowman’s capsule <strong>of</strong><br />

adult human kidneys. J Am Soc Nephrol 2006; 17: 2443-2456<br />

5 Richardson GD, Robson CN, Lang SH, Neal DE, Maitland<br />

NJ, Collins AT. CD133, a novel marker for human prostatic<br />

epithelial stem cells. J Cell Sci 2004; 117: 3539-3545<br />

6 Kordes C, Sawitza I, Müller-Marbach A, Ale-Agha N, Keitel V,<br />

Klonowski-Stumpe H, Häussinger D. CD133+ hepatic stellate<br />

cells are progenitor cells. Biochem Biophys Res Commun 2007;<br />

352: 410-417<br />

7 Sugiyama T, Rodriguez RT, McLean GW, Kim SK. Conserved<br />

markers <strong>of</strong> fetal pancreatic epithelium permit prospective<br />

isolation <strong>of</strong> islet progenitor cells by FACS. Proc Natl Acad<br />

Sci USA 2007; 104: 175-180<br />

8 Ito Y, Hamazaki TS, Ohnuma K, Tamaki K, Asashima M,<br />

Okochi H. Isolation <strong>of</strong> murine hair-inducing cells using the<br />

cell surface marker prominin-1/CD133. J Invest Dermatol<br />

2007; 127: 1052-1060<br />

9 Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C,<br />

Squire J, Dirks PB. Identification <strong>of</strong> a <strong>cancer</strong> stem cell in human<br />

brain tumors. Cancer Res 2003; 63: 5821-5828<br />

10 Taylor MD, Poppleton H, Fuller C, Su X, Liu Y, Jensen P,<br />

Magdaleno S, Dalton J, Calabrese C, Board J, Macdonald T,<br />

Rutka J, Guha A, Gajjar A, Curran T, Gilbertson RJ. Radial<br />

glia cells are candidate stem cells <strong>of</strong> ependymoma. Cancer Cell<br />

2005; 8: 323-335<br />

11 Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospective<br />

identification <strong>of</strong> tumorigenic prostate <strong>cancer</strong> stem<br />

cells. Cancer Res 2005; 65: 10946-10951<br />

12 O’Brien CA, Pollett A, Gallinger S, Dick JE. A human colon<br />

<strong>cancer</strong> cell capable <strong>of</strong> initiating tumour growth in immunodeficient<br />

mice. Nature 2007; 445: 106-110<br />

13 Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M,<br />

Peschle C, De Maria R. Identification and expansion <strong>of</strong> human<br />

colon-<strong>cancer</strong>-initiating cells. Nature 2007; 445: 111-115<br />

14 Todaro M, Alea MP, Di Stefano AB, Cammareri P, Vermeulen<br />

L, Iovino F, Tripodo C, Russo A, Gulotta G, Medema JP,<br />

Stassi G. Colon <strong>cancer</strong> stem cells dictate tumor growth and<br />

resist cell death by production <strong>of</strong> interleukin-4. Cell Stem Cell<br />

2007; 1: 389-402<br />

15 Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, Di Virgilio<br />

A, Conticello C, Ruco L, Peschle C, De Maria R. Identifica-<br />

WJG|www.wjgnet.com<br />

Yang ZL et al . Upregulated CD133 expression in tumorigenesis <strong>of</strong> colon <strong>cancer</strong> cells<br />

tion and expansion <strong>of</strong> the tumorigenic lung <strong>cancer</strong> stem cell<br />

population. Cell Death Differ 2008; 15: 504-514<br />

16 Ma S, Chan KW, Hu L, Lee TK, Wo JY, Ng IO, Zheng BJ,<br />

Guan XY. Identification and characterization <strong>of</strong> tumorigenic<br />

liver <strong>cancer</strong> stem/progenitor cells. Gastroenterology 2007; 132:<br />

2542-2556<br />

17 Monzani E, Facchetti F, Galmozzi E, Corsini E, Benetti A,<br />

Cavazzin C, Gritti A, Piccinini A, Porro D, Santinami M,<br />

Invernici G, Parati E, Alessandri G, La Porta CA. Melanoma<br />

contains CD133 and ABCG2 positive cells with enhanced tumourigenic<br />

potential. Eur J Cancer 2007; 43: 935-946<br />

18 Curley MD, Therrien VA, Cummings CL, Sergent PA, Koulouris<br />

CR, Friel AM, Roberts DJ, Seiden MV, Scadden DT,<br />

Rueda BR, Foster R. CD133 expression defines a tumor initiating<br />

cell population in primary human ovarian <strong>cancer</strong>. Stem<br />

Cells 2009; 27: 2875-2883<br />

19 Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW,<br />

Guba M, Bruns CJ, Heeschen C. Distinct populations <strong>of</strong> <strong>cancer</strong><br />

stem cells determine tumor growth and metastatic activity<br />

in human pancreatic <strong>cancer</strong>. Cell Stem Cell 2007; 1: 313-323<br />

20 Mizrak D, Brittan M, Alison MR. CD133: molecule <strong>of</strong> the moment.<br />

J Pathol 2008; 214: 3-9<br />

21 Shmelkov SV, Butler JM, Hooper AT, Hormigo A, Kushner<br />

J, Milde T, St Clair R, Baljevic M, White I, Jin DK, Chadburn<br />

A, Murphy AJ, Valenzuela DM, Gale NW, Thurston G, Yancopoulos<br />

GD, D’Angelica M, Kemeny N, Lyden D, Rafii S.<br />

CD133 expression is not restricted to stem cells, and both<br />

CD133+ and CD133- metastatic colon <strong>cancer</strong> cells initiate tumors.<br />

J Clin Invest 2008; 118: 2111-2120<br />

22 Horst D, Kriegl L, Engel J, Kirchner T, Jung A. CD133 expression<br />

is an independent prognostic marker for low survival in<br />

colo<strong>rectal</strong> <strong>cancer</strong>. Br J Cancer 2008; 99: 1285-1289<br />

23 Kojima M, Ishii G, Atsumi N, Fujii S, Saito N, Ochiai A. Immunohistochemical<br />

detection <strong>of</strong> CD133 expression in colo<strong>rectal</strong><br />

<strong>cancer</strong>: a clinicopathological study. Cancer Sci 2008; 99:<br />

1578-1583<br />

24 Kemper K, Sprick MR, de Bree M, Scopelliti A, Vermeulen L,<br />

Hoek M, Zeilstra J, Pals ST, Mehmet H, Stassi G, Medema JP.<br />

The AC133 epitope, but not the CD133 protein, is lost upon<br />

<strong>cancer</strong> stem cell differentiation. Cancer Res 2010; 70: 719-729<br />

25 Kelm JM, Timmins NE, Brown CJ, Fussenegger M, Nielsen<br />

LK. Method for generation <strong>of</strong> homogeneous multicellular<br />

tumor spheroids applicable to a wide variety <strong>of</strong> cell types.<br />

Biotechnol Bioeng 2003; 83: 173-180<br />

26 Weiswald LB, Richon S, Validire P, Briffod M, Lai-Kuen R,<br />

Cordelières FP, Bertrand F, Dargere D, Massonnet G, Marangoni<br />

E, Gayet B, Pocard M, Bieche I, Poupon MF, Bellet D,<br />

Dangles-Marie V. Newly characterised ex vivo colospheres<br />

as a three-dimensional colon <strong>cancer</strong> cell model <strong>of</strong> tumour aggressiveness.<br />

Br J Cancer 2009; 101: 473-482<br />

27 Friedrich J, Seidel C, Ebner R, Kunz-Schughart LA. Spheroidbased<br />

drug screen: considerations and practical approach.<br />

Nat Protoc 2009; 4: 309-324<br />

28 Du L, Wang H, He L, Zhang J, Ni B, Wang X, Jin H, Cahuzac<br />

N, Mehrpour M, Lu Y, Chen Q. CD44 is <strong>of</strong> functional importance<br />

for colo<strong>rectal</strong> <strong>cancer</strong> stem cells. Clin Cancer Res 2008; 14:<br />

6751-6760<br />

29 Horst D, Scheel SK, Liebmann S, Neumann J, Maatz S, Kirchner<br />

T, Jung A. The <strong>cancer</strong> stem cell marker CD133 has high<br />

prognostic impact but unknown functional relevance for the<br />

metastasis <strong>of</strong> human colon <strong>cancer</strong>. J Pathol 2009; 219: 427-434<br />

30 Zhu L, Gibson P, Currle DS, Tong Y, Richardson RJ, Bayazitov<br />

IT, Poppleton H, Zakharenko S, Ellison DW, Gilbertson<br />

RJ. Prominin 1 marks intestinal stem cells that are susceptible<br />

to neoplastic transformation. Nature 2009; 457: 603-607<br />

31 Barker N, van Es JH, Kuipers J, Kujala P, van den Born M,<br />

Cozijnsen M, Haegebarth A, Korving J, Begthel H, Peters PJ,<br />

Clevers H. Identification <strong>of</strong> stem cells in small intestine and<br />

colon by marker gene Lgr5. Nature 2007; 449: 1003-1007<br />

S- Editor Sun H L- Editor Wang XL E- Editor Ma WH<br />

937 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.938<br />

BRIEF ARTICLE<br />

Transplantation <strong>of</strong> microencapsulated umbilical-cord-bloodderived<br />

hepatic-like cells for treatment <strong>of</strong> hepatic failure<br />

Fang-Ting Zhang, Hui-Juan Wan, Ming-Hua Li, Jing Ye, Mei-Jun Yin, Chun-Qiao Huang, Jie Yu<br />

Fang-Ting Zhang, Hui-Juan Wan, Ming-Hua Li, Jing Ye,<br />

Mei-Jun Yin, Chun-Qiao Huang, Jie Yu, Central Laboratory,<br />

Peking University Shenzhen Hospital, Shenzhen 518036, China<br />

Author contributions: Zhang FT and Yu J designed the research;<br />

Zhang FT, Wan HJ, Li MH, Yin MJ, Ye J and Huang<br />

CQ performed the research; Zhang FT analyzed data; Zhang FT<br />

wrote the paper; Yu J edited the paper.<br />

Supported by Guangdong Natural Science Foundation (9151<br />

030002000008) and Shenzhen Science and Technology Planning<br />

Priority Program (JH200205270412B, 200808001, 2008<br />

01012)<br />

Correspondence to: Jie Yu, PhD, Central Laboratory, Peking<br />

University Shenzhen Hospital, 1120 Lian Hua Road, Shenzhen<br />

518036, China. yujie007@hotmail.com<br />

Telephone: +86-755-83923333 Fax: +86-755-83923333<br />

Received: July 19, 2010 Revised: October 20, 2010<br />

Accepted: October 27, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To investigate intraperitoneal transplantation <strong>of</strong><br />

microencapsulated hepatic-like cells from human umbilical<br />

cord blood for treatment <strong>of</strong> hepatic failure in rats.<br />

METHODS: CD34 + cells in umbilical cord blood cells<br />

were isolated by magnetic cell sorting. In the in vitro<br />

experiment, sorted CD34 + cells were amplified and<br />

induced into hepatic-like cells by culturing with a combination<br />

<strong>of</strong> fibroblast growth factor 4 and hepatocyte<br />

growth factor. Cultures without growth factor addition<br />

served as controls. mRNA and protein levels for hepatic-like<br />

cells were analyzed by reverse transcriptionpolymerase<br />

chain reaction, immunohistochemistry and<br />

immun<strong>of</strong>luorescence. In the in vivo experiment, the<br />

hepatic-like cells were encapsulated and transplanted<br />

into the abdominal cavity <strong>of</strong> acute hepatic failure (AHF)<br />

rats at 48 h after D-galactosamine induction <strong>of</strong> acute<br />

hepatic failure. Transplantation with PBS and unencapsulated<br />

hepatic-like cells served as controls. The<br />

mortality rate, hepatic pathological changes and serum<br />

WJG|www.wjgnet.com<br />

938<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 938-945<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

biochemical indexes were determined. The morphology<br />

and structure <strong>of</strong> microcapsules in the greater omentum<br />

were observed.<br />

RESULTS: Human albumin, alpha-fetoprotein and<br />

GATA-4 mRNA and albumin protein positive cells were<br />

found among cultured cells after 16 d. Albumin level in<br />

culture medium was significantly increased after culturing<br />

with growth factors in comparison with culturing<br />

without growth factor addition (P < 0.01). Compared<br />

with the unencapsulated group, the mortality rate <strong>of</strong> the<br />

encapsulated hepatic-like cell-transplanted group was<br />

significantly lower (P < 0.05). Serum biochemical parameters,<br />

alanine aminotransferase, aspartate aminotransferase<br />

and total bilirubin in the encapsulated group were<br />

significantly improvement compared with the PBS control<br />

group (P < 0.01). Pathological staining further supported<br />

these findings. At 1-2 wk post-transplantation, free microcapsules<br />

with a round clear structure and a smooth<br />

surface were observed in peritoneal lavage fluid, surviving<br />

cells inside microcapsules were found by trypan blue<br />

staining, but some fibrous tissue around microcapsules<br />

was also detected in the greater omentum <strong>of</strong> encapsulated<br />

group by hematoxylin and eosin staining.<br />

CONCLUSION: Transplantation <strong>of</strong> microencapsulated<br />

hepatic-like cells derived from umbilical cord blood cells<br />

could preliminarily alleviate the symptoms <strong>of</strong> AHF rats.<br />

© 2011 Baishideng. All rights reserved.<br />

Key words: Microencapsulation; Hepatic-like cells; Umbilical<br />

cord blood cells; CD34 antigen; Alginate; Acute<br />

hepatic failure<br />

Peer reviewer: Toshihiro Mitaka, MD, Pr<strong>of</strong>essor, Department<br />

<strong>of</strong> Pathophysiology, Cancer Research Institute, Sapporo Medical<br />

University, 060-85567 Sapporo, Japan<br />

Zhang FT, Wan HJ, Li MH, Ye J, Yin MJ, Huang CQ, Yu J.<br />

Transplantation <strong>of</strong> microencapsulated umbilical-cord-bloodderived<br />

hepatic-like cells for treatment <strong>of</strong> hepatic failure. <strong>World</strong><br />

February 21, 2011|Volume 17|Issue 7|

---

J Gastroenterol 2011; 17(7): 938-945 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/full/v17/i7/938.htm DOI:<br />

http://dx.doi.org/10.3748/wjg.v17.i7.938<br />

INTRODUCTION<br />

Substantial efforts have been made with regard to cell<br />

transplantation as an effective supporting system for hepatic<br />

failure and assisted therapies. However, immunological<br />

rejection has always been an important problem for<br />

cell transplantation. Alginate-poly-l-lysine-alginate (APA)<br />

microcapsules have proven to be effective in protecting<br />

enclosed target cells from immune rejection following<br />

transplantation into experimental animals, thereby eliminating<br />

the problems <strong>of</strong> immunosuppressive therapy [1-3] .<br />

Extensive studies have also been conducted on the<br />

core <strong>of</strong> this therapy, namely the cell sources. The investigated<br />

cells have included liver stem cells, embryonic stem<br />

cells, human umbilical cord blood (UCB) cells and bone<br />

marrow stem cells. Human UCB cells have some advantages<br />

that other cells do not have. The frequencies <strong>of</strong><br />

UCB hematopoietic stem/progenitor cells exceed those<br />

from bone marrow and peripheral blood. In our previous<br />

study, we confirmed the differentiation <strong>of</strong> mononuclear<br />

cells (MNCs) from human UCB into hepatocytes in three<br />

different ways, namely co-culture with injured liver cells,<br />

growth factor-assisted culture, and MNC transplantation<br />

in animal models <strong>of</strong> liver injury [4] . In the present study, we<br />

found that CD34 + cells derived from human UCB could<br />

be converted into hepatic-like cells that generate hepatocyte<br />

lineage cells. Furthermore, we encapsulated the hepatic-like<br />

cells using an alginate method and transplanted<br />

them into acute hepatic failure (AHF) rats to evaluate the<br />

effects <strong>of</strong> encapsulated hepatic-like cell transplantation.<br />

MATERIALS AND METHODS<br />

Isolation and identification <strong>of</strong> CD34 + cells<br />

UCB (more than 80 samples) from full-term deliveries<br />

were obtained from the Obstetrics Department <strong>of</strong> Peking<br />

University Shenzhen Hospital. UCB cells were harvested<br />

after written inform consent was obtained. The study<br />

protocol was approved by the Ethics Committee <strong>of</strong> Peking<br />

University Shenzhen Hospital. MNCs were isolated<br />

from the UCB samples by density-gradient centrifugation<br />

at 2000 r/min for 35 min using Ficoll-Hypaque (Huajing,<br />

Shanghai, China). CD34 + subpopulations were isolated<br />

using a Miltenyi Direct CD34 Progenitor Cell Isolation<br />

Kit (Miltenyi Biotec, Bergisch Gladbach, Germany). The<br />

specific steps were as follows: (1) isolated MNCs were resuspended<br />

in a final volume <strong>of</strong> 300 μL <strong>of</strong> PBS that contained<br />

5 g/L bovine serum albumin (BSA); (2) 100 μL <strong>of</strong><br />

FcR Blocking Reagent and 100 μL <strong>of</strong> CD34 Micro Beads<br />

per 1 × 10 8 total cells were sequentially added, mixed well<br />

and incubated for 30 min in a refrigerator at 4℃; (3) cells<br />

were passed through a magnetic column twice and purified;<br />

and (4) CD34 + cells were collected, resuspended in<br />

WJG|www.wjgnet.com<br />

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

Table 1 Primers used for reverse transcription-polymerase<br />

chain reaction<br />

Gene Primer (5’-3’) Amplicon<br />

(bp)<br />

Forward primer Reverse primer<br />

ALB CTTTCAAAGCAT-<br />

GGGCAGTAG<br />

GATA-4 ACCTGGGACTTG-<br />

GAGGATAG<br />

AFP TGAGCACTGTTG-<br />

CAGAGGAG<br />

ALB: Albumin; AFP: α-fetoprotein.<br />

GCAGCAGCACGA-<br />

CAGAGTAA<br />

GACAAGGACATCTT-<br />

GGGAAA<br />

CTGAGACAG-<br />

CAAGCTGAGGA<br />

100 μL PBS, incubated with 10 μL CD34-phycoerythrin<br />

for 10 min at 4℃ and identified by flow cytometry.<br />

Differentiation in vitro<br />

Freshly isolated CD34 + cells were primarily cultured<br />

in Dulbecco’s modified Eagle’s medium - low glucose<br />

(DMEM-LG, Gibco, Carlsbad, CA, USA), amplified for<br />

3-5 d with a combination <strong>of</strong> 12.5 μg/mL thrombopoietin<br />

(TPO) (R&D Systems, Minneapolis, MN, USA),<br />

50 ng/mL stem cell factor (SCF) (R&D Systems) and<br />

50 ng/mL Flt-3 (R&D Systems); then induced into hepatic-like<br />

cells by culturing in DMEM-LG that contained<br />

50 mL/L fetal bovine serum (Gibco), 100 U/mL penicillin,<br />

100 μg/mL streptomycin, 4.7 μg/mL linoleic acid, 1 ×<br />

insulin-transferrin-selenium and 1 × 10 -4 mol/L L-ascorbic<br />

acid 2-P supplemented with 100 ng/mL fibroblast growth<br />

factor (FGF)4 (R&D Systems) and 20 ng/mL hepatocyte<br />

growth factor (HGF; Sigma, St. Louis, MO, USA). CD34 +<br />

cells were incubated in 24-well plates at 37℃ in a 5% CO2<br />

atmosphere. Culture medium was replaced every 3 d. Cultured<br />

cells were collected after 8 and 16 d. Cultures without<br />

growth factors served as controls.<br />

Total mRNA isolation and reverse transcriptionpolymerase<br />

chain reaction<br />

Total mRNA was extracted from collected cells using<br />

Trizol (Mrcgene, Cincinnati, OH, USA). mRNA was<br />

reverse-transcribed and the resulting cDNA was amplified<br />

using the primer sets shown in Table 1 and a RobusT I<br />

reverse transcription-polymerase chain reaction (RT-PCR)<br />

Kit (Finnzymes, Espoo, Finland). Reverse transcriptase<br />

reaction was run at 48℃ for 45 min and PCR was initiated<br />

with pre-denaturation at 94℃ for 2 min, followed by<br />

35 cycles <strong>of</strong> 30 s at 94℃, annealing at 58℃ for 30 s and<br />

extension at 72℃ for 30 s, with 72℃ for 7 min for final<br />

extension. The PCR products were separated on a 1.2%<br />

agarose gel.<br />

Immunocytochemistry for CD34 + cells<br />

Cytospins prepared from cells were fixed with 4% paraformaldehyde<br />

and 0.15% picric acid in PBS at room temperature<br />

for 20 min, then permeabilized and blocked with<br />

10% goat serum and 0.1% Triton X-100 in PBS at room<br />

temperature for 10 min. The cells were sequentially incu-<br />

939 February 21, 2011|Volume 17|Issue 7|<br />

411<br />

250<br />

308

---

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

bated with a mouse anti-human albumin antibody (R&D<br />

Systems) for 30 min, a biotinylated peroxidase-conjugated<br />

secondary antibody (Zymed, South San Francisco, CA,<br />

USA) for 10 min, and diaminobenzidine for 10 min. Between<br />

the above steps, cells were washed with 0.1 mol/L<br />

PBS that contained 1 g/L BSA.<br />

Albumin determination<br />

Culture media were collected for the quantitative determination<br />

<strong>of</strong> human albumin by ELISA using a Human<br />

Albumin ELISA Kit (Alpha Diagnostics International,<br />

San Antonio, TX, USA) according to the manufacturer’s<br />

instructions.<br />

Cell encapsulation<br />

Cells collected after 16 d induction were washed with PBS<br />

and resuspended in the alginate. The alginate-cell mixture<br />

was passed though a microcapsule generator and extruded<br />

into 40 mL 1.1% CaCl2 solution. The airflow rate was<br />

adjusted for the regulation <strong>of</strong> the microcapsule diameter<br />

between 300 and 800 μm. The capsules and CaCl2 solution<br />

were then transferred to 50-mL conical tubes. After<br />

removal <strong>of</strong> the supernatant, the capsules were gently<br />

mixed with the wash solution and allowed to settle for<br />

2 min. Before transplantation, a few drops <strong>of</strong> encapsulated<br />

cells were placed on a slide, stained with 0.4% Trypan<br />

blue, covered with a cover glass and lightly pressed to<br />

force cells out <strong>of</strong> the microcapsules. Numbers <strong>of</strong> living<br />

cells were counted and expressed as percentages.<br />

Induction <strong>of</strong> AHF and cell transplantation<br />

Sprague-Dawley rats were purchased from the Experimental<br />

Animal Center <strong>of</strong> Southern Medical University<br />

(Guangzhou, China). The Scientific Committee at Peking<br />

University Shenzhen Hospital approved the use <strong>of</strong><br />

animals for experimental purposes. Forty-eight hours<br />

before transplantation, the Sprague-Dawley rats (weight:<br />

180-250 g) were intraperitoneally injected at 1.4 g/kg<br />

with a 10% D-galactosamine solution in normal saline.<br />

On the day <strong>of</strong> the experiment, microencapsulated cells at<br />

a density <strong>of</strong> 2 × 10 6 cells/mL were prepared and transplanted<br />

into the abdominal cavity <strong>of</strong> rats. Transplantation<br />

with PBS only or unencapsulated hepatocyte-like<br />

cells were performed for the establishment <strong>of</strong> control<br />

groups. As UCB samples are not delivered on the same<br />

day, animal experiments were carried out by batch and<br />

the transplantation <strong>of</strong> cells performed also on different<br />

days. The mortality rate, hepatic pathological changes<br />

and serum biochemical indexes were determined.<br />

AHF rats grouping<br />

We obtained total 135 AHF rats 48 h after injection <strong>of</strong><br />

D-galactosamine. They were divided into three groups<br />

on the day <strong>of</strong> the transplantation. Namely, encapsulated<br />

group (transplantation with encapsulated hepatic-like<br />

cells, n = 55), unencapsulated group (transplantation with<br />

unencapsulated hepatic-like cells, n = 40), PBS group<br />

(transplantation with PBS, n = 40). Among these, 76 AHF<br />

rats were determined for hepatic pathological changes and<br />

WJG|www.wjgnet.com<br />

serum biochemical indexes (encapsulated group, n = 36;<br />

unencapsulated group, n = 20; PBS group, n = 20). The<br />

remaining 59 rats were determined for mortality rate (encapsulated<br />

group, n = 19; unencapsulated group, n = 20;<br />

PBS group, n = 20).<br />

Histology<br />

The liver and greater omentum from all three groups<br />

were fixed in 4% buffered formaldehyde overnight. After<br />

paraffin embedding, 4-5-μm thick serial sections were<br />

stained with hematoxylin and eosin (HE) and observed<br />

under the light microscope.<br />

Statistical analysis<br />

Data were expressed as the mean ± SD. Mortality rate<br />

analysis was determined by Fisher’s exact test. Serum<br />

biochemical index statistical analysis was performed by<br />

ANOVA using SPSS version 13.0 (SPSS Inc., Chicago,<br />

IL, USA). Differences with P values < 0.05 were considered<br />

statistically significant.<br />

RESULTS<br />

Differentiation <strong>of</strong> CD34 + cells into hepatic-like cells<br />

Approximately 3 × 10 5 -9 × 10 5 /mL sorted cells were obtained<br />

using the CD34 immunomagnetic bead method, and<br />

91% <strong>of</strong> them expressed CD34 by flow cytometry analysis<br />

(Figure 1). CD34 + cells were firstly amplified 20-fold by a<br />

combination <strong>of</strong> TPO, SCF and Flt-3, and then they were<br />

cultured with HGF and FGF4. At 16 d, they developed<br />

larger volumes, richer cytoplasts, and binucleated structures,<br />

as observed under a H<strong>of</strong>fman microscope (Figure 2).<br />

The RT-PCR showed no human albumin, α-fetoprotein<br />

(AFP) and GATA-4 mRNA expression in CD34 + cells<br />

before the induction procedure. The expression <strong>of</strong> albumin<br />

and GATA-4 mRNA increased with the culture time<br />

after the addition <strong>of</strong> growth factors, whereas the amount<br />

<strong>of</strong> AFP mRNA expression peaked after 8 d and reduced<br />

at 16 d (Figure 3). Cells that expressed albumin and AFP<br />

were verified by immunocytochemical staining and ELISA<br />

(Figures 2 and 4). The percentage <strong>of</strong> albumin- and AFPpositive<br />

cells at 16 d was 30% and 24%, respectively. The<br />

albumin product in culture medium was significantly<br />

increased after culturing with HGF and FGF4 in comparison<br />

with control groups (P < 0.01).<br />

Cell encapsulation and transplantation<br />

The APA microencapsulation technique was used to encapsulate<br />

hepatic-like cells. The percentage <strong>of</strong> living cells<br />

was > 80%, as determined by trypan blue staining. The<br />

AHF animal model was successfully established using<br />

Sprague-Dawley rats by the injection <strong>of</strong> D-galactosamine.<br />

Pathological section <strong>of</strong> the AHF liver revealed that the<br />

structure <strong>of</strong> the hepatic lobules was destroyed and the<br />

hepatic cord was disordered, with large areas <strong>of</strong> denatured<br />

and necrotic hepatocytes, and infiltrating lymphocytes<br />

were found on the portal area at 48 h after injection. On<br />

the day <strong>of</strong> the experiment, microencapsulated cells at a<br />

density <strong>of</strong> 2 × 10 6 cells/mL were prepared and transplant-<br />

940 February 21, 2011|Volume 17|Issue 7|

---

A<br />

SS<br />

0 1023<br />

ed into the abdominal cavity <strong>of</strong> AHF rats. The mortality<br />

rate and hepatic pathological changes were determined.<br />

At 48 h after transplantation, HE staining <strong>of</strong> the encapsulated<br />

group revealed that the hepatic lobules were still<br />

intact; denaturation was the major change in hepatocytes<br />

and the area <strong>of</strong> necrosis nidus was small, and congestion<br />

and hemorrhage were almost undetectable (Figure 5). The<br />

mortality rate at 48 h after transplantation in three groups<br />

was 42.1% (encapsulated group), 65% (unencapsulated<br />

group) and 75% (PBS group), respectively. Compared<br />

with the unencapsulated group, the mortality rate <strong>of</strong> the<br />

encapsulated group was significantly lower (P < 0.05). In<br />

addition, the serum biochemical indexes <strong>of</strong> ALT, AST<br />

and total bilirubin in the microencapsulated group differed<br />

significantly from those in the PBS group (P < 0.01)<br />

WJG|www.wjgnet.com<br />

C<br />

91.2%<br />

10 0 10 1<br />

CD34-PE<br />

10 2<br />

10 3<br />

FS<br />

10 0 10 1<br />

Figure 1 FACS determination <strong>of</strong> CD34 + cells. A: Purity <strong>of</strong> CD34 + cells; B: Homotypic control cells.<br />

A B<br />

C D<br />

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

B<br />

0 1023<br />

H<br />

0.2%<br />

CD34-PE<br />

50 μm 100 μm<br />

50 μm 50 μm<br />

Figure 2 Cell culture and analyses. A: After 16 d; B: A binucleated cell; C, D: Positive staining for albumin (C) and α-fetoprotein (D) after 16 d <strong>of</strong> indction.<br />

at 48 h after transplantation, but there were no differences<br />

between the encapsulated and the unencapsulated group<br />

(Table 2). At 1-2 wk post-transplantation, free microcapsules<br />

with a round clear structure and a smooth surface<br />

were observed in peritoneal lavage fluid, surviving cells<br />

in microcapsules were found by trypan blue staining, but<br />

some fibrous tissues around microcapsules were also detected<br />

in the greater omentum <strong>of</strong> encapsulated group by<br />

HE staining (Figure 6).<br />

DISCUSSION<br />

10 2<br />

With the continued increase in people with hepatic failure<br />

from cirrhosis and hepatocarcinoma, cell transplantation<br />

as an effective therapy is becoming a matter <strong>of</strong> concern<br />

941 February 21, 2011|Volume 17|Issue 7|<br />

10 3

---

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

Table 2 Changes in serum biochemical indexes at different times<br />

48 h after<br />

injection D-GalN<br />

All 3 groups Encapsulated group Unencapsulated<br />

group<br />

ALT (U/L) 3242.3 ± 2403.24 93.93 ± 63.45 b<br />

AST (U/L) 4237.20 ± 1372.07 168.87 ± 89.33 b<br />

TBIL (μmol/L) 5.57 ± 1.86 1.73 ± 1.01 a<br />

WJG|www.wjgnet.com<br />

48 h after transplantation 7 d after transplantation<br />

PBS group Encapsulated group Unencapsulated<br />

group<br />

PBS group<br />

126.1 ± 54.35 245.9 ± 67.87 42.25 ± 11.86 45.07 ± 10.56 47.27 ± 11.08<br />

275.7 ± 52.74 439.7 ± 133.01 162.6 ± 54.29 124.52 ± 24.61 114.83 ± 16.50<br />

2.23 ± 1.98 3.50 ± 1.23 1.90 ± 0.52 2.72 ± 0.96 3.72 ± 1.18<br />

Data are shown as means ± SD. a P < 0.05; b P < 0.01, in comparison with PBS group. TBIL: total bilirubin; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase.<br />

ALB<br />

GATA-4<br />

AFP<br />

GAPDH<br />

d 0 d 8 d 16<br />

Figure 3 Reverse transcription-polymerase chain reaction analysis <strong>of</strong><br />

umbilical cord blood CD34 + cells cultured in vitro d 0, d 8 and d 16. ALB:<br />

Albumin; AFP: α-fetoprotein.<br />

A B<br />

C D<br />

ALB (μg/mL) 48 h<br />

100<br />

80<br />

60<br />

40<br />

20<br />

0<br />

With growth factors<br />

Without growth factors<br />

0 8 16<br />

Figure 4 Determination <strong>of</strong> albumin expression by Enzyme-Linked Immunosorbent<br />

Assay. ALB: Albumin.<br />

100 μm 100 μm<br />

Figure 5 Pathological changes in the livers <strong>of</strong> acute hepatic failure rats. A: Liver at 48 h after injection <strong>of</strong> D-galactosamine; B: Liver at 48 h after microcapsule<br />

transplantation; C: HE staining <strong>of</strong> the liver shown in section (A); D: HE staining <strong>of</strong> the liver shown in section (B).<br />

942 February 21, 2011|Volume 17|Issue 7|<br />

t/d

---

A B<br />

C D<br />

for more scientists. Cell transplantation could <strong>of</strong>fer metabolic<br />

support when liver function is damaged, and extend<br />

the waiting time for a liver donor [5,6] . Hepatic cell transplantation<br />

via the peritoneum or spleen has shown good<br />

prospects in clinical and animal experiments. However,<br />

the cell sources for transplantation and the requirement<br />

for long-term immunosuppression have caused stagnation<br />

in this field.<br />

There have been some intriguing studies that have described<br />

adult stem cells displaying plasticity in recent years.<br />

These studies have led us to consider that using adult<br />

stem cells might cure diseases such as AHF [7,8] . Human<br />

UCB cells are enriched in hematopoietic stem/progenitor<br />

cells that exceed those in the bone marrow and peripheral<br />

blood. In comparison with bone marrow stem cells, UCB<br />

stem cells are even more immature and with lower immunogenicity.<br />

In our previous study, we confirmed that<br />

the conversion <strong>of</strong> UCB MNCs into hepatocytes by three<br />

different ways, namely co-culture with injured liver cells,<br />

growth-factor-assisted culture, and MNC transplantation<br />

in AHF animal models [4] . In the present study, we explored<br />

the possibility that CD34 + cells derived from human UCB<br />

could be converted into hepatic-like cells. At present, the<br />

curative effect <strong>of</strong> hepatic-like cells derived from CD34 +<br />

cells in the bone marrow has already been confirmed by<br />

in vivo animal experiments [9-12] . This showed that an AHF<br />

model was initially set up using immunodeficient mice,<br />

and CD34 + cells enriched by immunobeads were injected<br />

through the tail vein or portal vein into the model animals.<br />

Expression <strong>of</strong> differentiation markers <strong>of</strong> donor cells in<br />

WJG|www.wjgnet.com<br />

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

500 μm 200 μm<br />

200 μm 100 μm<br />

Figure 6 Encapsules observation. A: Microcapsules created by the Alginate-poly-l-lysine-alginate microencapsulation method; B: Microcapsule masses in the peritoneal<br />

lavage fluid; C: Free microcapsules in the peritoneal lavage fluid; D: HE staining shows microcapsules in the greater omentum.<br />

recipient livers at different times after transplantation was<br />

determined by fluorescence in situ hybridization, immunohistochemistry<br />

and molecular biological techniques. It<br />

was found that stress-induced signals, such as increased<br />

expression <strong>of</strong> stromal-cell-derived factor 1, matrix metalloproteinase-9<br />

and HGF, recruits human CD34 + progenitors<br />

with hematopoietic and/or hepatic-like potential to<br />

the liver <strong>of</strong> NOD/SCID mice [13] . Furthermore, another<br />

study has confirmed that FGF, leukemia inhibitory factor,<br />

SCF, HGF, FGF4 and oncostatin M contribute to<br />

the proliferation and/or differentiation <strong>of</strong> hepatic cells<br />

in different ways, and that combinations <strong>of</strong> these factors,<br />

especially HGF and FGF4, are necessary for human UCB<br />

cells to convert into albumin-producing cells [14] .<br />

With a combination <strong>of</strong> HGF and FGF4, we have<br />

established a 16-d culture system to induce CD34 + cell<br />

differentiation. The culture system with HGF and FGF4<br />

displays the capability to convert the CD34 + cells from human<br />

UCB into cells with hepatocyte phenotypes, as confirmed<br />

by RT-PCR, immunohistochemical staining, and<br />

ELISA. Moreover, the positive ratio <strong>of</strong> albumin-containing<br />

cells by immunocytochemical staining was about 30%,<br />

which is consistent with the study <strong>of</strong> Kakinuma et al [14] . All<br />

these indicate that after proliferation and differentiation,<br />

we could obtain many transplantable hepatic-like cells.<br />

Although the lower immunogenicity <strong>of</strong> UCB stem<br />

cells has advantages in heterogenic transplantation, untreated<br />

UCB cells can sometimes cause serious immune<br />

rejection. How to resolve this problem is therefore a key<br />

point for further studies. Microencapsulation <strong>of</strong>fers a<br />

943 February 21, 2011|Volume 17|Issue 7|

---

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

possibility to overcome the difficulty. This technique uses<br />

microcapsules such as APA microcapsules to coat target<br />

cells or organs, and is beneficial for heterogenic transplantation<br />

because its biocompatible and semi-permeable<br />

membranes are capable <strong>of</strong> intercepting substances with<br />

molecular weights above 11 × 10 4 . Since Lim et al [15] first<br />

presented the concept <strong>of</strong> bio-microcapsules in 1980,<br />

artificial cell microcapsules as an effective barrier system<br />

for immunoprotection have been successfully applied in<br />

diabetes, parkinsonism, spinal cord injury, and peripheral<br />

nerve regeneration [15,16] .<br />

Our study examined coated hepatic-like cells derived<br />

from UCB by the APA microencapsulation technique. The<br />

obtained microcapsules exhibited a good smooth surface<br />

and integrated appearance. Furthermore, living cells inside<br />

the microcapsules were > 80% as determined by trypan<br />

blue staining. The mortality rate <strong>of</strong> AHF rats transplanted<br />

with microencapsulated hepatic-like cells significantly decreased<br />

in comparison with AHF rats transplanted with<br />

unencapsulated cells. In addition, there were significantly<br />

better outcomes in serum biochemical indexes such as<br />

ALT, AST and total bilirubin in the encapsulated group<br />

than in the PBS group, but no differences were observed<br />

between the encapsulated and the unencapsulated groups.<br />

Liver pathological staining supported these findings. The<br />

reason why the latter two groups showed no difference requires<br />

further exploration, although it is possibly related to<br />

the lower number <strong>of</strong> encapsulated cells. There have been<br />

some studies to support the notion that microcapsules<br />

provide the encapsulated cells with a good living space,<br />

and can significantly increase their survival time, therefore,<br />

we could theoretically reduce the number <strong>of</strong> transplanted<br />

cells [17] . Our data suggest that the transplantation <strong>of</strong> microencapsulated<br />

hepatic-like cells could <strong>of</strong>fer a metabolic<br />

support to AHF rats in the short term, but it is not sufficient<br />

to interrupt or repair the damage <strong>of</strong> the recipient<br />

hepatocytes.<br />

In our study, the pathological staining clearly showed<br />

liver recovery at 7 d after induction <strong>of</strong> AHF with D-galactosamine.<br />

At 2 wk post-transplantation, the morphological<br />

form <strong>of</strong> free microcapsules could be observed in the<br />

peritoneal lavage fluid, and showed round clear structures<br />

and smooth surfaces, and some microcapsule fragments<br />

were observed as well. HE staining revealed that some<br />

microcapsules attached to the greater omentum exhibited<br />

lymphocyte invasion surrounded with fibrous tissues.<br />

Although transplantation <strong>of</strong> microencapsulated hepaticlike<br />

cells could preliminarily alleviate the symptoms <strong>of</strong><br />

AHF rats, their short lifespan and varying stability are<br />

still problems for the further use <strong>of</strong> the technique. The<br />

improvement in the airflow encapsulation system might<br />

be considered to yield sufficient uniformity in the size <strong>of</strong><br />

microcapsules [18] .<br />

Transplantation <strong>of</strong> microencapsulated cells could<br />

provide a temporary metabolic support to AHF patients<br />

and/or be a transitional treatment, because its mechanism<br />

is not only related to the immunosuppressive and substitution<br />

effects <strong>of</strong> the transplanted cells, but is also associated<br />

WJG|www.wjgnet.com<br />

with liver repair promoted by the transplanted cells. This<br />

new approach could provide a potential alternative for severe<br />

liver diseases.<br />

COMMENTS<br />

Background<br />

With the continued increase in people with hepatic failure from cirrhosis and<br />

hepatocarcinoma, cell transplantation could <strong>of</strong>fer metabolic support when liver<br />

function is damaged, and extend the waiting time for a liver donor. However, the<br />

cell sources for transplantation and the requirement for long-term immunosuppression<br />

have caused stagnation in this field.<br />

Research frontiers<br />

Alginate-poly-l-lysine-alginate (APA) microcapsules have been proved effective<br />

in protecting enclosed target cells from immune rejection following transplantation<br />

into experimental animals. Many studies have been conducted on the cell<br />

sources such as liver stem cells, embryonic stem cells, umbilical cord blood<br />

(UCB) cells and bone marrow stem cells.<br />

Innovations and breakthroughs<br />

The research team led by Pr<strong>of</strong>essor Yu has established an artificial cell microcapsules<br />

platform, which is based on APA microcapsule technology and stem cell<br />

differentiation, to study the therapeutic effects <strong>of</strong> intraperitoneal transplantation <strong>of</strong><br />

microencapsulated hepatic-like cells derived from UCB cells on AHF in rats. The<br />

effective immunoprotectivity <strong>of</strong> artificial cell microcapsules has been observed in<br />

this study, which suggests that the transplantation <strong>of</strong> microencapsulated hepaticlike<br />

cells could <strong>of</strong>fer a metabolic support to AHF rats in the short term, but it is not<br />

yet sufficient to interrupt or repair the damage <strong>of</strong> the recipient hepatocytes.<br />

Applications<br />

Transplantation <strong>of</strong> microencapsulated cells could provide a temporary metabolic<br />

support to AHF patients and/or be used as a transitional treatment. This new<br />

approach could provide a potential alternative for severe liver diseases.<br />

Terminology<br />

UCB was obtained from full-term deliveries at the Obstetrics Department <strong>of</strong> Peking<br />

University Shenzhen Hospital. Hepatic-like cells were induced from UCB<br />

CD34 + cells by culturing with FGF4 and HGF. Alginate-poly-l-lysine-alginate<br />

microcapsules have biocompatibility and semi-permeable membranes, and can<br />

intercept substances with molecular weights > 1.1 × 10 5 .<br />

Peer review<br />

Zhang et al reported that CD34 + cells sorted from human UCB cells were<br />

cultured for 16 d in a specific medium and could differentiate into hepatocytelike<br />

cells. When the hepatocyte-like cells were encapsulated by alginate and<br />

intraperitoneally transplanted into rats with galactosamine-induced AHF, the<br />

number <strong>of</strong> surviving rats increased compared to that <strong>of</strong> control rats at 2 d after<br />

transplantation. Although the differentiation <strong>of</strong> CD34 + cells derived from UCB<br />

to hepatocyte-like cells has been reported, it is interesting to use the peritoneal<br />

injection <strong>of</strong> alginate-encapsulated hepatocyte-like cells for the alleviation <strong>of</strong><br />

AHF. If the preserved UCB cells are used for the treatment <strong>of</strong> AHF and related<br />

diseases, it will be beneficial to the patients.<br />

REFERENCES<br />

1 Sun Y, Ma X, Zhou D, Vacek I, Sun AM. Normalization <strong>of</strong><br />

diabetes in spontaneously diabetic cynomologus monkeys<br />

by xenografts <strong>of</strong> microencapsulated porcine islets without<br />

immunosuppression. J Clin Invest 1996; 98: 1417-1422<br />

2 Chang TM. Therapeutic applications <strong>of</strong> polymeric artificial<br />

cells. Nat Rev Drug Discov 2005; 4: 221-235<br />

3 Orive G, Hernández RM, Gascón AR, Calafiore R, Chang<br />

TM, De Vos P, Hortelano G, Hunkeler D, Lacík I, Shapiro<br />

AM, Pedraz JL. Cell encapsulation: promise and progress.<br />

Nat Med 2003; 9: 104-107<br />

4 Zhang FT, Fang JZ, Yu J, Wan HJ, Ye J, Long X, Yin MJ,<br />

Huang CQ. Conversion <strong>of</strong> mononuclear cells from human<br />

umbilical cord blood into hepatocyte-like cells. Junyi Daxue<br />

Xuebao 2006; 21: 358-364<br />

5 Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan<br />

AK, Murase N, Boggs SS, Greenberger JS, G<strong>of</strong>f JP. Bone<br />

944 February 21, 2011|Volume 17|Issue 7|

---

marrow as a potential source <strong>of</strong> hepatic oval cells. Science<br />

1999; 284: 1168-1170<br />

6 Theise ND, Badve S, Saxena R, Henegariu O, Sell S, Crawford<br />

JM, Krause DS. Derivation <strong>of</strong> hepatocytes from bone<br />

marrow cells in mice after radiation-induced myeloablation.<br />

Hepatology 2000; 31: 235-240<br />

7 Teratani T, Yamamoto H, Aoyagi K, Sasaki H, Asari A,<br />

Quinn G, Sasaki H, Terada M, Ochiya T. Direct hepatic fate<br />

specification from mouse embryonic stem cells. Hepatology<br />

2005; 41: 836-846<br />

8 Sakaida I, Terai S, Nishina H, Okita K. Development <strong>of</strong> cell<br />

therapy using autologous bone marrow cells for liver cirrhosis.<br />

Med Mol Morphol 2005; 38: 197-202<br />

9 Wang X, Ge S, McNamara G, Hao QL, Crooks GM, Nolta<br />

JA. Albumin-expressing hepatocyte-like cells develop in the<br />

livers <strong>of</strong> immune-deficient mice that received transplants <strong>of</strong><br />

highly purified human hematopoietic stem cells. Blood 2003;<br />

101: 4201-4208<br />

10 Newsome PN, Johannessen I, Boyle S, Dalakas E, McAulay<br />

KA, Samuel K, Rae F, Forrester L, Turner ML, Hayes PC,<br />

Harrison DJ, Bickmore WA, Plevris JN. Human cord bloodderived<br />

cells can differentiate into hepatocytes in the mouse<br />

liver with no evidence <strong>of</strong> cellular fusion. Gastroenterology<br />

2003; 124: 1891-1900<br />

11 Ishikawa F, Drake CJ, Yang S, Fleming P, Minamiguchi H,<br />

Visconti RP, Crosby CV, Argraves WS, Harada M, Key LL<br />

Jr, Livingston AG, Wingard JR, Ogawa M. Transplanted human<br />

cord blood cells give rise to hepatocytes in engrafted<br />

mice. Ann N Y Acad Sci 2003; 996: 174-185<br />

WJG|www.wjgnet.com<br />

Zhang FT et al . Transplantation <strong>of</strong> microencapsulated hepatic-like cells<br />

12 Danet GH, Luongo JL, Butler G, Lu MM, Tenner AJ, Simon<br />

MC, Bonnet DA. C1qRp defines a new human stem cell<br />

population with hematopoietic and hepatic potential. Proc<br />

Natl Acad Sci USA 2002; 99: 10441-10445<br />

13 Kollet O, Shivtiel S, Chen YQ, Suriawinata J, Thung SN,<br />

Dabeva MD, Kahn J, Spiegel A, Dar A, Samira S, Goichberg<br />

P, Kalinkovich A, Arenzana-Seisdedos F, Nagler A, Hardan I,<br />

Revel M, Shafritz DA, Lapidot T. HGF, SDF-1, and MMP-9<br />

are involved in stress-induced human CD34+ stem cell recruitment<br />

to the liver. J Clin Invest 2003; 112: 160-169<br />

14 Kakinuma S, Tanaka Y, Chinzei R, Watanabe M, Shimizu-<br />

Saito K, Hara Y, Teramoto K, Arii S, Sato C, Takase K,<br />

Yasumizu T, Teraoka H. Human umbilical cord blood as a<br />

source <strong>of</strong> transplantable hepatic progenitor cells. Stem Cells<br />

2003; 21: 217-227<br />

15 Lim F, Sun AM. Microencapsulated islets as bioartificial endocrine<br />

pancreas. Science 1980; 210: 908-910<br />

16 Kim YT, Hitchcock R, Broadhead KW, Messina DJ, Tresco<br />

PA. A cell encapsulation device for studying soluble factor<br />

release from cells transplanted in the rat brain. J Control Release<br />

2005; 102: 101-111<br />

17 Wang YF, Xue YL, Nan X, Liang F, Luo Y, Li YL, Gao YH,<br />

Yue W, Pei XT. [Sustainment <strong>of</strong> hepatocyte function with<br />

mixed cellular co-encapsulation]. Zhonghua Yixue Zazhi<br />

2005; 85: 2481-2486<br />

18 Shito M, Balis UJ, Tompkins RG, Yarmush ML, Toner M. A<br />

fulminant hepatic failure model in the rat: involvement <strong>of</strong><br />

interleukin-1beta and tumor necrosis factor-alpha. Dig Dis<br />

Sci 2001; 46: 1700-1708<br />

S- Editor Sun H L- Editor Kerr C E- Editor Ma WH<br />

945 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

doi:10.3748/wjg.v17.i7.946<br />

Primary clear cell carcinoma in the liver: CT and MRI<br />

findings<br />

Qing-Yu Liu, Hai-Gang Li, Ming Gao, Xiao-Feng Lin, Yong Li, Jian-Yu Chen<br />

Qing-Yu Liu, Ming Gao, Xiao-Feng Lin, Yong Li, Jian-Yu<br />

Chen, Department <strong>of</strong> Radiology, The Second Affiliated Hospital<br />

<strong>of</strong> Sun Yat-sen University, Guangzhou 510120, Guangdong Province,<br />

China<br />

Hai-Gang Li, Department <strong>of</strong> Pathology, The Second Affiliated<br />

Hospital <strong>of</strong> Sun Yat-sen University, Guangzhou 510120,<br />

Guangdong Province, China<br />

Author contributions: Liu QY designed the study and wrote the<br />

manuscript; Gao M, Li Y and Chen JY contributed to the analysis<br />

and interpretation <strong>of</strong> data; Li HG performed the pathological<br />

analysis; Lin XF contributed to the statistical analysis.<br />

Correspondence to: Qing-Yu Liu, PhD, Department <strong>of</strong> Radiology,<br />

The Second Affiliated Hospital <strong>of</strong> Sun Yat-sen University,<br />

107 Yan Jiang Xi Road, Guangzhou 510120, Guangdong Province,<br />

China. liu.qingyu@163.com<br />

Telephone: +86-20-81332243 Fax: +86-20-81332702<br />

Received: August 29, 2010 Revised: December 1, 2010<br />

Accepted: December 8, 2010<br />

Published online: February 21, 2011<br />

Abstract<br />

AIM: To retrospectively analyze the computed tomography<br />

(CT) and magnetic resonance imaging (MRI) appearances<br />

<strong>of</strong> primary clear cell carcinoma <strong>of</strong> the liver (PCCCL)<br />

and compare the imaging appearances <strong>of</strong> PCCCL and common<br />

type hepatocellular carcinoma (CHCC) to determine<br />

whether any differences exist between the two groups.<br />

METHODS: Twenty cases with pathologically proven<br />

PCCCL and 127 cases with CHCC in the Second Affiliated<br />

Hospital <strong>of</strong> Sun Yat-sen University were included in<br />

this study. CT or MRI images from these patients were<br />

retrospectively analyzed. The following imaging findings<br />

were reviewed: the presence <strong>of</strong> liver cirrhosis, tumor<br />

size, the enhancement pattern on dynamic contrast<br />

scanning, the presence <strong>of</strong> pseudo capsules, tumor rupture,<br />

portal vein thrombosis and lymph node metastasis.<br />

RESULTS: Both PCCCL and CHCC were prone to occur<br />

in patients with liver cirrhosis, the association rate <strong>of</strong><br />

liver cirrhosis was 80.0% and 78.7%, respectively (P ><br />

WJG|www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): 946-952<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

0.05). The mean sizes <strong>of</strong> PCCCL and CHCC tumors were<br />

(7.28 ± 4.25) cm and (6.96 ± 3.98) cm, respectively.<br />

Small HCCs were found in 25.0% (5/20) <strong>of</strong> PCCCL and<br />

19.7% (25/127) <strong>of</strong> CHCC cases. No significant differences<br />

in mean size and ratio <strong>of</strong> small HCCs were found<br />

between the two groups (P = 0.658 and 0.803, respectively).<br />

Compared with CHCC patients, PCCCL patients<br />

were more prone to form pseudo capsules (49.6% vs<br />

75.0%, P = 0.034). Tumor rupture, typical HCC enhancement<br />

patterns and portal vein tumor thrombosis<br />

were detected in 15.0% (3/20), 72.2% (13/18) and<br />

20.0% (4/20) <strong>of</strong> patients with PCCCL and 3.1% (4/127),<br />

83.6% (97/116) and 17.3% (22/127) <strong>of</strong> patients with<br />

CHCC, respectively. There were no significant differences<br />

between the two groups (all P > 0.05). No patients<br />

with PCCCL and 2.4% (3/127) <strong>of</strong> patients with CHCC<br />

showed signs <strong>of</strong> lymph node metastasis (P > 0.05).<br />

CONCLUSION: The imaging characteristics <strong>of</strong> PCCCL<br />

are similar to those <strong>of</strong> CHCC and could be useful for differentiating<br />

these from other liver tumors (such as hemangioma<br />

and hepatic metastases). PCCCLs are more<br />

prone than CHCCs to form pseudo capsules.<br />

© 2011 Baishideng. All rights reserved.<br />

BRIEF ARTICLE<br />

Key words: Clear cell carcinoma; Hepatocellular carcinoma;<br />

Pathology; Magnetic resonance imaging; Computed<br />

Tomography; X-ray<br />

Peer reviewers: C Triantopoulou, MD, PhD, Head <strong>of</strong> Radiology<br />

Department, Konstantopouleio general Hospital, 3-5, Agias Olgas<br />

street, 14233 N. Ionia, Athens, Greece; Hiroshi Yoshida, Associate<br />

Pr<strong>of</strong>essor, Department <strong>of</strong> Surgery, Nippon Medical School<br />

Tama Nagayama Hospital, 1-7-1 Nagayama, Tama-city, Tokyo,<br />

206-8512, Japan<br />

Liu QY, Li HG, Gao M, Lin XF, Li Y, Chen JY. Primary clear<br />

cell carcinoma in the liver: CT and MRI findings. <strong>World</strong> J<br />

Gastroenterol 2011; 17(7): 946-952 Available from: URL:<br />

http://www.wjgnet.com/1007-9327/full/v17/i7/946.htm DOI:<br />

http://dx.doi.org/10.3748/wjg.v17.i7.946<br />

946 February 21, 2011|Volume 17|Issue 7|

---

INTRODUCTION<br />

Hepatocellular carcinoma (HCC) is the most common<br />

primary malignant tumor <strong>of</strong> the liver. It can be classified<br />

according to its histological architecture or cytological<br />

features. HCC includes various cytological types; the less<br />

common ones are clear cell type, spindle cell type, giant<br />

cell type, small cell type and squamous cell type [1,2] . Primary<br />

clear cell carcinoma <strong>of</strong> the liver (PCCCL) is rare, with a<br />

frequency varying between 2.2% and 6.7% among HCCs<br />

reported in the published literatures [3,4] . Due to the accumulation<br />

<strong>of</strong> glycogens and/or fats, the PCCCL cell cytoplasm<br />

is clear to hematoxylin-eosin staining. PCCCL may<br />

pose a diagnostic dilemma even with histological evaluation<br />

because the morphology <strong>of</strong> PCCCL cells is similar<br />

to that <strong>of</strong> extrahepatic clear cell tumors, such as clear cell<br />

<strong>cancer</strong>s <strong>of</strong> the kidneys, adrenal glands, ovaries, thyroid, endometrium,<br />

uterine cervix, and vagina [5,6] . PCCCLs should<br />

be differentiated from metastatic clear cell <strong>cancer</strong> because<br />

their treatment strategies and prognoses are quite different.<br />

The prognosis <strong>of</strong> PCCCL is generally considered better<br />

than that <strong>of</strong> the common type <strong>of</strong> HCC (CHCC) [3,7,8] .<br />

Computed tomography (CT) and magnetic resonance<br />

imaging (MRI) are important examinations for the detection<br />

and characterization <strong>of</strong> liver tumors [9,10] . To our<br />

knowledge, the imaging features <strong>of</strong> PCCCL have rarely<br />

been reported in the English literature [11] . The purpose<br />

<strong>of</strong> this study was to describe the CT and MRI findings<br />

<strong>of</strong> PCCCL and compare them to CHCC to determine<br />

whether any differences exist between the two groups.<br />

MATERIALS AND METHODS<br />

Patients<br />

Between January 2005 and August 2009, a total <strong>of</strong> 570<br />

patients with primary HCC underwent hepatectomy at<br />

the Second Affiliated Hospital <strong>of</strong> Sun Yat-sen University.<br />

Twenty (3.5%) <strong>of</strong> these patients had pathologically confirmed<br />

PCCCL. The participants <strong>of</strong> this study included<br />

20 patients with PCCCL and 127 patients with CHCC<br />

(randomly selected from the other 550 cases <strong>of</strong> primary<br />

HCC). No patient had received preoperative treatment,<br />

such as interventional therapy or chemotherapy.<br />

Of the 20 patients with PCCCL, 14 had right upper<br />

abdominal pain, two complained <strong>of</strong> fatigue and four were<br />

asymptomatic. All patients with PCCCL were positive for<br />

HBsAg, and two were positive for anti-hepatitis C virus-<br />

IgG. The serum concentration <strong>of</strong> α-fetoprotein (AFP)<br />

was 5.8-68 787.0 μg/L for PCCCL patients, with a median<br />

<strong>of</strong> 149.9 μg/L. Of the 20 patients with PCCCL, 17 were<br />

AFP-positive (> 25 μg/L).<br />

Pathologic examinations were retrospectively reviewed<br />

by an experienced pathologist. According to diagnostic<br />

criteria generally accepted by pathologists in China,<br />

PCCCL was diagnosed when clear cells accounted for<br />

more than 50% <strong>of</strong> the tumor [1,3,4,12] .<br />

Imaging protocols<br />

CT or MRI examinations were performed no more than 5<br />

WJG|www.wjgnet.com<br />

Liu QY et al . Primary clear cell carcinoma in the liver<br />

days before hepatectomy. Thirteen patients with PCCCL<br />

and 73 patients with CHCC underwent dynamic CT examination<br />

using a spiral CT scanner (HiSpeed NX/I; GE<br />

Medical Systems, Milwaukee, WI) or a multi-detector CT<br />

scanner (Sensation 64; Siemens Medical Solutions, Erlangen,<br />

Germany). The scan parameters were as follows: 5-<br />

7 mm slice thickness reconstructions, 120-kV, 220-400<br />

mA current, 25 cm field <strong>of</strong> view, and 256 × 256 matrix.<br />

Scans began at the dome <strong>of</strong> the diaphragm and proceeded<br />

in a caudal direction. After pre-contrast CT scans, the patients<br />

underwent dynamic contrast-enhanced scans. A bolus<br />

injection <strong>of</strong> 80-100 mL <strong>of</strong> non-ionic contrast medium<br />

(Iopamidol, Bracco, Milano, Italy) with a concentration <strong>of</strong><br />

350 mg I/mL was given via the antecubital vein at a rate<br />

<strong>of</strong> 3.5 mL/s. Images <strong>of</strong> the hepatic arterial phase (HAP),<br />

portal venous phase (PVP) and equilibrium phase (EP)<br />

were obtained at 25 s, 70 s and 120 s, respectively, after the<br />

injection <strong>of</strong> contrast agent.<br />

Seven patients with PCCCL and 54 patients with<br />

CHCC underwent MRI studies with a 1.5-T MR unit<br />

(Gyroscan Intera, Philips Medical System, Best, the Netherlands).<br />

Unenhanced MR images included T1-weighted<br />

images with a water-selective excitation technique (FFE,<br />

TR 218ms, TE 4.9 ms, flip angle <strong>of</strong> 80, one acquisition)<br />

and turbo spin-echo T2-weighted images with fat saturation<br />

(TR 1600 ms, TE 70 ms, TSE Factor 24, three acquisitions).<br />

Five patients with PCCCL and 43 patients with<br />

CHCC underwent dynamic contrast-enhanced MR scans<br />

using a high-resolution turbo spin-echo sequence (TR<br />

5.3 ms, TE 1.4 ms, flip angle <strong>of</strong> 40, 3.0-mm slice thickness,<br />

no gap, one acquisition) via a power injector; contrast<br />

agent was administrated at a rate <strong>of</strong> 2.5 mL/sec.<br />

HAP, PVP and EP scans were obtained at 20, 60, and 110 s,<br />

respectively. The other 13 patients (2 with PCCCL and 11<br />

with CHCC) received manual injections <strong>of</strong> gadopentetate<br />

dimeglumine (Magnevist, Bayer Schering, Berlin, Germany)<br />

at a dose <strong>of</strong> 0.1 mmol/kg; post-contrast T1-weighted<br />

images were obtained at PVP (60-80 s after injection) with<br />

the same scanning parameters as the pre-contrast T1W<br />

scan. Regardless <strong>of</strong> the technique employed, axial and<br />

coronal images were acquired with 5.0-mm slice thickness.<br />

Image interpretation<br />

The CT and MRI images were retrospectively analyzed by<br />

two radiologists who have 10 and 15 years <strong>of</strong> experience<br />

in diagnosing abdominal diseases. Neither radiologist was<br />

aware <strong>of</strong> the patients’ clinicopathological data. Reviews<br />

were performed jointly and by consensus. The presence<br />

<strong>of</strong> liver cirrhosis, tumor size, the enhancement pattern<br />

on dynamic contrast scanning, the presence <strong>of</strong> pseudocapsule,<br />

tumor rupture, portal vein thrombus, and lymph<br />

node metastasis were recorded. A typical HCC enhancement<br />

pattern was defined as early enhancement at HAP<br />

and rapid contrast medium washout at PVP or EP with<br />

hypo-attenuation/intense signal or iso-attenuation/intense<br />

signal [9,10] .<br />

Statistical analysis<br />

Differences in mean age and tumor size were assessed<br />

947 February 21, 2011|Volume 17|Issue 7|

---

Liu QY et al . Primary clear cell carcinoma in the liver<br />

with an independent-samples t test. Differences in the<br />

frequencies <strong>of</strong> liver cirrhosis, tumor capsule formation,<br />

tumor rupture, typical enhancement pattern, portal vein<br />

tumor thrombus and lymph node metastases between the<br />

two groups were compared using the Chi-squared test or<br />

Fischer’s exact test. A P value <strong>of</strong> 0.05 or less was considered<br />

significant. Statistical analysis was performed using the<br />

SPSS 13.0 s<strong>of</strong>tware package (SPSS Inc., Chicago, IL, USA).<br />

RESULTS<br />

The male-to-female ratio was 4.0:1 in the PCCCL group<br />

and 6.1:1 in the CHCC group. The mean age was 52.00<br />

± 10.09 years (range, 29-66 years) in the PCCCL group<br />

and 51.82 ± 13.20 years (range, 19-83 years) in the CHCC<br />

group. There were no statistical differences between the<br />

two groups regarding sex or age (P = 0.733 and P = 0.953,<br />

respectively).<br />

Table 1 summarizes the imaging features observed in patients<br />

with PCCCL and patients with CHCC. Both PCCCL<br />

and CHCC were prone to occur in patients with liver cirrhosis,<br />

with a rate <strong>of</strong> 80.0% and 78.7%, respectively. The mean<br />

sizes <strong>of</strong> PCCCLs and CHCCs were 7.28 ± 4.25 cm (range,<br />

2.0-15.9 cm), and 6.96 ± 3.98 cm (range, 1.0-17.0 cm),<br />

respectively. Small HCCs with diameters ≤ 3.0 cm were<br />

found in 25.0% (5/20) <strong>of</strong> PCCCL cases and 19.7% (25/127)<br />

<strong>of</strong> CHCC cases. No statistically significant differences in<br />

mean size or ratio <strong>of</strong> small HCC were found between the<br />

two groups (P = 0.658 and 0.803, respectively). Compared<br />

with CHCCs, PCCCLs were more prone to form pseudo<br />

capsules, with a rate <strong>of</strong> 49.6% and 75.0%, respectively (P =<br />

0.034). Pseudo capsules showed hypo-attenuation/intensity<br />

haloes on pre-contrast scans and rim enhancement after<br />

contrast administration (Figures 1 and 2).<br />

A higher percentage <strong>of</strong> tumor rupture was found<br />

in patients with PCCCL (15.0%, 3/20) than in patients<br />

with CHCC (3.1%, 4/127); however, there was no significant<br />

difference between the two groups (P > 0.05).<br />

Of the 20 PCCCL cases, three showed tumor ruptures.<br />

The ruptured tumors were 15.9 cm, 10.9 cm and 9.3cm<br />

in diameter and were located at the periphery <strong>of</strong> the liver<br />

with protruding contours. Two cases presented as discontinuities<br />

<strong>of</strong> the liver surface on CT scan (Figure 1). The<br />

remaining case presented a local hematoma at the rupture<br />

site on MRI, which appeared as mixed iso-/hypo-intense<br />

signals on T1WI and hypo-intense signals on T2WI with<br />

no enhancement after injection <strong>of</strong> contrast agent.<br />

Typical HCC enhancement patterns were noted in<br />

72.2% (13/18) <strong>of</strong> PCCCLs and 83.6% (97/116) <strong>of</strong><br />

CHCCs; however, no significant difference was found<br />

between the two groups (P > 0.05) (Figures 1 and 3). The<br />

other five PCCCL cases showed atypical CT features on<br />

dynamic scan: two cases showed minimal enhancement<br />

and remained hypo-attenuated at HAP and PVP, while the<br />

other three cases showed gradual contrast enhancement<br />

during the portal phase.<br />

Four patients (20.0%) with PCCCL had portal vein<br />

tumor thrombosis: one located at the left branch <strong>of</strong> the<br />

portal vein, one at the right branch, and one at the right<br />

WJG|www.wjgnet.com<br />

Table 1 Characteristics <strong>of</strong> clear cell hepatocellular carcinoma<br />

in the liver<br />

Parameters PCCCL<br />

(n = 20)<br />

anterior branch and main portal vein. Compared with<br />

CHCC patients, PCCCL patients showed a slightly higher<br />

incidence <strong>of</strong> portal vein tumor thrombosis (17.3% and<br />

20.0%, respectively); however, there was no significant difference<br />

between the two groups (P > 0.05). No PCCCL<br />

patients and 2.4% (3/127) CHCC patients showed sign <strong>of</strong><br />

lymph node metastasis (P > 0.05).<br />

DISCUSSION<br />

CHCC<br />

(n = 127)<br />

P value<br />

Sex 0.733<br />

Male 16 109<br />

Female 4 18<br />

Liver cirrhosis 1.000<br />

Positive 16 100<br />

Negative 4 27<br />

Tumor diameter (cm) 0.803<br />

≤ 3.0 5 25<br />

> 3.0 15 102<br />

Capsule formation 0.034<br />

Positive 15 63<br />

Negative 5 64<br />

Rupture 0.053<br />

Positive 3 4<br />

Negative 17 123<br />

Typical enhancement pattern 0.399<br />

Positive 13 97<br />

Negative 5 19<br />

Portal vein tumor thrombus 1.000<br />

Positive 4 22<br />

Negative 16 105<br />

Lymph node metastases 1.000<br />

Positive 0 3<br />

Negative 20 124<br />

PCCCL: Primary clear cell carcinoma <strong>of</strong> the liver; CHCC: Common type <strong>of</strong><br />

hepatocellular carcinoma.<br />

PCCCL is a specific and rare subtype <strong>of</strong> primary HCC.<br />

The reported incidence <strong>of</strong> PCCCL is 0.4%-37%; inconsistent<br />

diagnostic criteria may be responsible for the variable<br />

reports [1,3,4,7,8,12,13] . Lai et al [7] suggested that the diagnosis<br />

<strong>of</strong> PCCCL could be made even when the proportion <strong>of</strong><br />

clear cells was < 30%, while Buchanan et al [8] suggested<br />

that PCCCL should be diagnosed when the proportion<br />

<strong>of</strong> clear cells was > 30%. Most studies diagnosed PCCCL<br />

when the proportion <strong>of</strong> clear cells was > 50% [1,3,4,12] . Using<br />

this criteria, PCCCL only accounts for 2.2%-6.7% <strong>of</strong><br />

all resectable HCCs in most reports [3,4] . Among the 570<br />

cases <strong>of</strong> primary HCC resected in our hospital, only 3.5%<br />

patients had PCCCL. The clear cell development is presumed<br />

to involve metabolic disorders and abnormalities<br />

<strong>of</strong> sugar metabolism [14,15] .<br />

The clinicopathological presentations <strong>of</strong> PCCCL were<br />

different from those <strong>of</strong> CHCC. The rates <strong>of</strong> hepatitis C<br />

infection and capsule formation were higher in PCCCL<br />

patients than in those with CHCC; however, no remarkable<br />

differences in patients’ age, sex, AFP-positive rate or<br />

948 February 21, 2011|Volume 17|Issue 7|

---

A<br />

C<br />

Liu QY et al . Primary clear cell carcinoma in the liver<br />

the location, number, size and grade <strong>of</strong> tumors were observed<br />

between the two groups [3] . Both tumor types were<br />

prone to occur in patients with hepatitis B, mostly on the<br />

basis <strong>of</strong> liver cirrhosis [3] . PCCCL had a better prognosis<br />

than CHCC, mainly related to capsule formation, vascular<br />

invasion, preoperative liver function and clear cell proportion<br />

[3,4,12] . Surgical resection is an effective treatment for<br />

patients with PCCCL [3,4,7] .<br />

The presence <strong>of</strong> clear cells and fatty changes characterizes<br />

well-differentiated HCC in the early <strong>stage</strong>, and their<br />

ratio is presumed to decrease as the tumor enlarges [15] . In<br />

1999, Monzawa et al [16] analyzed the pathologic and imaging<br />

changes <strong>of</strong> well-differentiated HCC; and found that<br />

some well-differentiated HCCs showed clear cell formation<br />

and/or fatty changes, which presented as high echo<br />

on ultrasound and hyper-intense signals on T1WI. However,<br />

in their study, the proportion <strong>of</strong> clear cells in the recruited<br />

HCC was less than 10%, or only 10%-50%, which<br />

did not meet the diagnosis criteria for PCCCL. In 2008,<br />

Takahashi et al [11] described CT, MR and angiographic<br />

findings <strong>of</strong> PCCCL in a woman with a normal liver. To<br />

our knowledge, no further research on the imaging manifestations<br />

<strong>of</strong> PCCCL has been conducted.<br />

Pseudocapsule formation (consisting mainly <strong>of</strong> peritumoral<br />

hepatic sinusoids and/or fibrosis) is an important<br />

gross pathologic feature <strong>of</strong> HCC. Pseudocapsule indicates<br />

a relatively positive prognosis after tumor resection [17] . Liu<br />

et al [3] found a higher ratio <strong>of</strong> pseudocapsule formation in<br />

PCCCL than in CHCC microscopically (88.4% vs 68.0%,<br />

P < 0.05); and pseudocapsule formation might be related<br />

WJG|www.wjgnet.com<br />

B<br />

D<br />

Figure 3 Primary clear cell carcinoma <strong>of</strong> the liver in a 62-year-old man. A: On pre-contrast computed tomography scan, the mass shows hypo-attenuation (arrows);<br />

B: At hepatic arterial phase, the mass shows early enhancement; C: At portal venous phase, the mass shows hypo-attenuation and thin rim enhancement (pseudocapsule);<br />

D: Microscopically, the mass is mainly composed <strong>of</strong> clear cells (HE, × 200).<br />

to a relatively lower degree <strong>of</strong> malignancy and a better<br />

prognosis for PCCCL. CT and MRI are reliable imaging<br />

examinations for the detection <strong>of</strong> HCC pseudo capsules.<br />

The pseudocapsule presents as rim enhancement on dynamic<br />

contrast scanning, and MRI is more sensitive than<br />

CT in identifying pseudocapsule [17-19] . Among the 20 cases<br />

<strong>of</strong> PCCCL in our study, 15 (75.0%) had pseudocapsule,<br />

all <strong>of</strong> which were confirmed pathologically. The percentage<br />

<strong>of</strong> pseudocapsule formation was higher in PCCCL<br />

patients than in CHCC patients (P < 0.05).<br />

Because <strong>of</strong> hypervascular blood supply, typical HCC<br />

showed early enhancement at HAP, and rapid contrast<br />

medium washout at PVP or EP with hypo-attenuation/intense<br />

signal or iso-attenuation/intense signal [9,10] . Among<br />

the 18 PCCCL cases in our study that underwent dynamic<br />

contrast CT or MRI examination, 13 presented a typical<br />

HCC enhancement pattern, indicating that the tumor is<br />

rich <strong>of</strong> blood supply. The enhancement pattern <strong>of</strong> PCCCL<br />

is not different from that <strong>of</strong> CHCC (P > 0.05). This imaging<br />

characteristic may be useful in differentiating PCCCL<br />

from other liver tumors, such as hemangioma and hepatic<br />

metastases. The other five PCCCL cases presented atypical<br />

enhancement on dynamic CT scans: two cases showed<br />

minimal enhancement with hypo-attenuation at HAP and<br />

PVP, indicating hypovascularity, and three cases showed<br />

gradual contrast enhancement during the portal phase,<br />

which may be attributable to the difference in blood supply<br />

(such as existence <strong>of</strong> small arterioportal shunts), tumor<br />

differentiation or liver cirrhosis background [20,21] .<br />

Spontaneous rupture <strong>of</strong> HCC is usually life-threaten-<br />

950 February 21, 2011|Volume 17|Issue 7|

---

ing but relatively uncommon, with a reported incidence<br />

<strong>of</strong> 3%-15% [22] . CT is a valuable imaging technique for<br />

diagnosing HCC ruptures. The imaging findings include:<br />

discontinuity or disruption <strong>of</strong> the liver capsule adjacent<br />

to the liver mass and hematoma with hyper-attenuation<br />

at the rupture site. The enucleation sign is a specific sign<br />

for diagnosing HCC rupture [23,24] . To our knowledge, no<br />

report on PCCCL rupture is available for review. Among<br />

the 20 PCCCL cases in our study, only three had tumor<br />

rupture: two showed discontinuity <strong>of</strong> the liver capsule on<br />

CT scans, and the other showed a hematoma at the rupture<br />

site on MRI, with iso-/hypo-intense signals on T1WI<br />

and hypo-intense signals on T2WI.<br />

Portal vein thrombosis, the characteristic growth pattern<br />

<strong>of</strong> HCC, occurs in 12.5%-39.7% <strong>of</strong> HCC patients [25] .<br />

Liu et al [3] reported that the microscopic vascular invasion<br />

rates are similar between PCCCL and CHCC (53.4% vs<br />

65.0%, P > 0.05). In our study, the incidence <strong>of</strong> macroscopic<br />

portal vein tumor thrombus in PCCCL and CHCC<br />

detected on imaging examination was not significantly different<br />

(P > 0.05). Portal vein invasion was an independent<br />

risk factor for the prognosis <strong>of</strong> patients with PCCCL [12] .<br />

Chemical shift imaging is valuable for characterizing<br />

lesions with a mixture <strong>of</strong> water and fat [26] . Renal clear<br />

cell carcinomas usually contain fat, and present focal and<br />

diffused signal loss on chemical shift imaging. This imaging<br />

technique is helpful for differentiating renal clear cell<br />

carcinoma from other types <strong>of</strong> renal <strong>cancer</strong> [27,28] . The cell<br />

morphology <strong>of</strong> PCCCL is similar to that <strong>of</strong> renal clear<br />

cell carcinoma, with cytoplasmic accumulation <strong>of</strong> glycogens<br />

and/or fat. The signal reduction <strong>of</strong> HCC during<br />

chemical shift imaging may help identify intratumoral fatty<br />

components and confirm a diagnosis <strong>of</strong> PCCCL [2] .<br />

In summary, the imaging characteristics <strong>of</strong> PCCCL are<br />

similar to those <strong>of</strong> CHCC, including early enhancement<br />

and rapid washout <strong>of</strong> contrast agent on dynamic contrast<br />

scans, and presence <strong>of</strong> portal vein thrombus or tumor rupture.<br />

These imaging features may help differentiate PCCCL<br />

from other liver tumors, such as hemangioma and hepatic<br />

metastases. Pseudocapsule formation is more likely to occur<br />

in PCCCL than in CHCC and may be related to PCCCL’s<br />

relatively lower degree <strong>of</strong> malignancy and better prognosis.<br />

COMMENTS<br />

Background<br />

Primary clear cell carcinoma <strong>of</strong> the liver (PCCCL) is a specific and rare subtype<br />

<strong>of</strong> primary hepatocellular carcinoma (HCC), with a frequency varying between<br />

2.2% and 6.7% among HCCs in the published literatures. PCCCL may pose a<br />

diagnostic dilemma even with histological sections because the morphology <strong>of</strong><br />

PCCCL cells is similar to that <strong>of</strong> metastatic clear cell tumors. As a result <strong>of</strong> the<br />

paucity <strong>of</strong> cases, available data about its imaging findings are limited.<br />

Research frontiers<br />

Imaging modalities [computed tomography (CT) and magnetic resonance imaging<br />

(MRI)] are important for the detection and characterization <strong>of</strong> liver tumors.<br />

The imaging characteristics <strong>of</strong> common type hepatocellular carcinoma (CHCC)<br />

are well documented; for example, CHCC is usually associated with liver cirrhosis,<br />

typical enhancement pattern on dynamic contrast scanning (early enhancement<br />

at hepatic arterial phase and rapid contrast medium washout at portal<br />

venous phase or equilibrium phase) and the presence <strong>of</strong> pseudocapsule. However,<br />

the imaging features <strong>of</strong> PCCCL have not been unequivocally addressed.<br />

This study clarifies the CT or MRI findings <strong>of</strong> PCCCL.<br />

WJG|www.wjgnet.com<br />

Liu QY et al . Primary clear cell carcinoma in the liver<br />

Innovations and breakthroughs<br />

The authors presented 20 surgically confirmed PCCCL cases and retrospectively<br />

analyzed their imaging findings. This study revealed that the imaging<br />

characteristics <strong>of</strong> PCCCL are similar to those <strong>of</strong> CHCC. PCCCLs are more<br />

likely to form pseudo capsules than CHCCs.<br />

Applications<br />

With a better understanding <strong>of</strong> the imaging features <strong>of</strong> PCCCL, further investigations<br />

should determine how to use imaging modalities, especially MRI, to differentiate<br />

PCCCL from CHCC or metastatic clear cell <strong>cancer</strong>. Chemical shift imaging<br />

with an MR scanner may help detect lipid component in the cytoplasm <strong>of</strong> clear<br />

cells in PCCCL.<br />

Terminology<br />

PCCCL is a rare variant <strong>of</strong> HCC. Due to the accumulation <strong>of</strong> large amounts <strong>of</strong> glycogen<br />

and/or lipids that are dissolved by routine histological processing (hematoxylineosin<br />

staining), the cytoplasm <strong>of</strong> PCCCL cells is clear. PCCCL can be diagnosed<br />

when the tumor cells are predominantly or wholly composed <strong>of</strong> clear cell cytoplasm<br />

(a proportion <strong>of</strong> clear cells > 50%). The prognosis <strong>of</strong> PCCCL is generally considered<br />

better than that <strong>of</strong> the CHCC.<br />

Peer review<br />

It is a well written paper, with interesting results.<br />

REFERENCES<br />

1 Cong WM, Zhang SH. Introduction <strong>of</strong> the rare types <strong>of</strong><br />

HCC. Chin J Pathol 2002; 31: 457-460<br />

2 Chung YE, Park MS, Park YN, Lee HJ, Seok JY, Yu JS, Kim<br />

MJ. Hepatocellular carcinoma variants: radiologic-pathologic<br />

correlation. AJR Am J Roentgenol 2009; 193: W7-W13<br />

3 Liu Z, Ma W, Li H, Li Q. Clinicopathological and prognostic<br />

features <strong>of</strong> primary clear cell carcinoma <strong>of</strong> the liver. Hepatol<br />

Res 2008; 38: 291-299<br />

4 Lao XM, Zhang YQ, Jin X, Lin XJ, Guo RP, Li GH, Li JQ. Primary<br />

clear cell carcinoma <strong>of</strong> liver--clinicopathologic features<br />

and surgical results <strong>of</strong> 18 cases. Hepatogastroenterology 2006;<br />

53: 128-132<br />

5 Murakata LA, Ishak KG, Nzeako UC. Clear cell carcinoma<br />

<strong>of</strong> the liver: a comparative immunohistochemical study with<br />

renal clear cell carcinoma. Mod Pathol 2000; 13: 874-881<br />

6 Oliveira AM, Erickson LA, Burgart LJ, Lloyd RV. Differentiation<br />

<strong>of</strong> primary and metastatic clear cell tumors in the liver<br />

by in situ hybridization for albumin messenger RNA. Am J<br />

Surg Pathol 2000; 24: 177-182<br />

7 Lai CL, Wu PC, Lam KC, Todd D. Histologic prognostic indicators<br />

in hepatocellular carcinoma. Cancer 1979; 44: 1677-1683<br />

8 Buchanan TF Jr, Huvos AG. Clear-cell carcinoma <strong>of</strong> the liver.<br />

A clinicopathologic study <strong>of</strong> 13 patients. Am J Clin Pathol<br />

1974; 61: 529-539<br />

9 Willatt JM, Hussain HK, Adusumilli S, Marrero JA. MR Imaging<br />

<strong>of</strong> hepatocellular carcinoma in the cirrhotic liver: challenges<br />

and controversies. Radiology 2008; 247: 311-330<br />

10 Jeong YY, Yim NY, Kang HK. Hepatocellular carcinoma in<br />

the cirrhotic liver with helical CT and MRI: imaging spectrum<br />

and pitfalls <strong>of</strong> cirrhosis-related nodules. AJR Am J<br />

Roentgenol 2005; 185: 1024-1032<br />

11 Takahashi A, Saito H, Kanno Y, Abe K, Yokokawa J, Irisawa<br />

A, Kenjo A, Saito T, Gotoh M, Ohira H. Case <strong>of</strong> clear-cell hepatocellular<br />

carcinoma that developed in the normal liver <strong>of</strong><br />

a middle-aged woman. <strong>World</strong> J Gastroenterol 2008; 14: 129-131<br />

12 Ji SP, Li Q, Dong H. Therapy and prognostic features <strong>of</strong> primary<br />

clear cell carcinoma <strong>of</strong> the liver. <strong>World</strong> J Gastroenterol<br />

2010; 16: 764-769<br />

13 Kashala LO, Conne B, Kalengayi MM, Kapanci Y, Frei PC,<br />

Lambert PH. Histopathologic features <strong>of</strong> hepatocellular carcinoma<br />

in Zaire. Cancer 1990; 65: 130-134<br />

14 Yang SH, Watanabe J, Nakashima O, Kojiro M. Clinicopathologic<br />

study on clear cell hepatocellular carcinoma. Pathol Int<br />

1996; 46: 503-509<br />

15 Kojiro M. Pathology <strong>of</strong> early liver <strong>cancer</strong> and similar lesions.<br />

1st ed. Tokyo: Igaku-Shoin Ltd., 1996: 35-37<br />

16 Monzawa S, Omata K, Shimazu N, Yagawa A, Hosoda K,<br />

951 February 21, 2011|Volume 17|Issue 7|

---

Liu QY et al . Primary clear cell carcinoma in the liver<br />

Araki T. Well-differentiated hepatocellular carcinoma: findings<br />

<strong>of</strong> US, CT, and MR imaging. Abdom Imaging 1999; 24: 392-397<br />

17 Ishigami K, Yoshimitsu K, Nishihara Y, Irie H, Asayama<br />

Y, Tajima T, Nishie A, Hirakawa M, Ushijima Y, Okamoto<br />

D, Taketomi A, Honda H. Hepatocellular carcinoma with a<br />

pseudocapsule on gadolinium-enhanced MR images: correlation<br />

with histopathologic findings. Radiology 2009; 250:<br />

435-443<br />

18 Grazioli L, Olivetti L, Fugazzola C, Benetti A, Stanga C,<br />

Dettori E, Gallo C, Matricardi L, Giacobbe A, Chiesa A. The<br />

pseudocapsule in hepatocellular carcinoma: correlation between<br />

dynamic MR imaging and pathology. Eur Radiol 1999; 9:<br />

62-67<br />

19 Ebara M, Ohto M, Watanabe Y, Kimura K, Saisho H, Tsuchiya<br />

Y, Okuda K, Arimizu N, Kondo F, Ikehira H. Diagnosis <strong>of</strong><br />

small hepatocellular carcinoma: correlation <strong>of</strong> MR imaging<br />

and tumor histologic studies. Radiology 1986; 159: 371-377<br />

20 Efremidis SC, Hytiroglou P, Matsui O. Enhancement patterns<br />

and signal-intensity characteristics <strong>of</strong> small hepatocellular<br />

carcinoma in cirrhosis: pathologic basis and diagnostic<br />

challenges. Eur Radiol 2007; 17: 2969-2982<br />

21 Hayashida M, Ito K, Fujita T, Shimizu A, Sasaki K, Tanabe M,<br />

Matsunaga N. Small hepatocellular carcinomas in cirrhosis:<br />

differences in contrast enhancement effects between helical<br />

WJG|www.wjgnet.com<br />

CT and MR imaging during multiphasic dynamic imaging.<br />

Magn Reson Imaging 2008; 26: 65-71<br />

22 Lai EC, Lau WY. Spontaneous rupture <strong>of</strong> hepatocellular carcinoma:<br />

a systematic review. Arch Surg 2006; 141: 191-198<br />

23 Choi BG, Park SH, Byun JY, Jung SE, Choi KH, Han JY. The<br />

findings <strong>of</strong> ruptured hepatocellular carcinoma on helical CT.<br />

Br J Radiol 2001; 74: 142-146<br />

24 Kim HC, Yang DM, Jin W, Park SJ. The various manifestations<br />

<strong>of</strong> ruptured hepatocellular carcinoma: CT imaging<br />

findings. Abdom Imaging 2008; 33: 633-642<br />

25 Minagawa M, Makuuchi M. Treatment <strong>of</strong> hepatocellular<br />

carcinoma accompanied by portal vein tumor thrombus.<br />

<strong>World</strong> J Gastroenterol 2006; 12: 7561-7567<br />

26 Valls C, Iannacconne R, Alba E, Murakami T, Hori M, Passariello<br />

R, Vilgrain V. Fat in the liver: diagnosis and characterization.<br />

Eur Radiol 2006; 16: 2292-2308<br />

27 Outwater EK, Bhatia M, Siegelman ES, Burke MA, Mitchell<br />

DG. Lipid in renal clear cell carcinoma: detection on opposed-phase<br />

gradient-echo MR images. Radiology 1997; 205:<br />

103-107<br />

28 Yoshimitsu K, Honda H, Kuroiwa T, Irie H, Tajima T, Jimi M,<br />

Kuroiwa K, Naito S, Masuda K. MR detection <strong>of</strong> cytoplasmic<br />

fat in clear cell renal cell carcinoma utilizing chemical shift<br />

gradient-echo imaging. J Magn Reson Imaging 1999; 9: 579-585<br />

S- Editor Tian L L- Editor Ma JY E- Editor Lin YP<br />

952 February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): I<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

ACKNOWLEDGMENTS<br />

Acknowledgments to reviewers <strong>of</strong> <strong>World</strong> <strong>Journal</strong> <strong>of</strong><br />

Gastroenterology<br />

Many reviewers have contributed their expertise and<br />

time to the peer review, a critical process to ensure the<br />

quality <strong>of</strong> <strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology. The editors<br />

and authors <strong>of</strong> the articles submitted to the journal are<br />

grateful to the following reviewers for evaluating the<br />

articles (including those published in this issue and<br />

those rejected for this issue) during the last editing<br />

time period.<br />

Shahab Abid, Dr., Associate Pr<strong>of</strong>essor, Department <strong>of</strong> Medicine, Aga<br />

Khan University, Stadium Road, PO Box 3500, Karachi 74800, Pakistan<br />

Hussein M Atta, MD, PhD, Department <strong>of</strong> Surgery, Faculty <strong>of</strong> Medicine,<br />

Minia University, Mir-Aswan Road, El-Minia 61519, Egypt<br />

Huijie Bian, Pr<strong>of</strong>essor, Vice-Director ,Department <strong>of</strong> Cell Biololy/Cell<br />

Engineering Research Center, Fourth Military Medical University, Xi'an<br />

710032, Shaanxi Province, China<br />

Alberto Biondi, Dr., PhD, Department <strong>of</strong> Surgery, 1st Surgical Division,<br />

Catholic University <strong>of</strong> Rome, Largo A. Gemelli 8, Rome 00168, Italy<br />

Hoon Jai Chun, MD, PhD, AGAF, Pr<strong>of</strong>essor, Department <strong>of</strong> Internal<br />

Medicine, Institute <strong>of</strong> Digestive Disease and Nutrition, Korea University<br />

College <strong>of</strong> Medicine, 126-1, Anam-dong 5-ga, Seongbuk-gu, Seoul<br />

136-705, South Korea<br />

Laurie DeLeve, Dr., University <strong>of</strong> Southern California Keck School <strong>of</strong><br />

Medicine, 2011 Zonal Avenue-HMR603, LA 90033, United States<br />

AM El-Tawil, MSc, MRCS, PhD, Department <strong>of</strong> Surgery, University<br />

Hospital <strong>of</strong> Birmingham, East Corridor, Ground Floor, Birmingham, B15<br />

2TH, United Kingdom<br />

Giammarco Fava, MD, Department <strong>of</strong> Gastroenterology, Università<br />

Politecnica delle Marche, Ancona, via Gervasoni 12, 60129 Ancona, Italy<br />

Fritz Francois, Dr., Assistant Dean for Academic Affairs and Diversity,<br />

Assistant Pr<strong>of</strong>essor <strong>of</strong> Medicine, New York University School <strong>of</strong> Medicine,<br />

423 E. 23rd St. Room 1132N, New York, NY 10010, United States<br />

Beata Jolanta Jablońska, MD, PhD, Department <strong>of</strong> Digestive Tract<br />

Surgery, University Hospital <strong>of</strong> Medical University <strong>of</strong> Silesia, Medyków 14<br />

St. 40-752 Katowice, Poland<br />

Waliul Khan, MBBs, PhD, Assistant Pr<strong>of</strong>essor, Department <strong>of</strong> Medicine,<br />

McMaster University, Room 3N5D, Health Science Center, 1200<br />

Main Street West, Hamilton, Ontario L8N 3Z5, Canada<br />

Hong Joo Kim, MD, Pr<strong>of</strong>essor, Department <strong>of</strong> Internal Medicine,<br />

WJG|www.wjgnet.com<br />

Sungkyunkwan University Kangbuk Samsung Hospital, 108, Pyung-Dong,<br />

Jongro-Ku, Seoul, 110-746, South Korea<br />

Kirk Ludwig, M.D., Associate Pr<strong>of</strong>essor <strong>of</strong> Surgery, Chief <strong>of</strong> Colo<strong>rectal</strong><br />

Surgery, Department <strong>of</strong> Surgery, Medical College <strong>of</strong> Wisconsin, 9200<br />

West Wisconsin Avenue, Milwaukee, Wisconsin, WI 53226, United States<br />

Eli Magen, Allergy and Clinical Immunology, Medicine B, Barzilai Medical<br />

Center, Ashdod 77456, Israel<br />

Ricardo Marcos, Ph.D, Lab Histology and Embryology, Institute <strong>of</strong><br />

Biomedical Sciences Abel Salazar, ICBAS, Lg Pr<strong>of</strong> Abel Salazar, 2, Porto,<br />

4099-003, Portugal<br />

Luca Morelli, MD, UO, Dr., Anatomy and Histology, Ospedale S. Chiara,<br />

Largo Medaglie d’Oro 9, Trento, 38100, Italy<br />

Tor C Savidge, PhD, Associate Pr<strong>of</strong>essor, Department <strong>of</strong> Gastroenterology<br />

& Hepatology, Galveston, TX 77555, United States<br />

Giovanni Tarantino, MD, Pr<strong>of</strong>essor, Department <strong>of</strong> Clinical and Experimental<br />

Medicine, Federico II University Medical School, VIA S. PAN-<br />

SINI, 5, Naples 80131, Italy<br />

Cesare Tosetti, MD, Department <strong>of</strong> Primary Care, Health Care Agency<br />

<strong>of</strong> Bologna Via Rosselli 21, 40046 Porretta Terme (BO), Italy<br />

Evangelos Tsiambas, MD, PhD, Cytopathologist, Lecturer in Molecular<br />

Cytopathology, Department <strong>of</strong> Pathology, Medical School, University<br />

<strong>of</strong> Athens, Ag Paraskevi Attiki, 15341, Greece<br />

Masahito Uemura, MD, Associate Pr<strong>of</strong>essor, Third Department <strong>of</strong> Internal<br />

Medicine, Nara Medical University, Shijo-cho, 840, Kashihara, Nara<br />

634-8522, Japan<br />

Lea Veijola, Consultant Gastroenterologist, Herttoniemi Hospital,<br />

Health Care <strong>of</strong> City <strong>of</strong> Helsinki, Kettutie 8, Helsinki, 00800, Finland<br />

Steven D Wexner, MD, Pr<strong>of</strong>essor <strong>of</strong> Surgery, The Cleveland Clinic Foundation<br />

Health Sciences Center <strong>of</strong> the Ohio State University, and Clinical<br />

Pr<strong>of</strong>essor, Department <strong>of</strong> Surgery, Division <strong>of</strong> General Surgery, University<br />

<strong>of</strong> South Florida College <strong>of</strong> Medicine, 21st Century Oncology Chair in<br />

Colo<strong>rectal</strong> Surgery, Chairman Department <strong>of</strong> Colo<strong>rectal</strong> Surgery, Chief <strong>of</strong><br />

Staff, Cleveland Clinic Florida, 2950 Cleveland Clinic Boulevard, Weston, FL<br />

33331, United States<br />

George Y Wu, Pr<strong>of</strong>essor, Department <strong>of</strong> Medicine, Division <strong>of</strong> Gastroenterology-Hepatology,<br />

University <strong>of</strong> Connecticut Health Center, 263<br />

Farmington Ave, Farmington, CT 06030, United States<br />

Satoshi Yamagiwa, MD, PhD, Division <strong>of</strong> Gastroenterology and Hepatology,<br />

Niigata University Graduate School <strong>of</strong> Medical and Dental Sciences,<br />

757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan<br />

I February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

www.wjgnet.com<br />

Meetings<br />

Events Calendar 2011<br />

January 14-15, 2011<br />

AGA Clinical Congress <strong>of</strong><br />

Gastroenterology and Hepatology:<br />

Best Practices in 2011 Miami, FL<br />

33101, United States<br />

January 20-22, 2011<br />

Gastrointestinal Cancers Symposium<br />

2011, San Francisco, CA 94143,<br />

United States<br />

January 27-28, 2011<br />

Falk Workshop, Liver and<br />

Immunology, Medical University,<br />

Franz-Josef-Strauss-Allee 11, 93053<br />

Regensburg, Germany<br />

January 28-29, 2011<br />

9. Gastro Forum München, Munich,<br />

Germany<br />

February 4-5, 2011<br />

13th Duesseldorf International<br />

Endoscopy Symposium,<br />

Duesseldorf, Germany<br />

February 13-27, 2011<br />

Gastroenterology: New Zealand<br />

CME Cruise Conference, Sydney,<br />

NSW, Australia<br />

February 17-20, 2011<br />

APASL 2011-The 21st Conference <strong>of</strong><br />

the Asian Pacific Association for the<br />

Study <strong>of</strong> the Liver<br />

Bangkok, Thailand<br />

February 22, 2011-March 04, 2011<br />

Canadian Digestive Diseases Week<br />

2011, Vancouver, BC, Canada<br />

February 24-26, 2011<br />

Inflammatory Bowel Diseases<br />

2011-6th Congress <strong>of</strong> the European<br />

Crohn's and Colitis Organisation,<br />

Dublin, Ireland<br />

February 24-26, 2011<br />

2nd International Congress on<br />

Abdominal Obesity, Buenos Aires,<br />

Brazil<br />

February 24-26, 2011<br />

International Colo<strong>rectal</strong> Disease<br />

Symposium 2011, Hong Kong, China<br />

February 26-March 1, 2011<br />

Canadian Digestive Diseases Week,<br />

WJG|www.wjgnet.com<br />

Westin Bayshore, Vancouver, British<br />

Columbia, Canada<br />

February 28-March 1, 2011<br />

Childhood & Adolescent Obesity:<br />

A whole-system strategic approach,<br />

Abu Dhabi, United Arab Emirates<br />

March 3-5, 2011<br />

42nd Annual Topics in Internal<br />

Medicine, Gainesville, FL 32614,<br />

United States<br />

March 7-11, 2011<br />

Infectious Diseases: Adult Issues<br />

in the Outpatient and Inpatient<br />

Settings, Sarasota, FL 34234,<br />

United States<br />

March 14-17, 2011<br />

British Society <strong>of</strong> Gastroenterology<br />

Annual Meeting 2011, Birmingham,<br />

England, United Kingdom<br />

March 17-19, 2011<br />

41. Kongress der Deutschen<br />

Gesellschaft für Endoskopie und<br />

Bildgebende Verfahren e.V., Munich,<br />

Germany<br />

March 17-20, 2011<br />

Mayo Clinic Gastroenterology &<br />

Hepatology 2011, Jacksonville, FL<br />

34234, United States<br />

March 18, 2011<br />

UC Davis Health Informatics:<br />

Change <strong>Management</strong> and Health<br />

Informatics, The Keys to Health<br />

Reform, Sacramento, CA 94143,<br />

United States<br />

March 25-27, 2011<br />

MedicReS IC 2011 Good Medical<br />

Research, Istanbul, Turkey<br />

March 26-27, 2011<br />

26th Annual New Treatments in<br />

Chronic Liver Disease, San Diego,<br />

CA 94143, United States<br />

April 6-7, 2011<br />

IBS-A Global Perspective, Pfister<br />

Hotel, 424 East Wisconsin Avenue,<br />

Milwaukee, WI 53202, United States<br />

April 7-9, 2011<br />

International and Interdisciplinary<br />

Conference Excellence in Female<br />

Surgery, Florence, Italy<br />

April 15-16, 2011<br />

Falk Symposium 177, Endoscopy<br />

Live Berlin 2011 Intestinal Disease<br />

Meeting, Stauffenbergstr. 26, 10785<br />

Berlin, Germany<br />

April 18-22, 2011<br />

Pediatric Emergency Medicine:<br />

Detection, Diagnosis and Developing<br />

Treatment Plans, Sarasota, FL 34234,<br />

United States<br />

April 20-23, 2011<br />

9th International Gastric Cancer<br />

Congress, COEX, <strong>World</strong> Trade<br />

Center, Samseong-dong, Gangnamgu,<br />

Seoul 135-731, South Korea<br />

April 25-27, 2011<br />

The Second International Conference<br />

<strong>of</strong> the Saudi Society <strong>of</strong> Pediatric<br />

Gastroenterology, Hepatology &<br />

Nutrition, Riyadh, Saudi Arabia<br />

April 25-29, 2011<br />

Neurology Updates for Primary<br />

Care, Sarasota, FL 34230-6947,<br />

United States<br />

April 28-30, 2011<br />

4th Central European Congress <strong>of</strong><br />

Surgery, Budapest, Hungary<br />

May 7-10, 2011<br />

Digestive Disease Week, Chicago, IL<br />

60446, United States<br />

May 12-13, 2011<br />

2nd National Conference Clinical<br />

Advances in Cystic Fibrosis, London,<br />

England, United Kingdom<br />

May 19-22, 2011<br />

1st <strong>World</strong> Congress on Controversies<br />

in the <strong>Management</strong> <strong>of</strong> Viral Hepatitis<br />

(C-Hep), Palau de Congressos de<br />

Catalunya, Av. Diagonal, 661-671<br />

Barcelona 08028, Spain<br />

May 21-24, 2011<br />

22nd European Society <strong>of</strong><br />

Gastrointestinal and Abdominal<br />

Radiology Annual Meeting and<br />

Postgraduate Course, Venise, Italy<br />

May 25-28, 2011<br />

4th Congress <strong>of</strong> the Gastroenterology<br />

Association <strong>of</strong> Bosnia and<br />

Herzegovina with international<br />

participation, Hotel Holiday Inn,<br />

Sarajevo, Bosnia and Herzegovina<br />

June 11-12, 2011<br />

The International Digestive Disease<br />

Forum 2011, Hong Kong, China<br />

June 13-16, 2011<br />

Surgery and Disillusion XXIV<br />

SPIGC, II ESYS, Napoli, Italy<br />

June 14-16, 2011<br />

International Scientific Conference<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): I<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

on Probiotics and Prebiotics-<br />

IPC2011, Kosice, Slovakia<br />

June 22-25, 2011<br />

ESMO Conference: 13th <strong>World</strong><br />

Congress on Gastrointestinal Cancer,<br />

Barcelona, Spain<br />

June 29-2, 2011<br />

XI Congreso Interamericano<br />

de Pediatria "Monterrey 2011",<br />

Monterrey, Mexico<br />

September 2-3, 2011 Falk Symposium<br />

178, Diverticular Disease, A Fresh<br />

Approach to a Neglected Disease,<br />

Gürzenich Cologne, Martinstr. 29-37,<br />

50667 Cologne, Germany<br />

September 10-11, 2011<br />

New Advances in Inflammatory<br />

Bowel Disease, La Jolla, CA 92093,<br />

United States<br />

September 10-14, 2011<br />

ICE 2011-International Congress <strong>of</strong><br />

Endoscopy, Los Angeles Convention<br />

Center, 1201 South Figueroa Street<br />

Los Angeles, CA 90015,<br />

United States<br />

September 30-October 1, 2011<br />

Falk Symposium 179, Revisiting<br />

IBD <strong>Management</strong>: Dogmas to be<br />

Challenged, Sheraton Brussels<br />

Hotel, Place Rogier 3, 1210 Brussels,<br />

Belgium<br />

October 19-29, 2011<br />

Cardiology & Gastroenterology |<br />

Tahiti 10 night CME Cruise, Papeete,<br />

French Polynesia<br />

October 22-26, 2011<br />

19th United European<br />

Gastroenterology Week, Stockholm,<br />

Sweden<br />

October 28-November 2, 2011<br />

ACG Annual Scientific Meeting &<br />

Postgraduate Course, Washington,<br />

DC 20001, United States<br />

November 11-12, 2011<br />

Falk Symposium 180, IBD 2011:<br />

Progress and Future for Lifelong<br />

<strong>Management</strong>, ANA Interconti Hotel,<br />

1-12-33 Akasaka, Minato-ku, Tokyo<br />

107-0052, Japan<br />

December 1-4, 2011<br />

2011 Advances in Inflammatory<br />

Bowel Diseases/Crohn's & Colitis<br />

Foundation's Clinical & Research<br />

Conference, Hollywood, FL 34234,<br />

United States<br />

I February 21, 2011|Volume 17|Issue 7|

---

Online Submissions: http://www.wjgnet.com/1007-9327<strong>of</strong>fice<br />

wjg@wjgnet.com<br />

www.wjgnet.com<br />

Instructions to authors<br />

GENERAL INFORMATION<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology (<strong>World</strong> J Gastroenterol, WJG, print<br />

ISSN 1007-9327, online ISSN 2219-2840, DOI: 10.3748) is a<br />

weekly, open-access (OA), peer-reviewed journal supported by an<br />

editorial board <strong>of</strong> 1144 experts in gastroenterology and hepatology<br />

from 60 countries.<br />

The biggest advantage <strong>of</strong> the OA model is that it provides<br />

free, full-text articles in PDF and other formats for experts and<br />

the public without registration, which eliminates the obstacle<br />

that traditional journals possess and usually delays the speed<br />

<strong>of</strong> the propagation and communication <strong>of</strong> scientific research<br />

results. The open access model has been proven to be a true approach<br />

that may achieve the ultimate goal <strong>of</strong> the journals, i.e. the<br />

maximization <strong>of</strong> the value to the readers, authors and society.<br />

Maximization <strong>of</strong> personal benefits<br />

The role <strong>of</strong> academic journals is to exhibit the scientific levels <strong>of</strong><br />

a country, a university, a center, a department, and even a scientist,<br />

and build an important bridge for communication between scientists<br />

and the public. As we all know, the significance <strong>of</strong> the publication<br />

<strong>of</strong> scientific articles lies not only in disseminating and communicating<br />

innovative scientific achievements and academic views,<br />

as well as promoting the application <strong>of</strong> scientific achievements, but<br />

also in formally recognizing the “priority” and “copyright” <strong>of</strong> innovative<br />

achievements published, as well as evaluating research performance<br />

and academic levels. So, to realize these desired attributes<br />

<strong>of</strong> WJG and create a well-recognized journal, the following four<br />

types <strong>of</strong> personal benefits should be maximized. The maximization<br />

<strong>of</strong> personal benefits refers to the pursuit <strong>of</strong> the maximum personal<br />

benefits in a well-considered optimal manner without violation <strong>of</strong><br />

the laws, ethical rules and the benefits <strong>of</strong> others. (1) Maximization<br />

<strong>of</strong> the benefits <strong>of</strong> editorial board members: The primary task <strong>of</strong><br />

editorial board members is to give a peer review <strong>of</strong> an unpublished<br />

scientific article via online <strong>of</strong>fice system to evaluate its innovativeness,<br />

scientific and practical values and determine whether it should<br />

be published or not. During peer review, editorial board members<br />

can also obtain cutting-edge information in that field at first hand.<br />

As leaders in their field, they have priority to be invited to write<br />

articles and publish commentary articles. We will put peer reviewers’<br />

names and affiliations along with the article they reviewed in<br />

the journal to acknowledge their contribution; (2) Maximization<br />

<strong>of</strong> the benefits <strong>of</strong> authors: Since WJG is an open-access journal,<br />

readers around the world can immediately download and read, free<br />

<strong>of</strong> charge, high-quality, peer-reviewed articles from WJG <strong>of</strong>ficial<br />

website, thereby realizing the goals and significance <strong>of</strong> the communication<br />

between authors and peers as well as public reading; (3)<br />

Maximization <strong>of</strong> the benefits <strong>of</strong> readers: Readers can read or use,<br />

free <strong>of</strong> charge, high-quality peer-reviewed articles without any limits,<br />

and cite the arguments, viewpoints, concepts, theories, methods,<br />

results, conclusion or facts and data <strong>of</strong> pertinent literature so as to<br />

validate the innovativeness, scientific and practical values <strong>of</strong> their<br />

own research achievements, thus ensuring that their articles have<br />

novel arguments or viewpoints, solid evidence and correct conclu-<br />

WJG|www.wjgnet.com<br />

<strong>World</strong> J Gastroenterol 2011 February 21; 17(7): I-VI<br />

ISSN 1007-9327 (print) ISSN 2219-2840 (online)<br />

© 2011 Baishideng. All rights reserved.<br />

sion; and (4) Maximization <strong>of</strong> the benefits <strong>of</strong> employees: It is an<br />

iron law that a first-class journal is unable to exist without first-class<br />

editors, and only first-class editors can create a first-class academic<br />

journal. We insist on strengthening our team cultivation and construction<br />

so that every employee, in an open, fair and transparent<br />

environment, could contribute their wisdom to edit and publish<br />

high-quality articles, thereby realizing the maximization <strong>of</strong> the<br />

personal benefits <strong>of</strong> editorial board members, authors and readers,<br />

and yielding the greatest social and economic benefits.<br />

Aims and scope<br />

The major task <strong>of</strong> WJG is to report rapidly the most recent results<br />

in basic and clinical research on esophageal, gastrointestinal,<br />

liver, pancreas and biliary tract diseases, Helicobacter pylori, endoscopy<br />

and gastrointestinal surgery, including: gastroesophageal<br />

reflux disease, gastrointestinal bleeding, infection and tumors;<br />

gastric and duodenal disorders; intestinal inflammation, micr<strong>of</strong>lora<br />

and immunity; celiac disease, dyspepsia and nutrition; viral<br />

hepatitis, portal hypertension, liver fibrosis, liver cirrhosis, liver<br />

transplantation, and metabolic liver disease; molecular and cell<br />

biology; geriatric and pediatric gastroenterology; diagnosis and<br />

screening, imaging and advanced technology.<br />

Columns<br />

The columns in the issues <strong>of</strong> WJG will include: (1) Editorial: To<br />

introduce and comment on major advances and developments in<br />

the field; (2) Frontier: To review representative achievements, comment<br />

on the state <strong>of</strong> current research, and propose directions for<br />

future research; (3) Topic Highlight: This column consists <strong>of</strong> three<br />

formats, including (A) 10 invited review articles on a hot topic, (B)<br />

a commentary on common issues <strong>of</strong> this hot topic, and (C) a commentary<br />

on the 10 individual articles; (4) Observation: To update<br />

the development <strong>of</strong> old and new questions, highlight unsolved<br />

problems, and provide strategies on how to solve the questions;<br />

(5) Guidelines for Basic Research: To provide guidelines for basic<br />

research; (6) Guidelines for Clinical Practice: To provide guidelines<br />

for clinical diagnosis and treatment; (7) Review: To review systemically<br />

progress and unresolved problems in the field, comment<br />

on the state <strong>of</strong> current research, and make suggestions for future<br />

work; (8) Original Article: To report innovative and original findings<br />

in gastroenterology; (9) Brief Article: To briefly report the<br />

novel and innovative findings in gastroenterology and hepatology;<br />

(10) Case Report: To report a rare or typical case; (11) Letters to the<br />

Editor: To discuss and make reply to the contributions published<br />

in WJG, or to introduce and comment on a controversial issue <strong>of</strong><br />

general interest; (12) Book Reviews: To introduce and comment on<br />

quality monographs <strong>of</strong> gastroenterology and hepatology; and (13)<br />

Guidelines: To introduce consensuses and guidelines reached by<br />

international and national academic authorities worldwide on basic<br />

research and clinical practice gastroenterology and hepatology.<br />

Name <strong>of</strong> journal<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Serial publication number<br />

ISSN 1007-9327 (print)<br />

ISSN 2219-2840 (online)<br />

I February 21, 2011|Volume 17|Issue 7|

---

Instructions to authors<br />

Indexed and Abstracted in<br />

Current Contents ® /Clinical Medicine, Science Citation Index<br />

Expanded (also known as SciSearch ® ), <strong>Journal</strong> Citation Reports ® ,<br />

Index Medicus, MEDLINE, PubMed, PubMed Central, and<br />

Digital Object Identifer. ISI, Thomson Reuters, 2009 Impact<br />

Factor: 2.092 (33/65 Gastroenterology and Hepatology).<br />

Published by<br />

Baishideng Publishing Group Co., Limited<br />

SPECIAL STATEMENT<br />

All articles published in this journal represent the viewpoints<br />

<strong>of</strong> the authors except where indicated otherwise.<br />

Biostatistical editing<br />

Statisital review is performed after peer review. We invite an<br />

expert in Biomedical Statistics from to evaluate the statistical<br />

method used in the paper, including t-test (group or paired comparisons),<br />

chi-squared test, Ridit, probit, logit, regression (linear,<br />

curvilinear, or stepwise), correlation, analysis <strong>of</strong> variance, analysis<br />

<strong>of</strong> covariance, etc. The reviewing points include: (1) Statistical<br />

methods should be described when they are used to verify the results;<br />

(2) Whether the statistical techniques are suitable or correct;<br />

(3) Only homogeneous data can be averaged. Standard deviations<br />

are preferred to standard errors. Give the number <strong>of</strong> observations<br />

and subjects (n). Losses in observations, such as drop-outs<br />

from the study should be reported; (4) Values such as ED50,<br />

LD50, IC50 should have their 95% confidence limits calculated<br />

and compared by weighted probit analysis (Bliss and Finney); and<br />

(5) The word ‘significantly’ should be replaced by its synonyms (if<br />

it indicates extent) or the P value (if it indicates statistical significance).<br />

Conflict-<strong>of</strong>-interest statement<br />

In the interests <strong>of</strong> transparency and to help reviewers assess<br />

any potential bias, WJG requires authors <strong>of</strong> all papers to declare<br />

any competing commercial, personal, political, intellectual, or<br />

religious interests in relation to the submitted work. Referees<br />

are also asked to indicate any potential conflict they might have<br />

reviewing a particular paper. Before submitting, authors are suggested<br />

to read “Uniform Requirements for Manuscripts Submitted<br />

to Biomedical <strong>Journal</strong>s: Ethical Considerations in the Conduct<br />

and Reporting <strong>of</strong> Research: Conflicts <strong>of</strong> Interest” from<br />

International Committee <strong>of</strong> Medical <strong>Journal</strong> Editors (ICMJE),<br />

which is available at: http://www.icmje.org/ethical_4conflicts.<br />

html.<br />

Sample wording: [Name <strong>of</strong> individual] has received fees for<br />

serving as a speaker, a consultant and an advisory board member<br />

for [names <strong>of</strong> organizations], and has received research funding<br />

from [names <strong>of</strong> organization]. [Name <strong>of</strong> individual] is an employee<br />

<strong>of</strong> [name <strong>of</strong> organization]. [Name <strong>of</strong> individual] owns stocks<br />

and shares in [name <strong>of</strong> organization]. [Name <strong>of</strong> individual] owns<br />

patent [patent identification and brief description].<br />

Statement <strong>of</strong> informed consent<br />

Manuscripts should contain a statement to the effect that all human<br />

studies have been reviewed by the appropriate ethics committee<br />

or it should be stated clearly in the text that all persons<br />

gave their informed consent prior to their inclusion in the study.<br />

Details that might disclose the identity <strong>of</strong> the subjects under<br />

study should be omitted. Authors should also draw attention to<br />

the Code <strong>of</strong> Ethics <strong>of</strong> the <strong>World</strong> Medical Association (Declaration<br />

<strong>of</strong> Helsinki, 1964, as revised in 2004).<br />

WJG|www.wjgnet.com<br />

Statement <strong>of</strong> human and animal rights<br />

When reporting the results from experiments, authors should<br />

follow the highest standards and the trial should conform to<br />

Good Clinical Practice (for example, US Food and Drug Administration<br />

Good Clinical Practice in FDA-Regulated Clinical Trials;<br />

UK Medicines Research Council Guidelines for Good Clinical<br />

Practice in Clinical Trials) and/or the <strong>World</strong> Medical Association<br />

Declaration <strong>of</strong> Helsinki. Generally, we suggest authors follow<br />

the lead investigator’s national standard. If doubt exists whether<br />

the research was conducted in accordance with the above standards,<br />

the authors must explain the rationale for their approach<br />

and demonstrate that the institutional review body explicitly approved<br />

the doubtful aspects <strong>of</strong> the study.<br />

Before submitting, authors should make their study approved<br />

by the relevant research ethics committee or institutional<br />

review board. If human participants were involved, manuscripts<br />

must be accompanied by a statement that the experiments were<br />

undertaken with the understanding and appropriate informed<br />

consent <strong>of</strong> each. Any personal item or information will not be<br />

published without explicit consents from the involved patients.<br />

If experimental animals were used, the materials and methods<br />

(experimental procedures) section must clearly indicate that appropriate<br />

measures were taken to minimize pain or discomfort,<br />

and details <strong>of</strong> animal care should be provided.<br />

SUBMISSION OF MANUSCRIPTS<br />

Manuscripts should be typed in 1.5 line spacing and 12 pt. Book<br />

Antiqua with ample margins. Number all pages consecutively,<br />

and start each <strong>of</strong> the following sections on a new page: Title<br />

Page, Abstract, Introduction, Materials and Methods, Results,<br />

Discussion, Acknowledgements, References, Tables, Figures,<br />

and Figure Legends. Neither the editors nor the publisher are<br />

responsible for the opinions expressed by contributors. Manuscripts<br />

formally accepted for publication become the permanent<br />

property <strong>of</strong> Baishideng Publishing Group Co., Limited, and may<br />

not be reproduced by any means, in whole or in part, without the<br />

written permission <strong>of</strong> both the authors and the publisher. We<br />

reserve the right to copy-edit and put onto our website accepted<br />

manuscripts. Authors should follow the relevant guidelines for<br />

the care and use <strong>of</strong> laboratory animals <strong>of</strong> their institution or<br />

national animal welfare committee. For the sake <strong>of</strong> transparency<br />

in regard to the performance and reporting <strong>of</strong> clinical trials, we<br />

endorse the policy <strong>of</strong> the ICMJE to refuse to publish papers<br />

on clinical trial results if the trial was not recorded in a publiclyaccessible<br />

registry at its outset. The only register now available, to<br />

our knowledge, is http://www.clinicaltrials.gov sponsored by the<br />

United States National Library <strong>of</strong> Medicine and we encourage<br />

all potential contributors to register with it. However, in the case<br />

that other registers become available you will be duly notified.<br />

A letter <strong>of</strong> recommendation from each author’s organization<br />

should be provided with the contributed article to ensure the privacy<br />

and secrecy <strong>of</strong> research is protected.<br />

Authors should retain one copy <strong>of</strong> the text, tables, photographs<br />

and illustrations because rejected manuscripts will not be<br />

returned to the author(s) and the editors will not be responsible<br />

for loss or damage to photographs and illustrations sustained<br />

during mailing.<br />

Online submissions<br />

Manuscripts should be submitted through the Online Submission<br />

System at: http://www.wjgnet.com/1007-9327<strong>of</strong>fice. Authors<br />

are highly recommended to consult the ONLINE INSTRUC-<br />

TIONS TO AUTHORS (http://www.wjgnet.com/1007-9327/<br />

g_info_20100315215714.htm) before attempting to submit on-<br />

II February 21, 2011|Volume 17|Issue 7|

---

line. For assistance, authors encountering problems with the Online<br />

Submission System may send an email describing the problem<br />

to wjg@wjgnet.com, or by telephone: +86-10-5908-0039. If<br />

you submit your manuscript online, do not make a postal contribution.<br />

Repeated online submission for the same manuscript is<br />

strictly prohibited.<br />

MANUSCRIPT PREPARATION<br />

All contributions should be written in English. All articles must be<br />

submitted using word-processing s<strong>of</strong>tware. All submissions must<br />

be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample<br />

margins. Style should conform to our house format. Required information<br />

for each <strong>of</strong> the manuscript sections is as follows:<br />

Title page<br />

Title: Title should be less than 12 words.<br />

Running title: A short running title <strong>of</strong> less than 6 words should<br />

be provided.<br />

Authorship: Authorship credit should be in accordance with the<br />

standard proposed by ICMJE, based on (1) substantial contributions<br />

to conception and design, acquisition <strong>of</strong> data, or analysis and<br />

interpretation <strong>of</strong> data; (2) drafting the article or revising it critically<br />

for important intellectual content; and (3) final approval <strong>of</strong> the<br />

version to be published. Authors should meet conditions 1, 2, and 3.<br />

Institution: Author names should be given first, then the complete<br />

name <strong>of</strong> institution, city, province and postcode. For example,<br />

Xu-Chen Zhang, Li-Xin Mei, Department <strong>of</strong> Pathology,<br />

Chengde Medical College, Chengde 067000, Hebei Province,<br />

China. One author may be represented from two institutions,<br />

for example, George Sgourakis, Department <strong>of</strong> General, Visceral,<br />

and Transplantation Surgery, Essen 45122, Germany; George<br />

Sgourakis, 2nd Surgical Department, Korgialenio-Benakio Red<br />

Cross Hospital, Athens 15451, Greece.<br />

Author contributions: The format <strong>of</strong> this section should be:<br />

Author contributions: Wang CL and Liang L contributed equally<br />

to this work; Wang CL, Liang L, Fu JF, Zou CC, Hong F and Wu<br />

XM designed the research; Wang CL, Zou CC, Hong F and Wu<br />

XM performed the research; Xue JZ and Lu JR contributed new<br />

reagents/analytic tools; Wang CL, Liang L and Fu JF analyzed the<br />

data; and Wang CL, Liang L and Fu JF wrote the paper.<br />

Supportive foundations: The complete name and number <strong>of</strong><br />

supportive foundations should be provided, e.g. Supported by<br />

National Natural Science Foundation <strong>of</strong> China, No. 30224801<br />

Correspondence to: Only one corresponding address should be<br />

provided. Author names should be given first, then author title,<br />

affiliation, the complete name <strong>of</strong> institution, city, postcode, province,<br />

country, and email. All the letters in the email should be in<br />

lower case. A space interval should be inserted between country<br />

name and email address. For example, Montgomery Bissell, MD,<br />

Pr<strong>of</strong>essor <strong>of</strong> Medicine, Chief, Liver Center, Gastroenterology<br />

Division, University <strong>of</strong> California, Box 0538, San Francisco, CA<br />

94143, United States. montgomery.bissell@ucsf.edu<br />

Telephone and fax: Telephone and fax should consist <strong>of</strong> +,<br />

country number, district number and telephone or fax number,<br />

e.g. Telephone: +86-10-59080039 Fax: +86-10-85381893<br />

Peer reviewers: All articles received are subject to peer review.<br />

WJG|www.wjgnet.com<br />

Instructions to authors<br />

Normally, three experts are invited for each article. Decision for<br />

acceptance is made only when at least two experts recommend<br />

an article for publication. Reviewers for accepted manuscripts<br />

are acknowledged in each manuscript, and reviewers <strong>of</strong> articles<br />

which were not accepted will be acknowledged at the end <strong>of</strong><br />

each issue. To ensure the quality <strong>of</strong> the articles published in WJG,<br />

reviewers <strong>of</strong> accepted manuscripts will be announced by publishing<br />

the name, title/position and institution <strong>of</strong> the reviewer in the<br />

footnote accompanying the printed article. For example, reviewers:<br />

Pr<strong>of</strong>essor Jing-Yuan Fang, Shanghai Institute <strong>of</strong> Digestive<br />

Disease, Shanghai, Affiliated Renji Hospital, Medical Faculty,<br />

Shanghai Jiaotong University, Shanghai, China; Pr<strong>of</strong>essor Xin-<br />

Wei Han, Department <strong>of</strong> Radiology, The First Affiliated Hospital,<br />

Zhengzhou University, Zhengzhou, Henan Province, China; and<br />

Pr<strong>of</strong>essor Anren Kuang, Department <strong>of</strong> Nuclear Medicine, Huaxi<br />

Hospital, Sichuan University, Chengdu, Sichuan Province, China.<br />

Abstract<br />

There are unstructured abstracts (no more than 256 words)<br />

and structured abstracts (no more than 480). The specific requirements<br />

for structured abstracts are as follows:<br />

An informative, structured abstracts <strong>of</strong> no more than 480<br />

words should accompany each manuscript. Abstracts for original<br />

contributions should be structured into the following sections.<br />

AIM (no more than 20 words): Only the purpose should be<br />

included. Please write the aim as the form <strong>of</strong> “To investigate/<br />

study/…”; MATERIALS AND METHODS (no more than<br />

140 words); RESULTS (no more than 294 words): You should<br />

present P values where appropriate and must provide relevant<br />

data to illustrate how they were obtained, e.g. 6.92 ± 3.86 vs 3.61<br />

± 1.67, P < 0.001; CONCLUSION (no more than 26 words).<br />

Key words<br />

Please list 5-10 key words, selected mainly from Index Medicus,<br />

which reflect the content <strong>of</strong> the study.<br />

Text<br />

For articles <strong>of</strong> these sections, original articles and brief articles,<br />

the main text should be structured into the following sections:<br />

INTRODUCTION, MATERIALS AND METHODS,<br />

RESULTS and DISCUSSION, and should include appropriate<br />

Figures and Tables. Data should be presented in the main<br />

text or in Figures and Tables, but not in both. The main text<br />

format <strong>of</strong> these sections, editorial, topic highlight, case report,<br />

letters to the editors, can be found at: http://www.wjgnet.<br />

com/1007-9327/g_info_20100315215714.htm.<br />

Illustrations<br />

Figures should be numbered as 1, 2, 3, etc., and mentioned clearly<br />

in the main text. Provide a brief title for each figure on a separate<br />

page. Detailed legends should not be provided under the<br />

figures. This part should be added into the text where the figures<br />

are applicable. Figures should be either Photoshop or Illustrator<br />

files (in tiff, eps, jpeg formats) at high-resolution. Examples<br />

can be found at: http://www.wjgnet.com/1007-9327/13/4520.<br />

pdf; http://www.wjgnet.com/1007-9327/13/4554.pdf;<br />

http://www.wjgnet.com/1007-9327/13/4891.pdf; http://<br />

www.wjgnet.com/1007-9327/13/4986.pdf; http://www.<br />

wjgnet.com/1007-9327/13/4498.pdf. Keeping all elements<br />

compiled is necessary in line-art image. Scale bars should be<br />

used rather than magnification factors, with the length <strong>of</strong><br />

the bar defined in the legend rather than on the bar itself.<br />

File names should identify the figure and panel. Avoid layering<br />

type directly over shaded or textured areas. Please use<br />

III February 21, 2011|Volume 17|Issue 7|

---

Instructions to authors<br />

uniform legends for the same subjects. For example: Figure 1<br />

Pathological changes in atrophic gastritis after treatment. A:...;<br />

B:...; C:...; D:...; E:...; F:...; G: …etc. It is our principle to publish<br />

high resolution-figures for the printed and E-versions.<br />

Tables<br />

Three-line tables should be numbered 1, 2, 3, etc., and mentioned<br />

clearly in the main text. Provide a brief title for each<br />

table. Detailed legends should not be included under tables,<br />

but rather added into the text where applicable. The information<br />

should complement, but not duplicate the text. Use one<br />

horizontal line under the title, a second under column heads,<br />

and a third below the Table, above any footnotes. Vertical and<br />

italic lines should be omitted.<br />

Notes in tables and illustrations<br />

Data that are not statistically significant should not be noted.<br />

a P < 0.05, b P < 0.01 should be noted (P > 0.05 should not be<br />

noted). If there are other series <strong>of</strong> P values, c P < 0.05 and d P<br />

< 0.01 are used. A third series <strong>of</strong> P values can be expressed as<br />

e P < 0.05 and f P < 0.01. Other notes in tables or under illustrations<br />

should be expressed as 1 F, 2 F, 3 F; or sometimes as other<br />

symbols with a superscript (Arabic numerals) in the upper left<br />

corner. In a multi-curve illustration, each curve should be labeled<br />

with ●, ○, ■, □, ▲, △, etc., in a certain sequence.<br />

Acknowledgments<br />

Brief acknowledgments <strong>of</strong> persons who have made genuine<br />

contributions to the manuscript and who endorse the data and<br />

conclusions should be included. Authors are responsible for<br />

obtaining written permission to use any copyrighted text and/or<br />

illustrations.<br />

REFERENCES<br />

Coding system<br />

The author should number the references in Arabic numerals according<br />

to the citation order in the text. Put reference numbers<br />

in square brackets in superscript at the end <strong>of</strong> citation content or<br />

after the cited author’s name. For citation content which is part <strong>of</strong><br />

the narration, the coding number and square brackets should be<br />

typeset normally. For example, “Crohn’s disease (CD) is associated<br />

with increased intestinal permeability [1,2] ”. If references are cited<br />

directly in the text, they should be put together within the text, for<br />

example, “From references [19,22-24] , we know that...”.<br />

When the authors write the references, please ensure that<br />

the order in text is the same as in the references section, and also<br />

ensure the spelling accuracy <strong>of</strong> the first author’s name. Do not list<br />

the same citation twice.<br />

PMID and DOI<br />

Pleased provide PubMed citation numbers to the reference list,<br />

e.g. PMID and DOI, which can be found at http://www.ncbi.<br />

nlm.nih.gov/sites/entrez?db=pubmed and http://www.crossref.org/SimpleTextQuery/,<br />

respectively. The numbers will be<br />

used in E-version <strong>of</strong> this journal.<br />

Style for journal references<br />

Authors: the name <strong>of</strong> the first author should be typed in boldfaced<br />

letters. The family name <strong>of</strong> all authors should be typed<br />

with the initial letter capitalized, followed by their abbreviated<br />

first and middle initials. (For example, Lian-Sheng Ma is abbreviated<br />

as Ma LS, Bo-Rong Pan as Pan BR). The title <strong>of</strong> the<br />

cited article and italicized journal title (journal title should be<br />

in its abbreviated form as shown in PubMed), publication date,<br />

WJG|www.wjgnet.com<br />

volume number (in black), start page, and end page [PMID:<br />

11819634 DOI: 10.3748/wjg.13.5396].<br />

Style for book references<br />

Authors: the name <strong>of</strong> the first author should be typed in boldfaced<br />

letters. The surname <strong>of</strong> all authors should be typed with the<br />

initial letter capitalized, followed by their abbreviated middle and<br />

first initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS,<br />

Bo-Rong Pan as Pan BR) Book title. Publication number. Publication<br />

place: Publication press, Year: start page and end page.<br />

Format<br />

<strong>Journal</strong>s<br />

English journal article (list all authors and include the PMID where applicable)<br />

1 Jung EM, Clevert DA, Schreyer AG, Schmitt S, Rennert J,<br />

Kubale R, Feuerbach S, Jung F. Evaluation <strong>of</strong> quantitative<br />

contrast harmonic imaging to assess malignancy <strong>of</strong> liver<br />

tumors: A prospective controlled two-center study. <strong>World</strong> J<br />

Gastroenterol 2007; 13: 6356-6364 [PMID: 18081224 DOI:<br />

10.3748/wjg.13.6356]<br />

Chinese journal article (list all authors and include the PMID where applicable)<br />

2 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunologic<br />

effect <strong>of</strong> Jianpi Yishen decoction in treatment <strong>of</strong> Pixudiarrhoea.<br />

Shijie Huaren Xiaohua Zazhi 1999; 7: 285-287<br />

In press<br />

3 Tian D, Araki H, Stahl E, Bergelson J, Kreitman M.<br />

Signature <strong>of</strong> balancing selection in Arabidopsis. Proc Natl<br />

Acad Sci USA 2006; In press<br />

Organization as author<br />

4 Diabetes Prevention Program Research Group. Hypertension,<br />

insulin, and proinsulin in participants with impaired<br />

glucose tolerance. Hypertension 2002; 40: 679-686 [PMID:<br />

12411462 PMCID:2516377 DOI:10.1161/01.HYP.00000<br />

35706.28494.09]<br />

Both personal authors and an organization as author<br />

5 Vallancien G, Emberton M, Harving N, van Moorselaar<br />

RJ; Alf-One Study Group. Sexual dysfunction in 1,<br />

274 European men suffering from lower urinary tract<br />

symptoms. J Urol 2003; 169: 2257-2261 [PMID: 12771764<br />

DOI:10.1097/01.ju.0000067940.76090.73]<br />

No author given<br />

6 21st century heart solution may have a sting in the tail. BMJ<br />

2002; 325: 184 [PMID: 12142303 DOI:10.1136/bmj.325.<br />

7357.184]<br />

Volume with supplement<br />

7 Geraud G, Spierings EL, Keywood C. Tolerability and<br />

safety <strong>of</strong> frovatriptan with short- and long-term use for<br />

treatment <strong>of</strong> migraine and in comparison with sumatriptan.<br />

Headache 2002; 42 Suppl 2: S93-99 [PMID: 12028325<br />

DOI:10.1046/j.1526-4610.42.s2.7.x]<br />

Issue with no volume<br />

8 Banit DM, Kaufer H, Hartford JM. Intraoperative frozen<br />

section analysis in revision total joint arthroplasty. Clin<br />

Orthop Relat Res 2002; (401): 230-238 [PMID: 12151900<br />

DOI:10.1097/00003086-200208000-00026]<br />

No volume or issue<br />

9 Outreach: Bringing HIV-positive individuals into care.<br />

HRSA Careaction 2002; 1-6 [PMID: 12154804]<br />

Books<br />

Personal author(s)<br />

10 Sherlock S, Dooley J. Diseases <strong>of</strong> the liver and billiary<br />

system. 9th ed. Oxford: Blackwell Sci Pub, 1993: 258-296<br />

IV February 21, 2011|Volume 17|Issue 7|

---

Chapter in a book (list all authors)<br />

11 Lam SK. Academic investigator’s perspectives <strong>of</strong> medical<br />

treatment for peptic ulcer. In: Swabb EA, Azabo S. Ulcer<br />

disease: investigation and basis for therapy. New York:<br />

Marcel Dekker, 1991: 431-450<br />

Author(s) and editor(s)<br />

12 Breedlove GK, Schorfheide AM. Adolescent pregnancy.<br />

2nd ed. Wieczorek RR, editor. White Plains (NY): March<br />

<strong>of</strong> Dimes Education Services, 2001: 20-34<br />

Conference proceedings<br />

13 Harnden P, J<strong>of</strong>fe JK, Jones WG, editors. Germ cell tumours<br />

V. Proceedings <strong>of</strong> the 5th Germ cell tumours Conference;<br />

2001 Sep 13-15; Leeds, UK. New York: Springer,<br />

2002: 30-56<br />

Conference paper<br />

14 Christensen S, Oppacher F. An analysis <strong>of</strong> Koza’s computational<br />

effort statistic for genetic programming. In: Foster<br />

JA, Lutton E, Miller J, Ryan C, Tettamanzi AG, editors. Genetic<br />

programming. EuroGP 2002: Proceedings <strong>of</strong> the 5th<br />

European Conference on Genetic Programming; 2002 Apr<br />

3-5; Kinsdale, Ireland. Berlin: Springer, 2002: 182-191<br />

Electronic journal (list all authors)<br />

15 Morse SS. Factors in the emergence <strong>of</strong> infectious diseases.<br />

Emerg Infect Dis serial online, 1995-01-03, cited<br />

1996-06-05; 1(1): 24 screens. Available from: URL: http://<br />

www.cdc.gov/ncidod/eid/index.htm<br />

Patent (list all authors)<br />

16 Pagedas AC, inventor; Ancel Surgical R&D Inc., assignee.<br />

Flexible endoscopic grasping and cutting device<br />

and positioning tool assembly. United States patent US<br />

20020103498. 2002 Aug 1<br />

Statistical data<br />

Write as mean ± SD or mean ± SE.<br />

Statistical expression<br />

Express t test as t (in italics), F test as F (in italics), chi square test<br />

as χ 2 (in Greek), related coefficient as r (in italics), degree <strong>of</strong> freedom<br />

as υ (in Greek), sample number as n (in italics), and probability<br />

as P (in italics).<br />

Units<br />

Use SI units. For example: body mass, m (B) = 78 kg; blood pressure,<br />

p (B) = 16.2/12.3 kPa; incubation time, t (incubation) = 96 h,<br />

blood glucose concentration, c (glucose) 6.4 ± 2.1 mmol/L; blood<br />

CEA mass concentration, p (CEA) = 8.6 24.5 mg/L; CO 2 volume<br />

fraction, 50 mL/L CO 2, not 5% CO 2; likewise for 40 g/L formaldehyde,<br />

not 10% formalin; and mass fraction, 8 ng/g, etc. Arabic<br />

numerals such as 23, 243, 641 should be read 23 243 641.<br />

The format for how to accurately write common units and<br />

quantums can be found at: http://www.wjgnet.com/1007-9327/<br />

g_info_20100315223018.htm.<br />

Abbreviations<br />

Standard abbreviations should be defined in the abstract and<br />

on first mention in the text. In general, terms should not be abbreviated<br />

unless they are used repeatedly and the abbreviation<br />

is helpful to the reader. Permissible abbreviations are listed in<br />

Units, Symbols and Abbreviations: A Guide for Biological and<br />

Medical Editors and Authors (Ed. Baron DN, 1988) published<br />

by The Royal Society <strong>of</strong> Medicine, London. Certain commonly<br />

used abbreviations, such as DNA, RNA, HIV, LD50, PCR,<br />

HBV, ECG, WBC, RBC, CT, ESR, CSF, IgG, ELISA, PBS, ATP,<br />

EDTA, mAb, can be used directly without further explanation.<br />

WJG|www.wjgnet.com<br />

Italics<br />

Quantities: t time or temperature, c concentration, A area, l length,<br />

m mass, V volume.<br />

Genotypes: gyrA, arg 1, c myc, c fos, etc.<br />

Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc.<br />

Biology: H. pylori, E coli, etc.<br />

Examples for paper writing<br />

Editorial: http://www.wjgnet.com/1007-9327/g_info_20100315<br />

220036.htm<br />

Frontier: http://www.wjgnet.com/1007-9327/g_info_20100315<br />

220305.htm<br />

Topic highlight: http://www.wjgnet.com/1007-9327/g_info_20<br />

100315220601.htm<br />

Observation: http://www.wjgnet.com/1007-9327/g_info_201003<br />

12232427.htm<br />

Guidelines for basic research: http://www.wjgnet.com/1007-93<br />

27/g_info_20100315220730.htm<br />

Guidelines for clinical practice: http://www.wjgnet.com/1007-<br />

9327/g_info_20100315221301.htm<br />

Review: http://www.wjgnet.com/1007-9327/g_info_20100315<br />

221554.htm<br />

Original articles: http://www.wjgnet.com/1007-9327/g_info_20<br />

100315221814.htm<br />

Brief articles: http://www.wjgnet.com/1007-9327/g_info_2010<br />

0312231400.htm<br />

Case report: http://www.wjgnet.com/1007-9327/g_info_2010<br />

0315221946.htm<br />

Letters to the editor: http://www.wjgnet.com/1007-9327/g_info_<br />

20100315222254.htm<br />

Book reviews: http://www.wjgnet.com/1007-9327/g_info_2010<br />

0312231947.htm<br />

Guidelines: http://www.wjgnet.com/1007-9327/g_info_2010<br />

0312232134.htm<br />

RESUBMISSION OF THE REVISED<br />

MANUSCRIPTS<br />

Please revise your article according to the revision policies <strong>of</strong><br />

WJG. The revised version includes manuscript and high-resolution<br />

image figures. The author should re-submit the revised<br />

manuscript online, along with printed high-resolution color or<br />

black and white photos; Copyright transfer letter, and responses<br />

to the reviewers, and science news are sent to us via email.<br />

Editorial Office<br />

<strong>World</strong> <strong>Journal</strong> <strong>of</strong> Gastroenterology<br />

Editorial Department: Room 903, Building D,<br />

Ocean International Center,<br />

No. 62 Dongsihuan Zhonglu,<br />

Chaoyang District, Beijing 100025, China<br />

E-mail: wjg@wjgnet.com<br />

http://www.wjgnet.com<br />

Telephone: +86-10-5908-0039<br />

Fax: +86-10-85381893<br />

Instructions to authors<br />

V February 21, 2011|Volume 17|Issue 7|

---

Instructions to authors<br />

Language evaluation<br />

The language <strong>of</strong> a manuscript will be graded before it is sent for<br />

revision. (1) Grade A: priority publishing; (2) Grade B: minor<br />

language polishing; (3) Grade C: a great deal <strong>of</strong> language polishing<br />

needed; and (4) Grade D: rejected. Revised articles should<br />

reach Grade A or B.<br />

Copyright assignment form<br />

Please download a Copyright assignment form from http://<br />

www.wjgnet.com/1007-9327/g_info_20100315222818.htm.<br />

Responses to reviewers<br />

Please revise your article according to the comments/suggestions<br />

provided by the reviewers. The format for responses to<br />

the reviewers’ comments can be found at: http://www.wjgnet.<br />

com/1007-9327/g_info_20100315222607.htm.<br />

Pro<strong>of</strong> <strong>of</strong> financial support<br />

For paper supported by a foundation, authors should provide<br />

a copy <strong>of</strong> the document and serial number <strong>of</strong> the foundation.<br />

Links to documents related to the manuscript<br />

WJG will be initiating a platform to promote dynamic interac-<br />

WJG|www.wjgnet.com<br />

tions between the editors, peer reviewers, readers and authors.<br />

After a manuscript is published online, links to the PDF version<br />

<strong>of</strong> the submitted manuscript, the peer-reviewers’ report and the<br />

revised manuscript will be put on-line. Readers can make comments<br />

on the peer reviewer’s report, authors’ responses to peer<br />

reviewers, and the revised manuscript. We hope that authors will<br />

benefit from this feedback and be able to revise the manuscript<br />

accordingly in a timely manner.<br />

Science news releases<br />

Authors <strong>of</strong> accepted manuscripts are suggested to write a science<br />

news item to promote their articles. The news will be<br />

released rapidly at EurekAlert/AAAS (http://www.eurekalert.<br />

org). The title for news items should be less than 90 characters;<br />

the summary should be less than 75 words; and main body less<br />

than 500 words. Science news items should be lawful, ethical,<br />

and strictly based on your original content with an attractive title<br />

and interesting pictures.<br />

Publication fee<br />

Authors <strong>of</strong> accepted articles must pay a publication fee.<br />

EDITORIAL, TOPIC HIGHLIGHTS, BOOK REVIEWS and<br />

LETTERS TO THE EDITOR are published free <strong>of</strong> charge.<br />

VI February 21, 2011|Volume 17|Issue 7|