Transplantation Immunology.pdf - E-Lib FK UWKS

METHODS IN MOLECULAR BIOLOGY 333 

Transplantation 

Immunology 

Methods and and Protocols 

Edited by 

Philip Hornick 

Marlene Rose

Transplantation Immunology

M E T H O D S I N M O L E C U L A R B I O L O G Y 

352. Protein Engineering Protocols, edited by Kristian 

Müller and Katja Arndt, 2006 

351. C. elegans: Methods and Applications, edited by 

Kevin Strange, 2006 

350. Protein Folding Protocols, edited by Yawen Bai 

and Ruth Nussinov 2006 

349. YAC Protocols, Second Edition, edited by Alasdair 

MacKenzie, 2006 

348. Nuclear Transfer Protocols: Cell Reprogramming 

and Transgenesis, edited by Paul J. Verma and Alan 

Trounson, 2006 

347. Glycobiology Protocols, edited by Inka 

Brockhausen-Schutzbach, 2006 

346. Dictyostelium discoideum Protocols, edited by 

Ludwig Eichinger and Francisco Rivero-Crespo, 2006 

345. Diagnostic Bacteriology Protocols, Second Edition, 

edited by Louise O'Connor, 2006 

344. Agrobacterium Protocols, Second Edition: 

Volume 2, edited by Kan Wang, 2006 

343. Agrobacterium Protocols, Second Edition: 

Volume 1, edited by Kan Wang, 2006 

342. MicroRNA Protocols, edited by Shao-Yao Ying, 

2006 

341. Cell–Cell Interactions: Methods and Protocols, 

edited by Sean P. Colgan, 2006 

340. Protein Design: Methods and Applications, 

edited by Raphael Guerois and Manuela López de la 

Paz, 2006 

339. Microchip Capillary Electrophoresis: Methods 

and Protocols, edited by Charles Henry, 2006 

338. Gene Mapping, Discovery, and Expression: 

Methods and Protocols, edited by M. Bina, 2006 

337. Ion Channels: Methods and Protocols, edited by 

J. D. Stockand and Mark S. Shapiro, 2006 

336. Clinical Applications of PCR: Second Edition, 

edited by Y. M. Dennis Lo, Rossa W. K. Chiu, and K. C. 

Allen Chan, 2006 

335. Fluorescent Energy Transfer Nucleic Acid 

Probes: Designs and Protocols, edited by Vladimir 

V. Didenko, 2006 

334. PRINS and In Situ PCR Protocols: Second 

Edition, edited by Franck Pellestor, 2006 

333. Transplantation Immunology: Methods and 

Protocols, edited by Philip Hornick and Marlene 

Rose, 2006 

332. Transmembrane Signaling Protocols: Second 

Edition, edited by Hydar ali and Haribabu Bodduluri, 

2006 

331. Human Embryonic Stem Cell Protocols, edited by 

Kursad Turksen, 2006 

330. Embryonic Stem Cell Protocols, Second Edition, 

Vol. II: Differentiation Models, edited by Kursad 

Turksen, 2006 

329.Embryonic Stem Cell Protocols, Second Edition, 

Vol. I: Isolation and Characterization, edited by 

Kursad Turksen, 2006 

John M. Walker, SERIES EDITOR 

328. New and Emerging Proteomic Techniques, edited 

by Dobrin Nedelkov and Randall W. Nelson, 2006 

327. Epidermal Growth Factor: Methods and Protocols, 

edited by Tarun B. Patel and Paul J. Bertics, 2006 

326. In Situ Hybridization Protocols, ThirdEdition, 

edited by Ian A. Darby and Tim D. Hewitson, 2006 

325. Nuclear Reprogramming: Methods and Protocols, 

edited by Steve Pells, 2006 

324. Hormone Assays in Biological Fluids, edited by 

Michael J. Wheeler and J. S. Morley Hutchinson, 2006 

323. Arabidopsis Protocols, Second Edition, edited by 

Julio Salinas and Jose J. Sanchez-Serrano, 2006 

322. Xenopus Protocols: Cell Biology and Signal 

Transduction, edited by X. Johné Liu, 2006 

321. Microfluidic Techniques: Reviews and Protocols, 

edited by Shelley D. Minteer, 2006 

320. Cytochrome P450 Protocols, Second Edition, edited 

by Ian R. Phillips and Elizabeth A. Shephard, 2006 

319. Cell Imaging Techniques, Methods and Protocols, 

edited by Douglas J. Taatjes and Brooke T. Mossman, 

2006 

318. Plant Cell Culture Protocols, Second Edition, edited 

by Victor M. Loyola-Vargas and Felipe Vázquez-Flota, 

2005 

317. Differential Display Methods and Protocols, Second 

Edition, edited by Peng Liang, Jonathan Meade, and 

Arthur B. Pardee, 2005 

316. Bioinformatics and Drug Discovery, edited by 

Richard S. Larson, 2005 

315. Mast Cells: Methods and Protocols, edited by Guha 

Krishnaswamy and David S. Chi, 2005 

314. DNA Repair Protocols: Mammalian Systems, Second 

Edition, edited by Daryl S. Henderson, 2005 

313. Yeast Protocols: Second Edition, edited by Wei 

Xiao, 2005 

312. Calcium Signaling Protocols: Second Edition, 

edited by David G. Lambert, 2005 

311. Pharmacogenomics: Methods and Protocols, edited by 

Federico Innocenti, 2005 

310. Chemical Genomics: Reviews and Protocols, edited by 

Edward D. Zanders, 2005 

309. RNA Silencing: Methods and Protocols, edited by 

Gordon Carmichael, 2005 

308. Therapeutic Proteins: Methods and Protocols, 

edited by C. Mark Smales and David C. James, 2005 

307. Phosphodiesterase Methods and Protocols, 

edited by Claire Lugnier, 2005 

306. Receptor Binding Techniques: Second Edition, 

edited by Anthony P. Davenport, 2005 

305. Protein–Ligand Interactions: Methods and 

Applications, edited by G. Ulrich Nienhaus, 2005 

304. Human Retrovirus Protocols: Virology and 

Molecular Biology, edited by Tuofu Zhu, 2005 

303. NanoBiotechnology Protocols, edited by Sandra J. 

Rosenthal and David W. Wright, 2005

M E T H O D S I N M O L E C U L A R B I O L O G Y 



Methods and Protocols 

Edited by 


National Heart and Lung Institute, London, UK 

Marlene Rose 

National Heart and Lung Institute, Harefield, UK

© 2006 Humana Press Inc. 

999 Riverview Drive, Suite 208 

Totowa, New Jersey 07512 

www.humanapress.com 

All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in 

any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise 

without written permission from the Publisher. Methods in Molecular BiologyTM is a trademark of The 

Humana Press Inc. 

All papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not 

necessarily reflect the views of the publisher. 

This publication is printed on acid-free paper. ∞ 

ANSI Z39.48-1984 (American Standards Institute) 

Permanence of Paper for Printed Library Materials. 

Cover illustration: From Fig. 3, Chapter 17, “Experimental Models of Graft Arteriosclerosis,” by Bezhad 

Soleimani and Victor C. Shi. 

Production Editor: Robin B. Weisberg 

Cover design by Patricia F. Cleary 

For additional copies, pricing for bulk purchases, and/or information about other Humana titles, contact 

Humana at the above address or at any of the following numbers: Tel.: 973-256-1699; Fax: 973-256-8341; 

E-mail: orders@humanapr.com; or visit our Website: www.humanapress.com 

Photocopy Authorization Policy: 

Authorization to photocopy items for internal or personal use, or the internal or personal use of specific 

clients, is granted by Humana Press Inc., provided that the base fee of US $30.00 per copy is paid directly 

to the Copyright Clearance Center at 222 Rosewood Drive, Danvers, MA 01923. For those organizations 

that have been granted a photocopy license from the CCC, a separate system of payment has been 

arranged and is acceptable to Humana Press Inc. The fee code for users of the Transactional Reporting 

Service is: [1-58829-544-3/06 $30.00]. 

Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1 

eISBN: 1-59745-049-9 

ISSN: 1064-3745 

Library of Congress Cataloging-in-Publication Data 

Transplantation immunology : methods and protocols / edited by Philip 

Hornick, Marlene Rose. 

p. ; cm. -- (Methods in molecular biology, ISSN 1064-3745 ; v. 333) 

Includes bibliographical references and index. 

ISBN 1-58829-544-3 (alk. paper) 

1. Transplantation immunology. I. Hornick, Philip. II. Rose, Marlene 

L. III. Series: Methods in molecular biology (Clifton, N.J.) ; v. 333. 

[DNLM: 1. Graft Rejection--diagnosis. 2. Graft Rejection--immunology. 

3. Laboratory Techniques and Procedures. 4. Organ Transplantation 

--adverse effects. 5. Transplantation, Homologous--immunology. 

W1 ME9616J v.333 2006 / WO 680 T7725 2006] 

QR188.8T732 2006 

617.9'5--dc22 

2005028830

Preface 

Our understanding of the immunological mechanisms of rejection has 

greatly improved over the past 10 years. Much of this is the result of technical 

innovations in the laboratory, resulting in more detailed analysis of experimental 

graft rejection and better ways of detecting and monitoring the patients’ 

immune response to the allografted organ. Transplantation Immunology: 

Methods and Protocols focuses, in the main, on practical methods of detecting 

the immune response to the allografted organ. The first six chapters are, 

however, more theoretical. They provide an update on current practices of 

renal, liver, islet, and lung transplantation, and pathways of antigen presentation 

and chronic rejection. A possible novel therapy of transplant rejection 

involves the overexpression of molecules of interest in donor or recipient 

tissues, the issues of the best vectors, whether viral or nonviral is reviewed in 

Chapters 8 and 9. Methods of HLA typing and methods of detecting HLA 

antibodies have considerably changed in recent years and current methods are 

described in two chapters. More specialized methods, generally confined to 

research labs at present, such as proteomics, laser dissection microscopy, and 

real-time polymerase chain reaction, are described. Whereas monitoring the 

antibody response to transplantation has been performed by many laboratories 

in the past, monitoring the T-cell response is still laborious and hence the 

province of very specialized laboratories. The traditional method, quantitative 

limiting dilution analysis, is described and compared with new techniques. The 

area of tolerance induction and reprogramming of the immune system is 

covered in Chapter 11, and current practices of organ preservation and 

immunosuppressive drugs (Chapters 15 and 16) are also included. Finally, 

chronic rejection has been difficult to mimic in experimental models, all 

models are limited, and this subject is updated in the final chapter. 

Transplantation Immunology: Methods and Protocols is intended for 

clinicians and scientists interested in the practice of solid organ transplantation. 

The chapters all give broad overviews and as such will be suitable for 

relative newcomers to the field. For those already familiar or expert in certain 

laboratory methods, we hope they find the chapters about the newer techniques 

of interest and value. 

v 


Marlene Rose

Contents 

Preface ..............................................................................................................v 

Contributors .....................................................................................................ix 

1 Current Status of Renal Transplantation 

Christopher J. Callaghan and J. Andrew Bradley ................................. 1 

2 Current Status of Liver Transplantation 

Peter J. Friend and Charles J. Imber ................................................... 29 

3 Current Status of Clinical Islet Cell Transplantation 

Jonathan R. T. Lakey, Mohammadreza Mirbolooki, 

and A. M. James Shapiro ................................................................ 47 

4 Current Status of Lung Transplantation 

Allan R. Glanville .............................................................................. 105 

5 Chronic Rejection in the Heart 

Philip Hornick and Marlene Rose ..................................................... 131 

6 Direct and Indirect Allorecognition 

Philip Hornick ................................................................................... 145 

7 HLA Typing and Its Influence on Organ Transplantation 

Stephen Sheldon and Kay Poulton .................................................... 157 

8 Strategies for Gene Transfer to Solid Organs: Viral Vectors 

Charlotte Lawson .............................................................................. 175 

9 Nonviral Vectors 

Louise Collins .................................................................................... 201 

10 Detection and Clinical Relevance of Antibodies 

After Transplantation 

John D. Smith and Marlene Rose ...................................................... 227 

11 Reprogramming the Immune System Using Antibodies 

Luis Graca and Herman Waldmann ................................................. 247 

12 In Vitro Assays for Immune Monitoring in Transplantation 

Maria P. Hernandez-Fuentes and Alan Salama ................................ 269 

13 Proteomics and Laser Microdissection 

Emma McGregor and Ayesha De Souza ........................................... 291 

vii

viii Contents 

14 Real-Time Quantitative Polymerase Chain Reaction 

in Cardiac Transplant Research 

Leanne E. Felkin, Anne B. Taegtmeyer, and Paul J. R. Barton.......... 305 

15 Organ Preservation 

Mark Hicks, Alfred Hing, Ling Gao, Jonathon Ryan, 

and Peter S. MacDonald ............................................................... 331 

16 Pharmacological Manipulation of the Rejection Response 

Peter Mark Anthony Hopkins ........................................................... 375 

17 Experimental Models of Graft Arteriosclerosis 

Bezhad Soleimani and Victor C. Shi ................................................. 401 

Index ............................................................................................................ 425

Contributors 

PAUL J. R. BARTON • National Heart and Lung Institute, Imperial College 

London, Heart Science Centre, Harefield Hospital, Harefield, Middlesex, 

England 

J. ANDREW BRADLEY • Department of Surgery, University of Cambridge, 

Cambridge, Cambridgeshire, England 

CHRISTOPHER J. CALLAGHAN • Wellcome Trust Research Training Fellow, 

University Department of Surgery, Addenbrooke’s Hospital, Cambridge, 

England 

LOUISE COLLINS • Clinical Sciences, GKT School of Medicine, Kings 

College; The Rayne Institute, London, England 

AYESHA DE SOUZA • Transplant Immunology, National Heart and Lung 

Institute, Imperial College London; Heart Science Centre, Harefield 

Hospital, Harefield, Middlesex, England 

LEANNE E. FELKIN • National Heart and Lung Institute, Imperial College 


England 

PETER J. FRIEND • Nuffield Department of Surgery, John Radcliffe Hospital, 

Oxfordshire, Oxford, England 

LING GAO • Transplant Programme, Victor Chang Cardiac Research 

Institute, Sydney, Australia 

ALLAN R. GLANVILLE • Department of Thoracic Medicine, St. Vincent’s 

Hospital, Darlinghurst, New South Wales, Australia 

LUIS GRACA • Therapeutic Immunology Group, Sir William Dunn School 

of Pathology, Oxfordshire, Oxford, England 

MARIA P. HERNANDEZ-FUENTES • Immunoregulation Laboratory, Department 

of Nephrology and Transplantation, School of Medicine, Kings College 

London, University of London, London, England 

MARK HICKS • Heart and Lung Transplant Unit and Department of Clinical 

Pharmacology, St. Vincent’s Hospital, Sydney and Department 

of Physiology and Pharmacology, University of New South Wales, 

Australia 

ALFRED HING • Transplant Programme, Victor Chang Cardiac Research 

Institute, Sydney, Australia 

PHILIP HORNICK • Cardiothoracic Surgery, National Heart and Lung Institute, 

Imperial College Hammersmith Campus, London, England 

ix

x Contributors 

PETER MARK ANTHONY HOPKINS • Queensland Heart-Lung Transplant Unit, 

The Prince Charles Hospital, Chermside, Brisbane, Queensland, Australia 

CHARLES J. IMBER • Queen Elizabeth Liver Unit, Queen Elizabeth Hospital, 

Birmingham, England 

JONATHAN R. T. LAKEY • Department of Surgery, Faculty of Medicine 

and Dentistry, University of Alberta, Edmonton, Alberta, Canada 

CHARLOTTE LAWSON • Veterinary Basic Sciences, The Royal Veterinary 

College, London, England 

PETER S. MACDONALD • Heart and Lung Transplant Unit, St. Vincent’s 

Hospital, Sydney and Transplant Programme, Victor Chang Cardiac 

Research Institute, Sydney, Australia 

EMMA MCGREGOR • Department of Vascular Surgery, Imperial College 

School of Medicine, Charing Cross Hospital, London, England 

MOHAMMADREZA MIRBOLOOKI • Department of Surgery, Faculty of Medicine 


KAY POULTON • Transplantation Laboratory, Central Manchester and 

Manchester, Children’s University Hospitals NHS Trust, Manchester 

Royal Infirmary, Manchester, England 

MARLENE ROSE • Heart Science Centre, National Heart and Lung Institute, 

Imperial College, Harefield Hospital, Harefield, England 

JONATHON RYAN • Heart and Lung Transplant Unit, St. Vincent’s Hospital, 

Sydney, Australia 

ALAN SALAMA • Renal Section, Division of Medicine, Hammersmith 

Hospital, Imperial College London, London, England 

A. M. JAMES SHAPIRO • Department of Surgery, Faculty of Medicine 


STEPHEN SHELDON • Transplantation Laboratory, Central Manchester and 

Manchester, Children’s University Hospitals NHS Trust, Manchester 

Royal Infirmary, Oxford Road, Manchester, England 

VICTOR C. SHI • Transplantational Research, Novartis Pharmaceutical 

Corp., Summit, NJ 

JOHN D. SMITH • Tissue Typing Laboratory, Royal Brompton and Harefield 

NHS Trust, Harefield Hospital, Harefield, Middlesex, England 

BEZHAD SOLEIMANI • Cardiothoracic Surgery, National Heart and Lung 

Institute, London, England 

ANNE B. TAEGTMEYER • National Heart and Lung Institute, Imperial College 


England 

HERMAN WALDMANN • Therapeutic Immunology Group, Sir William Dunn 

School of Pathology, Oxfordshire, Oxford, England

Current Status of Renal Transplantation 1 

1 

Current Status of Renal Transplantation 

Christopher J. Callaghan and J. Andrew Bradley 

Summary 

Renal transplantation is the best treatment for most patients with end-stage renal failure. 

It markedly improves quality of life and in some cases increases life expectancy. 

Advances in immunosuppression and other areas of practice have led to an incremental 

improvement in outcome; 1- and 5-yr graft survival after cadaveric renal transplantation 

is now around 90 and 70%, respectively. This success has led to increased demand for 

transplantation that cannot be met by cadaveric heart-beating donors, numbers of which 

have remained relatively static. Increasing use is now being made of kidneys from 

so-called “marginal” or “extended criteria” cadaveric donors and from non-heartbeating 

donors. More reliance is also being placed on living kidney donation, which 

accounts for around 25% of kidney transplants in the United Kingdom and 50% of transplants 

in the United States. Much effort in renal transplantation is now being directed 

toward improving long-term outcomes. This chapter provides an overview of these and 

other issues in renal transplantation, focusing on some of the topics of current interest. 

Key Words: Renal transplantation; immunosuppression; organ donation; long-term 

outcomes. 

1. Introduction 

The first kidney transplant that was successful in the long term was performed 

in Boston in 1954 between genetically identical twins. The immunological barrier 

between genetically unrelated individuals was then overcome in the 1960s, 

when azathioprine and steroids were used with moderate success. Cyclosporine 

was introduced in the late 1970s and heralded the modern era of kidney transplantation 

(1). Renal transplantation is now the optimal therapy for the majority 

of patients with end-stage renal disease (ESRD). Not only does renal transplantation 

provide a better quality of life than either peritoneal dialysis or hemodialysis 

(2,3) but there is increasing evidence that it offers a survival advantage 

From: Methods in Molecular Biology, vol. 333: Transplantation Immunology: Methods and Protocols 

Edited by: P. Hornick and M. Rose © Humana Press Inc., Totowa, NJ 

1

2 Callaghan and Bradley 

Table 1 

Underlying Renal Disease in UK Adult 

Kidney-Only Transplants, 2003–2004 

Not reported a 37.3% 

Polycystic kidneys, adult type 10.4% 

Pyelonephritis/interstitial nephritis 8.4% 

Glomerulonephritis 7.7% 

Diabetes mellitus (types 1 and 2) 6.7% 

IgA nephropathy 6.6% 

Renovascular disease 5.7% 

Other diseases 17.2% 

a A high proportion of this group is made up of patients 

with end-stage renal disease of unknown cause. 

Personal communication, UK Transplant, July 2004. 

IgA, immunoglobulin A. 

over dialysis (4). Transplantation is also the most cost-effective treatment for 

ESRD (5,6). 

This chapter aims to provide a brief overview of renal transplantation, with 

emphasis on issues of current interest. For a more complete account of the field, 

the reader is directed to one of the comprehensive textbooks available (7). 

1.1. Current UK Activity and Results 

The majority of patients with ESRD should be considered for renal transplantation. 

The most common underlying diagnoses in adults undergoing renal 

transplantation are glomerulonephritis, diabetes, pyelonephritis, renovascular 

disease, and polycystic kidney disease (Table 1).* Contraindications to renal 

transplantation are listed in Table 2. The success of renal transplantation is 

reflected in the ever-growing numbers of patients waiting for a transplant. In 

March 2003, 6447 people were on the active waiting list for a renal transplant 

in the United Kingdom (Fig. 1), with a median waiting time for adults of approx 

500 d. Although 1667 kidney transplants were performed in 2002, an increase 

of 5% from the previous year, the disparity between demand and supply continues 

to grow (Fig. 1). 

The total number of renal transplants performed annually in the United Kingdom 

has remained relatively static since the mid-1990s, despite recent improvements 

in the number of living donor kidneys used. This is owing to reductions 

* Statistics prepared by UK Transplant from the National Transplant Database maintained on 

the behalf of transplant services in the United Kingdom and Republic of Ireland. UK Transplant 

statistics can be found at http://www.uktransplant.org.uk/ukt/statistics/statistics.jsp.


Table 2 

Contraindications to Renal Transplantation 

Predicated patient survival 50% at 1 yr 

Patients unable to comply with immunosuppressive medication 

History of noncompliance 

Poorly controlled psychosis or regular use of class A drugs 

Immunosuppression predicted to cause life-threatening complications 

AIDS, acquired immunodeficiency syndrome. 

Fig. 1. Kidney-only transplants and active transplant list at year end in the United 

Kingdom, 1995–2004. (Courtesy of UK Transplant.) 

in road traffic accidents and cerebrovascular accidents, the two leading causes 

of death of cadaveric heart-beating donors (Renal Transplant Audit 1990–1998, 

UK Transplant, Bristol). 

Kidney transplant survival is improving year after year (8), as a result of 

refinements in immunosuppression, postoperative management, and laboratory 

support services. Ninety percent of cadaveric grafts survive to 1 yr, with 

5- and 10-yr allograft survival rates of approx 70% and 50%, respectively.


1.2. Determinants of Long-Term Outcome 

Improvements in long-term graft survival are mainly a result of better outcomes 

in the first year posttransplantation (8,9). It is disappointing to note that 

the rate of graft loss after 1 yr has remained relatively unchanged since the 

1980s, at 3–5% per year. Long-term graft loss is primarily the result of chronic 

allograft nephropathy (CAN) (40%) or death with a functioning graft (40%). 

Recurrence of the initial renal disease in the renal transplant is also an important 

cause of graft failure (10% of late graft loss). CAN is characterized histologically 

by intimal hyperplasia in small- and medium-sized arteries, interstitial 

fibrosis, glomerulosclerosis, and tubular atrophy. Both immunological (chronic 

rejection) and nonimmunological factors contribute to the development of CAN 

(10). The clinical manifestations of CAN are a progressive decline in renal 

function with proteinuria and hypertension. The precise mechanisms are poorly 

understood, but a number of risk factors have been identified. 

Immunological risk factors for CAN include previous episodes of acute rejection 

(8) and suboptimal immunosuppression (11). Mismatches between the donor 

and recipient at the human leukocyte antigen (HLA)-DR, HLA-A, and HLA-B 

loci also reduce long-term graft survival in renal transplantation (12). Mismatching 

is expressed as a mismatch (MM) grade, and the MM grade may vary between 

0-0-0 (full house match) and 2-2-2 (complete mismatch), with each integer signifying 

the HLA-A, -B, and -DR locus, respectively. In the United Kingdom, the 

number of donor–recipient HLA mismatches has been reduced through the introduction 

of HLA matching into the National Kidney Allocation Scheme. 

Nonimmunological factors leading to CAN are numerous and include increased 

recipient age, male gender, hypertension, and increased donor age (12). Because 

there is no effective treatment for CAN other than retransplantation, it is important 

to try wherever possible to minimize associated risk factors (11). 

The rates of recurrent renal disease in the transplanted kidney and its clinical 

impact vary depending on the underlying disease (13). Histological changes 

suggestive of diabetic nephropathy can be identified in most grafts in diabetic 

recipients, but clinically overt diabetic nephropathy is uncommon. In contrast, 

up to 50% of patients with focal segmental glomerulosclerosis experience disease 

recurrence, and there is a 50% chance of graft loss within 2 yr. 

Death with a functioning graft is most commonly the result of cardiovascular 

disease (CVD) in the recipient (14). This is discussed in more detail later. 

2. Recipient Evaluation 

Evaluation of a prospective recipient for renal transplantation should be performed 

as soon as it becomes apparent that therapy for ESRD will be required. 

Early transplantation is desirable in patients with ESRD, and there is evidence 

that pre-emptive transplantation (i.e., transplantation in the months preceding


the need for dialysis) is associated with a particularly good outcome (15). Patients 

with ESRD secondary to diabetic nephropathy may, if sufficiently fit, be suitable 

candidates for simultaneous pancreas and kidney transplantation (16). 

With improvements in anesthetic, surgical, and HLA typing techniques, renal 

transplantation can now be offered to groups of patients previously considered to 

be at an unacceptably high risk. This includes older patients, those with significant 

comorbidities such as diabetes mellitus or ischemic heart disease, and 

highly sensitized patients requiring retransplantation. Advanced age alone is 

not a contraindication to receiving a renal transplant because improvements in 

graft survival now mean that survival benefits outweigh potential risks to elderly 

patients (17,18). In practice, however, transplantation is rarely considered 

in those over 75 yr of age. 

Evaluation of renal transplant candidates should be undertaken to determine 

that the risks of surgery and immunosuppression are acceptable to both the 

patient and the transplant team. Clinical assessment should focus on assessing 

general fitness (especially of the cardiovascular and respiratory systems), excluding 

concurrent malignancy and infection, and identifying any psychosocial issues 

that may interfere with compliance with immunosuppressive therapy (19). 

Screening for CVD is a vital component of the assessment process because of 

its high prevalence in patients with ESRD (see Subheading 9.). Patients with 

diabetes and older patients require particularly rigorous screening for cardiovascular 

pathology. 

3. Expansion of the Donor Pool 

The majority of donor kidneys in the United Kingdom come from cadaveric 

heart-beating (brain-stem-dead) donors declared dead using well-recognized 

criteria (20,21). The steady decrease in the number of these donors has led to 

the need to improve organ utilization and to investigate other potential sources 

of donor kidneys such as marginal donors, non-heart-beating donors (NHBDs), 

and living donors. 

3.1. Marginal Donors 

The lengthening waiting list for renal transplantation has led to a relaxation 

in the selection criteria for kidney donors and the use of kidneys from so-called 

marginal donors. There is no widely accepted definition of what constitutes a 

marginal kidney, but examples include donors at the extremes of age, those 

with longstanding hypertension or diabetes, or donors where there is an increased 

risk of disease transmission. As might be expected, the results of transplantation 

with marginal kidneys are inferior to those with standard kidneys (22). 

Transplanting both kidneys from a very marginal donor into one recipient is a 

potential option and may result in better renal function in the recipient. Dual


kidney transplants from marginal donors has been reported to give similar results 

to single kidney transplants from nonmarginal donors (23), and dual transplantation 

does not appear to increase the rate of surgical complications (24). This 

procedure is rarely undertaken in the United Kingdom, with only one dual transplant 

performed in 2002–2003. 

Objective methods of assessing donor kidney quality are necessary to enable 

rational decision making about organ usage, but none are in widespread use. 

Scoring systems using donor variables such as age, history of hypertension, 

renal function, kidney biopsy findings, cause of death, and HLA mismatch 

may provide a quantitative approach to identifying marginal kidneys (25,26). 

Until scoring systems become widespread, careful consideration is required as 

to how best to allocate these organs from marginal donors. It is also important 

that potential recipients offered kidneys from marginal donors receive careful 

counseling to enable informed consent to be given (27). 

3.2. Living Donors 

The outcome of kidney transplantation from living donors has been shown to 

be superior to that of kidney transplantation from cadaveric donors (8). Although 

they are usually poor matches for HLA, grafts from living unrelated donors 

have 3-yr survival rates equivalent to those from living related organs (28). 

Concerns surrounding living donor transplantation center on the potential risks 

to the donor and on the possibility of coercion, which may be difficult to detect. 

The peri-operative mortality rate for live donor nephrectomy is in the region 

of 0.03% (29), and the peri-operative major complication rate is approx 2%. 

There is no long-term increase in mortality after kidney donation, but donors 

may develop asymptomatic proteinuria and hypertension more often than the 

general population (30). In addition to a rigorous health screen, potential 

donors must be carefully questioned by the transplant team about their 

motives for donation and all attempts must be made to ensure that coercion 

does not occur. 

Medical evaluation of the prospective donor is extensive and can be divided 

into different phases (31). ABO blood grouping and cross-match testing are 

performed first to establish that living donor transplantation is feasible. This is 

followed by a complete medical assessment, including assessment of renal 

function, and radiological definition of the renal vascular anatomy. If both kidneys 

have single renal arteries, the left kidney is usually selected for donation 

because the longer left renal vein makes the recipient operation marginally 

technically easier. 

Removal of the donor’s kidney has traditionally been performed through a 

15- to 20-cm-long flank incision (open-donor nephrectomy). Postoperative 

wound pain, which may be chronic in around 5% of donors, and poor cosmesis


are potential problems with this approach. Advances in surgical techniques and 

fiber-optic technology have enabled the introduction of laparoscopic (keyhole) 

live donor nephrectomy (LLDN) (32) in an attempt to reduce postoperative 

morbidity. Instrument access to the kidney is gained through four abdominal 

ports requiring 1- to 2-cm incisions each, and the donor kidney is then removed 

after mobilization through a 6-cm abdominal incision. 

Although no large randomized controlled trials have been performed, longterm 

graft function after LLDN is similar to that after open nephrectomy. Some 

studies have suggested that early graft function may be marginally delayed after 

LLDN (33,34). The laparoscopic approach requires a longer operative time (35), 

although this disadvantage is counterbalanced by improved cosmesis, shorter 

postoperative stay, reduced analgesic requirement, and earlier return to work 

(36). Morbidity is similar for the two approaches, although LLDN may leave 

the donor at long-term risk of small bowel obstruction from adhesions. Some 

centers offering LLDN have observed increases in donation rates (37), although 

it difficult to know whether LLDN per se is responsible for this. 

Although the number of living donor transplants in the United Kingdom is 

increasing (Fig. 1), it makes up only 21% of total kidney transplant activity 

(UKT 2003 data). This compares poorly with North America, Scandinavia, 

and Australia, all of which have higher rates of living donation. United Network 

for Organ Sharing data for 2001 showed, for the first time, that the number 

of living-donor kidney transplants in the United States exceeded the number 

of cadaveric transplants undertaken. There is, therefore, considerable scope for 

further increasing the living kidney donor rate in the United Kingdom. 

3.3. Non-Heart-Beating Donors 

NHBDs are donors from whom organs are retrieved following declaration 

of death by conventional means, that is, irreversible cessation of circulatory 

and respiratory function. NHBDs were the main source of organs before the 

widespread acceptance of brainstem death criteria in the late 1970s but then 

declined markedly owing to less favorable results. In recent years, the use of 

NHBDs has increased in many centers in an attempt to offset the severe shortage 

of kidneys from cadaveric heart-beating donors. 

NHBDs can be separated into categories on the basis of their mode of death 

(38) (Table 3). Uncontrolled NHB donations (categories 1 and 2) occur in 

emergency settings, and because the process of seeking consent from relatives 

is often protracted, warm ischemic times must be minimized by inserting a 

double-balloon triple-lumen catheter via the femoral artery, allowing selective 

perfusion of the renal arteries with cooled organ-preservation solution (39). 

Controlled NHB donations (categories 3 and 4) are derived from critically ill 

patients who have died in an intensive care setting. This allows time for con-


Table 3 

Maastricht Categories of Non-Heart-Beating Donors 

Maastricht 

category Description Location 

1 Dead on arrival Outside hospital, 

emergency room 

2 Unsuccessful Emergency room, 

resuscitation intensive care, general ward 

3 Treatment withdrawn, Intensive care 

awaiting cardiac arrest 

4 Cardiac arrest while Intensive care 

brainstem dead 

From ref. 38. 

sent to donation to be taken from relatives. Once medical intervention has been 

withdrawn and death has been declared by the medical staff, the transplant 

team waits a further 5–10 min before starting the organ-retrieval operation. 

The insertion of medical devices into uncontrolled NHBDs before consent 

has been obtained from the relatives raises ethical and legal questions (40). In 

the United Kingdom, the acceptance of this technique in potential uncontrolled 

donors has been achieved by discussions with the local ethics committee and 

by requesting the coroner’s permission before inserting a double-balloon triplelumen 

catheter (41). 

The principal concern relating to renal transplants from NHBDs is the higher 

rates of delayed graft function (DGF) and primary nonfunction (PNF) when 

compared to kidneys from cadaveric heart-beating donors (42,43). Careful 

donor selection may minimize PNF (44,45), and despite a higher incidence 

of DGF than after transplantation with kidneys from cadaveric heart-beating 

donors, the long-term survival of heart-beating and NHBD kidneys is very 

similar (43–45). Other trials report similar PNF rates between the two groups. 

Although DGF after transplantation of kidneys from cadaveric heart-beating 

donors may be associated with reduced long-term graft survival (46), the longterm 

graft survival of NHBD grafts appears comparable to cadaveric heartbeating 

grafts. 

There are significant logistical difficulties in instituting a NHBD program. 

Referrals of potential uncontrolled donors call for enthusiasm and dedication 

from accident and emergency department staff and a rapid response from the 

transplant team. Controlled NHBDs often require the surgical team and operating 

room nursing staff to wait for prolonged periods for the patient to develop 

asystole once ventilation has been discontinued.


Although the use of kidneys from NHBDs is increasing, the number performed 

in the United Kingdom remains relatively small. Only 103 transplants 

from NHBDs were performed in 2002–2003 (6% of the total kidney transplants 

undertaken). This low level of utilization reflects the medical, ethical, legal, and 

logistical hurdles that need to be overcome before the concept of NHB donation 

is widely accepted. NHBDs have the potential to make a major contribution to 

the organ donor pool. A 40% increase in the overall supply of cadaveric kidneys 

has been reported from a Dutch center using NHBD kidneys (47); if maintained, 

this would substantially reduce the renal transplant waiting list (42). 

3.4. ABO-Incompatible Renal Transplants 

Traditionally, ABO blood group compatibility is considered an essential 

prerequisite for successful kidney transplantation. ABO-incompatible kidney 

transplants are likely to be rapidly destroyed by hyperacute rejection owing to 

anti-A and/or anti-B antibodies binding to A and/or B antigens on the graft 

endothelium, activating the complement cascade and inducing platelet aggregation 

and intravascular thrombosis (48,49). 

Graft loss is not inevitable, however, and in 1981 Slapak and colleagues 

observed that plasmapheresis overcame rapid rejection in an accidental ABOincompatible 

renal transplant that resulted from a blood typing error (50). There 

has recently been increased interest in the use of ABO-incompatible living 

donor kidney transplants, particularly in countries where, because cadaveric 

donation is rare for cultural reasons, there is no alternative donor source. Japanese 

surgeons have reported that selected subgroups of patients can achieve 

acceptable outcomes following transplantation of ABO-incompatible kidneys 

if pretransplant anti-ABO antibody reduction is combined with splenectomy 

and/or postoperative anticoagulation and high-dose immunosuppression. 

Pretransplant anti-A/anti-B immunoglobulin (Ig)G and IgM antibody titers 

are reduced by either plasma exchange or immunoabsorption, with subsequent 

replacement with type AB plasma. Splenectomy is performed in an attempt to 

reduce the recipient’s ability to produce anti-A/anti-B antibodies once the 

ABO-incompatible living donor kidney transplant has been performed (51). 

Anticoagulation with platelet aggregation inhibitors is used to prevent the initiation 

of intra-renal disseminated intravascular coagulation due to humoral 

rejection. The need for time-consuming preoperative treatment means that this 

approach is readily applicable only to recipients of living donor and not cadaveric 

donor organs. 

From 1989 to 1998, a total of 312 ABO-incompatible living kidney transplants 

were performed in Japan (52), approx 10% of all living donor grafts. 

The procedure has shown the most promise for recipients younger than 15 yr, 

with progressively less favorable results in older age groups. The largest study


of pediatric recipients of ABO-incompatible living kidney transplants reported 

actuarial 1- and 5-yr graft survival rates of 87% and 85%, respectively, with 

100% patient survival (53). There are no significant differences in graft survival 

between A- and B-incompatible transplants (52). 

Blood group A can be subdivided into A 1 and A 2 types on the basis of the 

degree of expression of the A epitope by tissues. Type A 1 is strongly expressed, 

and A 2 is only weakly expressed. In Europeans, A 1 is the dominant A blood 

group and makes up approx 80% of the total type A population (54). In contrast 

to A 1-incompatible kidney transplantation, A 2-incompatible transplants 

do not require pretransplant antibody removal if recipients with low anti-A 

serum titers are selected. This means that A 2-incompatible cadaveric renal 

transplants can potentially be undertaken. One single-center series of A 2-incompatible 

cadaveric kidney transplants reported an actuarial 2-yr graft survival of 

94% for those patients with a low pretransplant anti-A IgG titer (55). These 

results have been difficult to replicate (56), and therefore this approach remains 

confined to a small number of units. 

At present, a number of factors prevent A 1BO-incompatible living kidney 

transplants from achieving widespread acceptance in the Western transplantation 

community. These include the relative availability of ABO-compatible 

cadaveric and living grafts, the complex and expensive pretransplant plasmapheresis 

required, and the inferior early graft survival rates when compared to 

ABO-compatible kidney transplants. An alternative approach to dealing with 

ABO-incompatible living donors and recipients is to undertake paired donation. 

This involves an exchange agreement between two donor–recipient pairs 

such that kidneys from two living donors who are both ABO incompatible with 

their intended recipients are donated to the reciprocal ABO-compatible recipients. 

This has been practiced successfully in South Korea for many years and is 

also undertaken in a small number of American centers. Under current UK 

legislation, paired donation is illegal (57), but there is hope that new legislation 

might enable this approach to be used for ABO-incompatible living donor kidney 

transplantation. 

4. Recipient Operative Technique 

Operative techniques for renal transplantation have remained relatively constant 

for the last 40 yr (Fig. 2). The donor kidney is placed extraperitoneally in 

either iliac fossa. The renal vein is anastomosed to the external iliac vein, and 

the donor renal artery is anastomosed to either the external or internal iliac 

artery. Once the venous and arterial anastomoses have been completed, the 

vascular clamps are removed to allow perfusion of the graft, and the ureter– 

bladder anastomosis is then performed. Insertion of a double-J ureteric stent has 

been shown to reduce urological complications, particularly urine leaks (58).


Fig. 2. Schematic view of right iliac fossa renal transplant. Anastomosis of renal 

vessels to external iliac vessels. 

5. Current Immunosuppressive Strategies 

The commonly used oral immunosuppressive agents are of broadly three 

classes: calcineurin inhibitors (cyclosporine, tacrolimus), antiproliferative agents 

(azathioprine, mycophenolate mofetil), and steroids (prednisolone). Combined 

use of a single agent from each class is known as triple therapy, the standard 

regime of immunosuppression in early to midterm posttransplantation. This provides 

broad immunosuppression based on the differing mechanisms of action of 

each class. Additional immunosuppression at the time of renal transplantation 

(induction therapy) is common practice because the risk of acute rejection highest 

in first 6 mo. Induction therapy usually consists of antibody prophylaxis with 

either daclizumab (Zenapax ® , Roche) or basiliximab (Simulect ® , Novartis) (see 

below). 

Cyclosporine (CyA, Sandimmun ® , Novartis) was introduced in the late 1970s 

by Sir Roy Calne in Cambridge and resulted in a marked improvement in graftsurvival 

rates (59). CyA combined with azathioprine (AZA) and prednisolone 

became the standard immunosuppressive regime during the 1980s. The mid- 

1990s saw the introduction of a CyA microemulsion formulation (Neoral ® , 

Novartis), resulting in better absorption and more consistent dosing (60). Other 

new drugs to emerge at this time were tacrolimus (Prograf ® , Fujisawa) and 

mycophenolate mofetil (MMF, CellCept ® , Roche). Substitution of tacrolimus 

for CyA in the triple therapy protocol led to a significant reduction in acute 

rejection (61), as did MMF when compared to azathioprine in CyA-based triple 

therapy (62).


Table 4 

Adverse Cardiovascular Risk Profiles 

of Common Immunosuppressant Medications 

Medication Diabetes Hypertension Hyperlipidemia 

Corticosteroids +++ ++ +++ 

Cyclosporine ++ ++ ++ 

Tacrolimus +++ ++ + 

Sirolimus – – +++ 

Within each of the three main classes of immunosuppressive drugs, the sideeffect 

profiles are similar. The calcineurin inhibitors, although chemically unrelated, 

are associated with hypertension, hyperlipidemia, and the development of 

diabetes to varying degrees (Table 4). Of most concern are the nephrotoxic 

effects of calcineurin inhibitors, which can cause permanent renal damage and 

contribute to CAN. The antiproliferative agents lead to dose-related nonspecific 

bone marrow suppression, and MMF causes gastrointestinal disturbances. 

The debilitating side effects of steroids are well known and include osteoporosis, 

cataracts, hypertension, adrenal suppression, skin atrophy, neuropsychiatric 

changes, and peptic ulceration. Also, the continued use of steroids may be 

associated with poorer long-term graft outcome (12). Posttransplant immunosuppressive 

protocols have been developed that are entirely steroid-free (63), 

but in most centers steroids are given at the time of transplantation and then 

slowly tapered to the minimal required dose. In some patients steroids can be 

stopped completely, but unfortunately steroid withdrawal can initiate an episode 

of acute rejection, especially in black recipients (64). 

A new class of immunosuppressants, the mammalian target of rapamycin 

(mTOR) inhibitors, was launched in the late 1990s. The first member of the 

mTOR inhibitor class to enter clinical practice was rapamycin (sirolimus, 

Rapamune ® , Wyeth). The main side effects of sirolimus are hyperlipidemia 

and myelosuppression. An advantage of the mTOR inhibitors is their lack of 

nephrotoxicity. Cyclosporine withdrawal from a sirolimus–CyA–steroid regimen 

has been shown to lead to improved graft function and reduction in hypertension 

(65). There is hope that the calcineurin-sparing effects of sirolimus 

may lead to decreased rates of CAN in the long-term. At present the optimal 

role of sirolimus in renal transplantation is unknown and the long-term results 

of trials are awaited (66). 

As acute rejection rates have dropped and the number of clinically effective 

immunosuppressant agents has increased, the clinical focus has moved towards 

optimizing long-term outcomes and tailoring immunosuppressive regimes to


the needs of the individual patient. Tacrolimus should be avoided in patients 

with diabetes, and sirolimus should be used with caution in patients with preexisting 

CVD. Steroid use should be minimized for both groups. Patients who 

are at particularly high risk of an acute rejection episode may benefit from 

more potent immunosuppression. 

6. Acute Rejection Monitoring and Management 

Acute rejection occurs in approx 30% of renal transplant recipients within 

the first 6 mo postoperatively, depending on the immunosuppressive regime 

and the immunological risk profile of the patient. In the majority of cases, 

acute rejection is reversible and results in early graft loss in less than 10% of 

rejection episodes. Acute rejection may, however, be an important predictor of 

chronic rejection (67) and therefore of long-term function and graft survival 

(8). Acute vascular rejection and rejection episodes that are severe, recurrent, 

or of late onset are associated with an increased risk of chronic rejection (67). 

The prevention, early diagnosis, and effective management of acute rejection 

are therefore vital. 

Acute rejection is recognized clinically by a rapid deterioration in graft function 

(i.e., increased creatinine) after exclusion of alternative diagnoses such as 

dehydration, urinary tract infection, calcineurin-inhibitor toxicity, or inflow/ 

outflow obstruction. Percutaneous ultrasound-guided biopsy is often valuable 

and can be performed under local anesthetic with a major complication rate of 

0.5% (68). Histological analysis enables the diagnosis, classification, and scoring 

of acute rejection according to the Banff criteria (69,70). 

Recognition that the prevention of clinical acute rejection may result in 

improved long-term graft outcomes has led to an interest in detecting subclinical 

rejection with serial biopsies (protocol biopsies). Subclinical rejection 

is defined as the presence of histological changes meeting the criteria for 

acute rejection in patients with stable graft function (71). The incidence of 

subclinical rejection in the first 3 mo posttransplant varies from 5 to 50% (71). 

In one small study its presence was shown to be associated with increased 

rates of CAN at 2 yr (72), and treatment with methylprednisolone correlated 

with improved 2-yr graft outcomes (73). In an era of increasing graft survival 

and decreasing acute rejection rates, subjecting patients to protocol biopsies 

and the potential morbidity of high-dose steroids may be inappropriate given 

that the natural history of subclinical rejection is not known with certainty 

(74). A prospective randomized trial with long-term follow-up is needed to 

resolve this issue. 

Noninvasive methods to detect imminent acute rejection are also being developed. 

Techniques include measurement of perforin and granzyme B gene 

expression in peripheral blood (75,76), and measurement of soluble C4d and


adhesion molecules in the urine by enzyme-linked immunosorbent assay (77). 

Noninvasive tests for CAN are also being investigated (78,79), but none have 

undergone large-scale trials or entered routine clinical use. 

6.1. Management of Acute Rejection 

First-line treatment of acute rejection is with high-dose intravenous steroid 

(e.g., methylprednisolone 0.5–1 g daily for 3 d). In up to 50% of cases, acute 

rejection is steroid resistant and treatment with polyclonal antithymocyte globulin 

(ATG) is required (80). This is given under close supervision as a result of 

the risk of pulmonary edema from cytokine release syndrome. Anti-CD3 monoclonal 

antibody (muromonab-CD3, Orthoclone OKT ® 3, Ortho Biotech) has also 

been used with similar efficacy and side effects (81). Early reports have suggested 

that high-dose pooled human immunoglobulin may be superior because 

of its relatively benign side-effect profile (82). 

As already noted, both daclizumab and basiliximab, monoclonal antibodies 

directed against the interlukin-2 receptor α chain (CD25), reduce the incidence 

of acute rejection by approx 30% when given prophylactically around the time of 

transplantation (83,84). These agents, which are widely used, appear to be free 

from significant side effects, and their ability to reduce acute rejection makes 

them cost-effective (85). 

6.2. C4d Staining and Antibody-Mediated Rejection 

Since the mid-1990s, it has become increasingly apparent that antibody may 

mediate allograft rejection in settings other than hyperacute rejection. This has 

occurred through the recognition that C4d deposition in graft peritubular capillaries 

is a reliable marker of antibody-mediated acute rejection (86). C4d is a 

stable inactive degradation product of complement factor C4, formed when the 

classical complement cascade is activated by the binding of antidonor antibodies 

to the endothelium of the allograft. 

Capillary C4d staining has been found in 30% of biopsies performed for 

renal graft deterioration (87) and has been found to be 95% sensitive and specific 

for the presence of antidonor antibodies (88). The definitive diagnosis of 

acute antibody-mediated rejection requires morphological evidence of acute 

tissue injury with immunopathological evidence for antibody action (C4d staining 

or immunoglobulin and complement in arterial fibrinoid necrosis) and 

serological evidence of antidonor antibodies (69). 

C4d staining may also occur in CAN, mildly altered graft function, or with 

normal histology. In these settings, the clinical significance of C4d staining 

remains unclear. However, when features of acute cellular or humoral rejection 

are present, C4d staining appears to be a marker of severity (89). Therefore, 

anti-B-cell therapy (antithymocyte globulin, intravenous immunoglobulin,


mycophenolate mofetil) or removal of antibody (plasmapheresis, immunoabsorption) 

should be considered (90). 

7. Management of the Sensitized Patient 

Exposure to foreign HLA leads to immunological sensitization and the generation 

of lymphocyte cytotoxic or binding antibodies in the recipient’s serum. 

Sensitization to alloantigens may result from previous failed grafts, pregnancies, 

and blood transfusions. Preexisting antibodies against a donor’s HLA 

may cause hyperacute rejection and immediate graft loss; to avoid this problem, 

a crossmatch test, in which serum of the prospective recipient is tested 

against donor lymphocytes plus complement, is routinely performed before 

making the final decision to carry out transplantation. In general, a positive Tcell 

cross-match test (donor cell lysis) is a contraindication to renal transplantation. 

Sensitization is reported as the panel-reactive antibody (PRA). This is the 

percentage of panel cells, selected to include common HLA antigens, which 

are lysed by the patient’s serum. Highly sensitized patients are arbitrarily defined 

as those with a PRA of 85% or greater. Such patients are more likely to have a 

positive lymphocyte cross-match test and will thus wait longer for a transplant 

if this is not taken into account in allocation systems. This will tend to disadvantage 

young patients requiring multiple transplants. Management of the sensitized 

patient involves techniques to reduce PRA as well as organ allocation 

schemes to prevent excessively long waiting times. Strategies to reduce the 

incidence of sensitization by minimizing exposure to alloantigens in the transplant 

population are also important. The UK kidney allocation scheme avoids, 

wherever possible, poorly HLA-matched kidney transplants, especially in 

younger recipients. 

The introduction of recombinant human erythropoietin has revolutionized 

the treatment of the anemia of chronic renal failure by reducing the 

need for blood transfusion. This has also reduced sensitization (91). Despite 

the introduction of leucocyte-depleted blood products in the United Kingdom 

in 1999 to minimize the risk of variant Creutzfeldt-Jakob disease 

(vCJD) transmission, studies elsewhere have not demonstrated the expected 

reduction in allosensitization (92). 

Organ-allocation schemes play the major role in managing highly sensitized 

patients. Under the UK National Kidney Allocation Scheme, highly sensitized 

patients are given priority over patients with PRAs of less than 85% 

such that blood-group-compatible kidneys are allocated to 0-0-0 mismatched 

highly sensitized patients. Eurotransplant has similar programs and has demonstrated 

reduced waiting time to transplantation for highly sensitized patients 

(93). The recent publication of HLAMatchmaker, an algorithm that determines


HLA compatibility at the level of amino acid triplets in antibody-accessible 

regions of HLA molecules, may also be valuable in identifying more HLAmatched 

donors for this group of patients (94). 

Clinical strategies to decrease PRAs, and thus increase the chances of a negative 

crossmatch, include administration of intravenous gammaglobulin (95), 

induction immunosuppression with antithymocyte globulin (96), plasma exchange/ 

immunoabsorption (97), or a combination of the above (98). 

8. BK-Virus-Associated Nephropathy 

Renal transplant recipients are, like all transplant recipients, at increased 

risk of infection, particularly viral infections such as cytomegalovirus infection 

(99). A review of infectious complications after renal transplantation is 

beyond the scope of this chapter. However, since it was first reported in 1995, 

BK-virus-associated nephropathy (BKVN) has emerged as an important cause 

of renal allograft loss and is therefore highlighted here. 

BK virus (also known as polyomavirus hominis 1) is an unenveloped doublestranded 

DNA virus that infects 75% of the general population. Primary infection 

occurs in childhood, resulting in a vague flu-like illness. The route of transmission 

is unclear. BK virus then persists in the urinary tract, from where it may 

undergo asymptomatic reactivation in immunocompetent individuals. In the 

immunocompromised the disease is more virulent, especially in kidney transplant 

patients (100). 

In renal transplant recipients, BK viral disease has a wide variety of manifestations, 

including ureteric stenosis, transient graft dysfunction, or irreversible 

allograft failure secondary to BKVN. BKVN is defined as deterioration of 

graft function associated with histologically apparent BK virus allograft infection 

(101). It occurs in approx 8% of renal transplant patients (102), and the 

incidence appears to be rising. This may be the result of the use of more potent 

immunosuppressants, increased awareness, and better diagnostic tools. 

Definitive diagnosis of BKVN requires allograft biopsy (103). BKVN is seen 

as intranuclear inclusion bodies in tubular epithelial cells with enlarged nuclei. 

Ongoing viral replication leads to an accompanying inflammatory response with 

fibrosis and eventually atrophic tubules. Infected cells shed into the urine are 

known as decoy cells. Quantitative polymerase chain reaction (PCR) of BKV 

DNA in serum is the most commonly used noninvasive test, with sensitivity 

and specificity of 100% and 88%, respectively (102). 

In the absence of rejection, which is often coexistent, management consists 

of immunosuppressant reduction. If rejection is present, management is difficult—a 

two-step protocol of antirejection treatment followed by lowered immunosuppression 

has been advocated (100). Antiviral treatment with cidofivir may 

be of use, but it is potentially nephrotoxic and has not yet been evaluated in


randomized trials. Much remains to be learned about the natural history, diagnosis, 

and optimum treatment of this disease. 

9. Cardiovascular Disease in the Renal Transplant Patient 

As short-term success rates in kidney transplantation improve, clinical attention 

is focusing increasingly on maximizing long-term survival. Death with a 

functioning graft causes 40% of late graft losses, with CVD accounting for 

approximately half of all deaths after renal transplantation (14). CVD includes 

ischemic heart disease, peripheral vascular disease, cerebrovascular disease, 

and cardiac failure. A recipient aged 25–34 yr has a 10 times higher relative 

risk of dying of CVD than an age- and gender-matched control (104). Overall, 

kidney recipients have a prevalence of CVD five times that of the general population 

(105). Prevention and management of CVD and its risk factors is therefore 

a high priority. 

Studies on the general population such as the Framingham Heart Study have 

identified risk factors for the development of CVD and ischemic heart disease 

in particular. Modifiable risk factors include hypertension, hypercholesterolemia, 

obesity, sedentary lifestyle, smoking, and diabetes; age, gender, ethnic 

group, and family history of CVD are unmodifiable risk factors. Although these 

traditional risk factors also apply to renal transplantation patients, they tend to 

underestimate the prevalence of CVD (106). Proteinuria, chronic immunosuppression, 

infections, and hyperhomocysteinemia may help to explain the higher 

than predicted CVD burden of the transplant population (Fig. 3). 

CVD is often already present prior to transplantation. ESRD and hemodialysis 

are associated with hypertension, fluid overload, anemia, and the metabolic 

effects of chronic uremia on the cardiovascular system (107). In addition, 

diabetes or renovascular disease may be the underlying cause of ESRD, placing 

the patient in a very high-risk group. All patients referred for consideration 

of renal transplantation should therefore undergo screening and management 

for both CVD risk factors and overt CVD (19). Smoking cessation advice and 

support is especially important, as is encouragement to exercise regularly. 

Once transplantation has occurred, screening should continue in the outpatient 

clinic because calcineurin inhibitors (tacrolimus, cyclosporine) and corticosteroids 

are associated with the development of hypertension, diabetes, and 

hyperlipidemia to differing degrees. Hypertension should be treated initially 

with general measures such as weight reduction, salt restriction, and exercise. 

However, antihypertensive drugs are often necessary. In patients with uncontrollable 

hypertension, renal artery stenosis should be excluded. Hyperlipidemia 

is commonly treated with diet control and HMG-CoA reductase 

inhibitors (statins). In addition, statins may have a role in the primary prevention 

of CVD (108) as well as a potential immunosuppressant action (109,110).


Fig. 3. Cardiovascular disease risk factors in renal transplant recipients. 

In practice, the majority of renal transplant recipients receive statins and 

antiplatelet agents such as aspirin in an attempt to reduce cardiovascular morbidity 

and mortality. Postttransplant diabetes mellitus (PTDM) has an incidence 

of 4–18% (111), and fasting blood glucose tests should be undertaken 

every 3 mo (112). Initial treatment is with dietary modification, although oral 

hypoglycemics or even insulin may be necessary. Preexisting diabetes requires 

intensive monitoring and blood glucose control. Control of hypertension, hyperlipidemia, 

and PTDM may also require modifications to the patient’s immunosuppressive 

regime. 

Other risk factors may also play a part in the development of CVD in the 

renal transplant recipient. Elevated plasma homocysteine has been identified 

as an independent factor for CVD in the renal transplant population (113), but 

as yet there is no evidence that reduction of homocysteine levels reduces the 

incidence of CVDs. Routine homocysteine measurement and the use of folate 

supplements are therefore currently not recommended (114). Systemic inflammation 

or low-grade infection may also play a role in the development of CVD


because C-reactive protein, a marker of inflammation, is associated with an 

increased risk of ischemic heart disease in renal transplant recipients (115). 

Proteinuria has been shown to be an independent risk factor for both cardiovascular 

and noncardiovascular death (116). Treatment with an angiotensinconverting 

enzyme inhibitor, even in normotensive patients, should be 

considered (117). 

10. Conclusion 

As with other types of organ transplantation, the major problem facing the 

field of renal transplantation is a shortage of organs due to declining rates of 

cadaveric heart-beating donors. Although the use of alternative sources of 

organs such as living donors and NHBDs is rising, at present this increase is only 

sufficient to keep the overall number of transplants performed static. Techniques 

to enable ABO-incompatible renal transplantation are expected to widen access 

to living donor kidneys, a high-quality source of grafts. With advances in immunosuppression 

and increasing long-term graft survival, the clinical focus is shifting 

to improving the quality of life of renal transplant recipients by minimizing 

immunosuppression-related side effects and preventing cardiovascular diseases. 

Despite this progress, CAN remains a significant problem. Further work on the 

prevention and early detection of CAN is essential if the significant gains in 

long-term renal graft survival seen over the last 20 yr are to continue. 

References 

1. Bradley, J. A. and Hamilton, D. N. H. (2001) Organ transplantation: an historical 

perspective, in Transplantation Surgery (Hakim, N. S. and Danovitch, G. M, eds.), 

Springer, London, p. 1. 

2. Evans, R. W., Manninen, D. L., Garrison, L. P., Jr., et al. (1985) The quality of 

life of patients with end-stage renal disease. N. Engl. J. Med. 312, 553–559. 

3. Valderrabano, F., Jofre, R., and Lopez-Gomez, J. M. (2001) Quality of life in endstage 

renal disease patients. Am. J. Kidney Dis. 38, 443–464. 

4. Wolfe, R. A., Ashby, V. B., Milford, E. L., et al. (1999) Comparison of mortality 

in all patients on dialysis, patients on dialysis awaiting transplantation, and recipients 

of a first cadaveric transplant. N. Engl. J. Med. 341, 1725–1730. 

5. Eggers, P. (1992) Comparison of treatment costs between dialysis and transplantation. 

Semin. Nephrol. 12, 284–289. 

6. Croxson, B. E. and Ashton, T. (1990) A cost effectiveness analysis of the treatment 

of end stage renal failure. NZ Med. J. 103, 171–174. 

7. Morris, P. J. (2001) Kidney Transplantation. Principles and Practice, W.B. 

Saunders, Philadelphia. 

8. Hariharan, S., Johnson, C. P., Bresnahan, B. A., Taranto, S. E., McIntosh, M. J., 

and Stablein, D. (2000) Improved graft survival after renal transplantation in the 

United States, 1988 to 1996. N. Engl. J. Med. 342, 605–612.


9. Hariharan, S., McBride, M. A., Cherikh, W. S., Tolleris, C. B., Bresnahan, B. A., 

and Johnson, C. P. (2002) Post-transplant renal function in the first year predicts 

long-term kidney transplant survival. Kidney Int. 62, 311–318. 

10. Pascual, M., Theruvath, T., Kawai, T., Tolkoff-Rubin, N., and Cosimi, A. B. 

(2002) Strategies to improve long-term outcomes after renal transplantation. N. 

Engl. J. Med. 346, 580–590. 

11. Monaco, A. P., Burke, J. F. Jr., Ferguson, R. M., et al. (1999) Current thinking on 

chronic renal allograft rejection: issues, concerns, and recommendations from a 

1997 roundtable discussion. Am. J. Kidney Dis. 33, 150–160. 

12. Opelz, G. (2000) Factors influencing long-term graft loss. The Collaborative 

Transplant Study. Transplant. Proc. 32, 647–649. 

13. Denton, M. D. and Singh, A. K. (2000) Recurrent and de novo glomerulonephritis 

in the renal allograft. Semin. Nephrol. 20, 164–175. 

14. Briggs, J. D. (2001) Causes of death after renal transplantation. Nephrol. Dial. 

Transplant. 16, 1545–1549. 

15. Papalois, V. E., Moss, A., Gillingham, K. J., Sutherland, D. E., Matas, A. J., and 

Humar, A. (2000) Pre-emptive transplants for patients with renal failure: an argument 

against waiting until dialysis. Transplantation 70, 625–631. 

16. White, S. A., Nicholson, M. L., and London, N. J. (1999) Vascularized pancreas 

allotransplantation—clinical indications and outcome. Diabet. Med. 16, 533– 

534. 

17. Roodnat, J. I., Zietse, R., Mulder, P. G., Rischen-Vos, J., van Gelder, T., Ijzermans, 

J. N., and Weimar, W. (1999) The vanishing importance of age in renal transplantation. 

Transplantation 67, 576–580. 

18. Schaubel, D., Desmeules, M., Mao, Y., Jeffery, J., and Fenton, S. (1995) Survival 

experience among elderly end-stage renal disease patients. A controlled comparison 

of transplantation and dialysis. Transplantation 60, 1389–1394. 

19. Kasiske, B. L., Cangro, C. B. , Hariharan, S., et al.; American Society of Transplantation 

(2002) The evaluation of renal transplantation candidates: clinical practice 

guidelines. Am. J. Transplant. 1 (Suppl. 2), 3–95. 

20. (1995) Criteria for the diagnosis of brain stem death. Review by a working group 

convened by the Royal College of Physicians and endorsed by the Conference of 

Medical Royal Colleges and their Faculties in the United Kingdom. J. R. Coll. 

Physicians Lond. 29,381–382. 

21. Wijdicks, E. F. (2001) The diagnosis of brain death. N. Engl. J. Med. 344, 1215– 

1221. 

22. Ojo, A. O., Hanson, J.A., Meier-Kriesche, H., et al. (2001) Survival in recipients 

of marginal cadaveric donor kidneys compared with other recipients and waitlisted 

transplant candidates. J. Am. Soc. Nephrol. 12, 589–597. 

23. Jerius, J. T., Taylor, R. J., Murillo, D., and Leone, J. P. (2000) Double renal transplants 

from marginal donors: 2-year results. J. Urol. 163, 423–425. 

24. Remuzzi, G., Grinyo, J., Ruggenenti, P., et al. (1999) Early experience with dual 

kidney transplantation in adults using expanded donor criteria. Double Kidney 

Transplant Group (DKG). J. Am. Soc. Nephrol. 10, 2591–2598.


25. Nyberg, S. L., Matas, A. J., Kremers, W. K., et al. (2003) Improved scoring system 

to assess adult donors for cadaver renal transplantation. Am. J. Transplant. 3, 

715–721. 

26. Perico, N., Ruggenenti, P., Scalamogna, M., Locatelli, G., and Remuzzi, G. (2002) 

One or two marginal organs for kidney transplantation? Transplant. Proc. 34, 

3091–3096. 

27. Persson, M. O., Persson, N. H., Kallen, R., Ekberg, H., and Hermeren, G. (2002) 

Kidneys from marginal donors: views of patients on informed consent. Nephrol. 

Dial. Transplant. 17, 1497–1502. 

28. Terasaki, P. I., Cecka, J. M., Gjertson, D W., and Takemoto, S. (1995) High survival 

rates of kidney transplants from spousal and living unrelated donors. N. 

Engl. J. Med. 333, 333–336. 

29. Najarian, J. S., Chavers, B. M., McHugh, L. E., and Matas, A. J. (1992) 20 years 

or more of follow-up of living kidney donors. Lancet 340, 807–810. 

30. Kasiske, B. L., Ma, J. Z., Louis, T. A., and Swan, S. K. (1995) Long-term effects 

of reduced renal mass in humans. Kidney Int. 48, 814–819. 

31. (2000). UK Guidelines for Living Donor Kidney Transplantation, British Transplantation 

Society, London, p. 1. 

32. Ratner, L. E., Ciseck, L. J., Moore, R. G., Cigarroa, F. G., Kaufman, H. S., and 

Kavoussi, L. R. (1995) Laparoscopic live donor nephrectomy. Transplantation 

60,1047–1049. 

33. Waller, J. R., Hiley, A. L., Mullin, E. J., Veitch, P S., and Nicholson, M. L. (2002) 

Living kidney donation: a comparison of laparoscopic and conventional open 

operations. Postgrad. Med. J. 78, 153–157. 

34. Ratner, L. E., Montgomery, R A., and Kavoussi, L. R. (1999) Laparoscopic live 

donor nephrectomy: the four year Johns Hopkins University experience. Nephrol. 

Dial. Transplant. 14, 2090–2093. 

35. Velidedeoglu, E., Williams, N., Brayman, K. L., et al. (2002) Comparison of open, 

laparoscopic, and hand-assisted approaches to live-donor nephrectomy. Transplantation 

74, 169–172. 

36. Lind, M. Y., Ijzermans, J. N., and Bonjer, H. J. (2002) Open vs. laparoscopic 

donor nephrectomy in renal transplantation. BJU Int. 89,162–168. 

37. Kuo, P. C. and Johnson, L. B. (2000) Laparoscopic donor nephrectomy increases 

the supply of living donor kidneys: a center-specific microeconomic analysis. 


38. Kootstra, G. (1995) Statement on non-heart-beating donor programs. Transplant 

Proc. 27, 2965–2965. 

39. Garcia-Rinaldi, R., Lefrak, E. A., Defore, W. W., et al. (1975) In situ preservation 

of cadaver kidneys for transplantation: laboratory observations and clinical application. 

Ann. Surg. 182, 576–584. 

40. Bos, M. A. (1995) Legal issues concerning the use of non-heart-beating donors. 

Transplant. Proc. 27, 2929–2931. 

41. Dunlop, P., Varty, K., Veitch, P. S., Nicholson, M. L., and Bell, P. R. (1995) Nonheart-beating 

donors: the Leicester experience. Transplant. Proc. 27, 2940–2941.


42. Cho, Y. W., Terasaki, P. I., Cecka, J. M., and Gjertson, D. W. (1998) Transplantation 

of kidneys from donors whose hearts have stopped beating. N. Engl. J. 

Med. 338, 221–225. 

43. Nicholson, M. L., Metcalfe, M. S., White, S. A., et al. (2000) A comparison of the 

results of renal transplantation from non-heart-beating, conventional cadaveric, 

and living donors. Kidney Int. 58, 2585–2591. 

44. Weber, M., Dindo, D., Demartines, N., Ambuhl, P. M., and Clavien, P. A. (2002) 

Kidney transplantation from donors without a heartbeat. N. Engl. J. Med. 347, 

248–255. 

45. Metcalfe, M. S., Butterworth, P. C., White, S. A., et al. (2001) A case-control 

comparison of the results of renal transplantation from heart-beating and nonheart-beating 

donors. Transplantation 71,1556–1559. 

46. Pirsch, J. D., Ploeg, R. J., Gange, S., et al. (1996) Determinants of graft survival 

after renal transplantation. Transplantation 61, 1581–1586. 

47. Kootstra, G. (1997) The asystolic, or non-heartbeating, donor. Transplantation 

63, 917–921. 

48. Hume, D. M., Merrill, J. P., Miller, B. F., and Thorn, G. W. (1955) Experiences 

with renal homotransplantation in the human: report of nine cases. J. Clin. Invest. 

34, 327–382. 

49. Starzl, T. E., Marchioro, T. L., Holmes, J. H., et al. (1964) Renal homografts in 

patients with major donor-recipient blood group incompatibilities. Surgery 

55,195–200. 

50. Slapak, M., Naik, R. B., and Lee, H. A. (1981) Renal transplant in a patient with 

major donor-recipient blood group incompatibility: reversal of acute rejection by 

the use of modified plasmapheresis. Transplantation 31, 4–7. 

51. Alexandre, G. P. J., Squifflet, J. P., Bruyere, M. D., et al. (1985) Splenectomy as 

a prerequisite for successful human ABO-incompatible renal transplantation. 


52. Takahashi, K. (2001) ABO-Incompatible Kidney Transplantation, Elsevier, 

Amsterdam. 

53. Shishido, S., Asanuma, H., Tajima, E., et al. (2001) ABO-incompatible livingdonor 

kidney transplantation in children. Transplantation 72, 1037–1042. 

54. Daniels, G. (1995) Human Blood Groups, Blackwell Science, Oxford. 

55. Nelson, P. W., Landreneau, M. D., Luger, A. M., et al. (1998) Ten-year experience 

in transplantation of A2 kidneys into B and O recipients. Transplantation 65, 

256–260. 

56. Schnuelle, P. and van der Woude, F. J. (1998) Should A2 kidneys be transplanted 

into B or O recipients? Lancet 351, 1675–1676. 

57. Sells, R. A. (1997) Paired-kidney-exchange programs. N. Engl. J. Med. 337, 1392– 

1393. 

58. Pleass, H. C., Clark, K. R., Rigg, K. M., et al. (1995) Urologic complications after 

renal transplantation: a prospective randomized trial comparing different techniques 

of ureteric anastomosis and the use of prophylactic ureteric stents. Transplant 

Proc. 27, 1091–1092.


59. Calne, R. Y. (1987) Cyclosporin in cadaveric renal transplantation: 5-year follow-up 

of a multicentre trial. Lancet. 2, 506–507. 

60. Curtis, J. J., Barbeito, R., Pirsch, J., Lewis, R. M., Van Buren, D. H., and Choudhury, 

S. (1999) Differences in bioavailability between oral cyclosporine formulations in 

maintenance renal transplant patients. Am. J. Kidney Dis. 34, 869–874. 

61. Knoll, G. A. and Bell, R. C. (1999) Tacrolimus versus cyclosporin for immunosuppression 

in renal transplantation: meta-analysis of randomised trials. BMJ 318, 

1104–1107. 

62. Halloran, P., Mathew, T., Tomlanovich, S., Groth, C., Hooftman, L., and Barker, 

C. (1997) Mycophenolate mofetil in renal allograft recipients: a pooled efficacy 

analysis of three randomized, double-blind, clinical studies in prevention of rejection. 

The International Mycophenolate Mofetil Renal Transplant Study Groups. 


63. Birkeland, S. A. (2001) Steroid-free immunosuppression in renal transplantation: a 

long-term follow-up of 100 consecutive patients. Transplantation 71, 1089–1090. 

64. Ahsan, N., Hricik, D., Matas, A., et al. (1999) Prednisone withdrawal in kidney 

transplant recipients on cyclosporine and mycophenolate mofetil—a prospective 

randomized study. Steroid Withdrawal Study Group. Transplantation 68, 1865– 

1874. 

65. Oberbauer, R., Kreis, H., Johnson, R. W., et al.; Rapamune Maintenance Regimen 

Study Group. (2003) Long-term improvement in renal function with sirolimus 

after early cyclosporine withdrawal in renal transplant recipients: 2-year results 

of the Rapamune Maintenance Regimen Study. Transplantation 76, 364–370. 

66. Watson, C. J. (2001) Sirolimus (rapamycin) in clinical transplantation. Transplant. 

Rev. 15, 165–168. 

67. Humar, A., Kerr, S., Gillingham, K. J., and Matas, A. J. (1999) Features of acute 

rejection that increase risk for chronic rejection. Transplantation 68, 1200–1203. 

68. Furness, P. N., Philpott, C. M., Chorbadjian, M. T., et al. (2003) Protocol biopsy 

of the stable renal transplant: a multicenter study of methods and complication 

rates. Transplantation 76, 969–973. 

69. Racusen, L. C., Colvin, R. B., Solez, K., et al. (2003) Antibody-mediated rejection 

criteria—an addition to the Banff 97 classification of renal allograft rejection. 

Am. J. Transplant. 3, 708–714. 

70. Racusen, L. C., Solez, K., Colvin, R. B., et al. (1999) The Banff 97 working classification 

of renal allograft pathology. Kidney Int. 55, 713–723. 

71. Roberts, I. S., Reddy, S., Russell, C., et al. (2004) Subclinical rejection and borderline 

changes in early protocol biopsy specimens after renal transplantation. 


72. Legendre, C., Thervet, E., Skhiri, H., et al. (1998) Histologic features of chronic 

allograft nephropathy revealed by protocol biopsies in kidney transplant recipients. 


73. Rush, D., Nickerson, P., Gough, J., et al. (1998) Beneficial effects of treatment of 

early subclinical rejection: a randomized study. J. Am. Soc. Nephrol. 9, 2129– 

2134.


74. Matas, A. J., Gillingham, K. J., Payne, W. D., and Najarian, J. S. (1994) The 

impact of an acute rejection episode on long-term renal allograft survival (t1/2). 


75. Simon, T., Opelz, G., Wiesel, M., Ott, R. C., and Susal, C. (2003) Serial peripheral 

blood perforin and granzyme B gene expression measurements for prediction 

of acute rejection in kidney graft recipients. Am. J. Transplant. 3, 1121–1127. 

76. Vasconcellos, L. M., Schachter, A. D., Zheng, X. X., et al. (1998) Cytotoxic lymphocyte 

gene expression in peripheral blood leukocytes correlates with rejecting 

renal allografts. Transplantation 66, 562–566. 

77. Lederer, S. R., Friedrich, N., Regenbogen, C., Getto, R., Toepfer, M., and Sitter, 

T. (2003) Non-invasive monitoring of renal transplant recipients: urinary excretion 

of soluble adhesion molecules and of the complement-split product C4d. 

Nephron Clin. Pract. 94, 19–26. 

78. Magee, C. C., Denton, M. D., Womer, K. L., Khoury, S. J., and Sayegh, M. H. 

(2004) Assessment by flow cytometry of intracellular cytokine production in the 

peripheral blood cells of renal transplant recipients. Clin. Transplant. 18, 395– 

401. 

79. Hricik, D. E., Rodriguez, V., Riley, J., et al. (2003) Enzyme linked immunosorbent 

spot (ELISPOT) assay for interferon-gamma independently predicts renal function 

in kidney transplant recipients. Am. J. Transplant. 3, 878–884. 

80. Gaber, A. O., First, M. R., Tesi, R. J., et al. (1998) Results of the double-blind, 

randomized, multicenter, phase III clinical trial of thymoglobulin versus Atgam 

in the treatment of acute graft rejection episodes after renal transplantation. Transplantation 

66, 29–37. 

81. Midtvedt, K., Fauchald, P., Lien, B., et al. (2003) Individualized T cell monitored 

administration of ATG versus OKT3 in steroid-resistant kidney graft rejection. 

Clin. Transplant. 17, 69–74. 

82. Casadei, D. H., del C Rial, M., Opelz, G., et al. (2001) A randomized and prospective 

study comparing treatment with high-dose intravenous immunoglobulin with 

monoclonal antibodies for rescue of kidney grafts with steroid-resistant rejection. 


83. Vincenti, F., Kirkman, R., Light, S., et al. (1998) Interleukin-2-receptor blockade 

with daclizumab to prevent acute rejection in renal transplantation. Daclizumab 

Triple Therapy Study Group. N. Engl. J. Med. 338,161–165. 

84. Nashan, B., Moore, R., Amlot, P., Schmidt, A. G., Abeywickrama, K., and 

Soulillou, J. P. (1997) Randomised trial of basiliximab versus placebo for control 

of acute cellular rejection in renal allograft recipients. CHIB 201 International 

Study Group. Lancet 350, 1193–1198. 

85. Chilcott, J. B., Holmes, M. W., Walters, S., Akehurst, R. L., and Nashan, B. (2002) 

The economics of basiliximab (Simulect) in preventing acute rejection in renal 

transplantation. Transplant. Int. 15, 486–493. 

86. Lederer, S. R., Kluth-Pepper, B., Schneeberger, H., Albert, E., Land, W., and 

Feucht, H. E. (2001) Impact of humoral alloreactivity early after transplantation 

on the long-term survival of renal allografts. Kidney Int. 59, 334–341.


87. Nickeleit, V., Zeiler, M., Gudat, F., Thiel, G., and Mihatsch, M. J. (2002) Detection 

of the complement degradation product C4d in renal allografts: diagnostic 

and therapeutic implications. J. Am. Soc. Nephrol. 13, 242–251. 

88. Mauiyyedi, S., Crespo, M., Collins, A. B., et al. (2002) Acute humoral rejection 

in kidney transplantation: II. Morphology, immunopathology, and pathologic 

classification. J. Am. Soc. Nephrol. 13, 779–787. 

89. Nickeleit, V. and Mihatsch, M. J. (2003) Kidney transplants, antibodies and rejection: 

is C4d a magic marker? Nephrol. Dial. Transplant. 18, 2232–2239. 

90. Shah, A., Nadasdy, T., Arend, L., et al. (2004) Treatment of C4d-positive acute 

humoral rejection with plasmapheresis and rabbit polyclonal antithymocyte 

globulin. Transplantation 77, 1399–1405. 

91. Vella, J. P., O’Neill, D., Atkins, N., Donohoe, J. F., and Walshe, J. J. (1998) Sensitization 

to human leukocyte antigen before and after the introduction of erythropoietin. 

Nephrol. Dial. Transplant. 13, 2027–2032. 

92. Karpinski, M., Pochinco, D., Dembinski, I., Laidlaw, W., Zacharias, J., and 

Nickerson, P. (2004) Leukocyte reduction of red blood cell transfusions does not 

decrease allosensitization rates in potential kidney transplant candidates. J. Am. 

Soc. Nephrol. 15, 818–824. 

93. Doxiadis, I. I., De Meester, J., Smits, J. M., et al. (1998) The impact of special 

programs for kidney transplantation of highly sensitized patients in Eurotransplant. 

Clin. Transplant. 115–120. 

94. Duquesnoy, R. J., Howe, J., and Takemoto, S. (2003) HLAmatchmaker: a molecularly 

based algorithm for histocompatibility determination. IV. An alternative strategy 

to increase the number of compatible donors for highly sensitized patients. 


95. Jordan, S. C., Vo, A., Bunnapradist, S., et al. (2003) Intravenous immune globulin 

treatment inhibits crossmatch positivity and allows for successful transplantation 

of incompatible organs in living-donor and cadaver recipients. Transplantation 

76, 631–636. 

96. Thibaudin, D., Alamartine, E., de Filippis, J. P., Diab, N., Laurent, B., and 

Berthoux, F. (1998) Advantage of antithymocyte globulin induction in sensitized 

kidney recipients: a randomized prospective study comparing induction with and 

without antithymocyte globulin. Nephrol. Dial. Transplant. 13, 711–715. 

97. Higgins, R. M., Bevan, D. J., Carey, B. S., et al. (1996) Prevention of hyperacute 

rejection by removal of antibodies to HLA immediately before renal transplantation. 

Lancet 348, 1208–1211. 

98. Montgomery, R. A., Zachary, A. A., Racusen, L. C., et al. (2000) Plasmapheresis 

and intravenous immune globulin provides effective rescue therapy for refractory 

humoral rejection and allows kidneys to be successfully transplanted into crossmatch-positive 

recipients. Transplantation 70, 887–895. 

99. Brennan, D. C. (2001) Cytomegalovirus in renal transplantation. J. Am. Soc. 

Nephrol. 12, 848–855. 

100. Hirsch, H. H., and Steiger, J. (2003) Polyomavirus BK. Lancet Infect. Dis. 3, 

611–623.


101. Kazory, A., and Ducloux, D. (2003). Renal transplantation and polyomavirus 

infection: recent clinical facts and controversies. Transplant. Infect. Dis. 5, 

65–71. 

102. Hirsch, H. H., Knowles, W., Dickenmann, M.,et al. (2002) Prospective study of 

polyomavirus type BK replication and nephropathy in renal-transplant recipients. 

N. Engl. J. Med. 347, 488–496. 

103. Lin, P. L., Vats, A. N., and Green, M. (2001) BK virus infection in renal transplant 

recipients. Pediatr. Transplant. 5, 398–405. 

104. Foley, R. N., Parfrey, P. .S, and Sarnak, M. J. (1998) Clinical epidemiology of 

cardiovascular disease in chronic renal disease. Am. J. Kidney Dis. 32(5 Suppl. 

3), S112–S119. 

105. Raine, A. E., Margreiter, R., Brunner, F. P., et al. (1992) Report on management 

of renal failure in Europe, 22, 1991. Nephrol. Dial. Transplant. 7(Suppl. 2), 7– 

35. 

106. Kasiske, B. L., Chakkera, H. A., and Roel, J. (2000) Explained and unexplained 

ischemic heart disease risk after renal transplantation. J. Am. Soc. Nephrol. 11, 

1735–1743. 

107. Foley, R. N. (2003) Clinical epidemiology of cardiac disease in dialysis patients: 

left ventricular hypertrophy, ischemic heart disease, and cardiac failure. Semin. 

Dial. 16, 111–117. 

108. Holdaas, H., Fellstrom, B., Jardine, A. G., et al.; Assessment of LEscol in Renal 

Transplantation (ALERT) Study Investigators (2003) Effect of fluvastatin on 

cardiac outcomes in renal transplant recipients: a multicentre, randomised, placebo-controlled 

trial. Lancet 361, 2024–2031. 

109. Kwak, B., Mulhaupt, F., Myit, S., and Mach, F. (2000) Statins as a newly recognized 

type of immunomodulator. Nat. Med. 6, 1399–1402. 

110. Holdaas, H. and Jardine, A. (2003) Acute renal allograft rejections, a role for 

statins? Minerva Urol. Nefrol. 55, 111–119. 

111. Kasiske, B. L., Vazquez, M. A., Harmon, W. E., et al. (2000) Recommendations 

for the outpatient surveillance of renal transplant recipients. American Society 

of Transplantation. J. Am. Soc. Nephrol. 11 (Suppl. 15), S1–86. 

112. EBPG Expert Group on Renal Transplantation (2002) European best practice 

guidelines for renal transplantation. Section IV: long-term management of the 

transplant recipient. IV.5.4. Cardiovascular risks. Post-transplant diabetes mellitus. 

Nephrol. Dial. Transplant. 17 (Suppl. 4), 28. 

113. Ducloux, D., Motte, G., Challier, B., Gibey, R., and Chalopin, J. M. (2000) Serum 

total homocysteine and cardiovascular disease occurrence in chronic, stable renal 

transplant recipients: a prospective study. J. Am. Soc. Nephrol. 11,134–137. 

114. EBPG Expert Group on Renal Transplantation (2002). European best practice 

guidelines for renal transplantation. Section IV: Long-term management of the 

transplant recipient. IV.5.5. Cardiovascular risks. Hyperhomocysteinaemia. 

Nephrol. Dial. Transplant. 17 (Suppl. 4), 28. 

115. Ducloux, D., Kazory, A., and Chalopin, J. M. (2004) Predicting coronary heart disease 

in renal transplant recipients: a prospective study. Kidney Int. 66, 441–447.


116. Roodnat, J. I., Mulder, P. G., Rischen-Vos, J., van Riemsdijk, I. C., van Gelder, 

T., Zietse, R., IJzermans, J. N., and Weimar, W. (2001) Proteinuria after renal 

transplantation affects not only graft survival but also patient survival. Transplantation 

72, 438–444. 

117. Bostom, A. D., Brown, R. S. Jr., Chavers, B. M., et al. (2002) Prevention of posttransplant 

cardiovascular disease—report and recommendations of an ad hoc 

group. Am. J. Transplant. 2, 491–500.

Transplantation Immunology

METHODS IN MOLECULAR BIOLOGY 333 



Methods and and Protocols 

Edited by 


Marlene Rose

Status of Liver Transplantation 29 

2 

Current Status of Liver Transplantation 

Peter J. Friend and Charles J. Imber 

Summary 

Liver transplantation has become the treatment of choice for a wide range of endstage 

liver disease. As outcomes have improved, so the demand for this therapy has 

increasingly exceeded the availability of donor organs. Access to liver transplantation is 

controlled such that donor organs are generally allocated to the patients who are likely to 

benefit most, although if all patients who might benefit were placed on the waiting list, 

the donor shortage would be greatly increased. 

Recurrence of the original liver disease is emerging as an important issue. Fewer patients 

are transplanted for liver tumors, as earlier results showed a very high rate of recurrence. 

In recent years there has been a change in the underlying conditions of patients on 

the waiting list, and a preponderance of patients now present with hepatitis C and alcoholic 

cirrhosis. 

Increasingly, transplant units are looking to sources of donor organs that would previously 

have been deemed unsuitable—such marginal donors include non-heart-beating 

donors (NHBDs). Results from controlled NHBDs—those cases in which cardiac arrest 

is predicted—suggest that this is a good source of viable organs. 

Splitting a donor liver to provide two grafts has successful enabled the transplantation 

of a child and an adult from one organ. The transplantation of two adults from a 

single organ remains a greater challenge. 

Transplantation from living donors has been practiced increasingly over the last decade, 

although anxieties have been expressed over donor safety. In many countries this now 

represents a significant contribution to overall liver transplant activity. 

Key Words: Liver; transplantation; donor; allocation; indications. 

1. Historical Perspective 

The first human liver transplant was performed on March 1, 1963, at the 

University of Colorado on a 3-yr-old boy suffering with biliary atresia (1). He 

died before the operation was completed; it was not until 1967 that the first 



29

30 Friend and Imber 

meaningful survival was reported (2). Between 1967 and 1980, 170 liver transplants 

were performed at the University of Colorado, and between 1968 and 

1983, 138 transplants took place in Cambridge, England (2), with 1-yr survival 

rates of approx 30%. With the emergence of cyclosporine, pioneered by Borel 

and Calne, as well as gradual refinements of various technical aspects, particularly 

bile duct reconstruction and coagulation support, outcome figures improved. 

In 1983, a National Institutes of Health (NIH) Consensus Conference concluded 

that liver transplantation was now a therapeutic option for patients with 

end-stage liver disease, rather than an experimental procedure (3). This led to a 

rapid expansion of the number of patients referred for liver transplantation 

worldwide. Five years after the NIH conference, 616 patients awaited liver 

transplants in the United States. Ten years later, this number had increased to 

12,056. 

Since the early 1980s, there have been significant advances in all aspects of 

liver transplantation, including recipient selection, donor management, operative 

technique, immunosuppression, and postoperative management of liver 

recipients. These changes, which have marked the evolution from an experimental 

technique to established and routine therapy, have resulted in enormous 

improvements in outcome. The overall 1-yr survival for adults and pediatric 

orthotopic liver transplants is now expected to be in excess of 85%, with 5- and 

10-yr survival in excess of 70 and 60%, respectively (4–7). Partly as a consequence 

of this improved outcome, the selection criteria have broadened, leading 

to changes in the demographics of the patient population. 

2. Current Indications for Liver Transplantation 

The goal of liver transplantation is not only to prolong life, but also to improve 

the quality of life. The selection of patients to achieve these goals and the ideal 

time at which to intervene during the course of chronic liver disease remain 

among the greatest challenges for the transplant team. The current indications 

for liver transplantation can be categorized as follows: advanced chronic liver 

disease, fulminant hepatic failure, inherited metabolic liver disease, and liver 

tumors. 

Controversy exists over transplantation for alcoholic liver disease, hepatitis 

B, hepatitis C, and hepatic malignancy because of the risk of recurrent disease 

and consequent reduced long-term survival. There has been much ethical 

debate in relation to the use of a scarce resource in both patients with selfinflicted 

diseases and conditions with a high probability of recurrence. 

Neuberger and colleagues clearly demonstrated the difficulties faced in attempting 

to allocate such a scarce resource (8). This study showed that the priorities of 

the public differed from those of the medical profession. The former placed 

greater emphasis on factors such as age of recipient, whereas doctors felt that


outcome and value to society were a greater priority. Patients who displayed 

traits consistent with antisocial behavior (e.g., alcoholism) were given a low 

level of importance by all. In general, the indications for liver transplantation 

can be defined as either an intolerable quality of life (because of the liver disease) 

or an anticipated length of life of less than 1 yr because of liver failure. 

3. Organ-Allocation Policies 

Various schemes have evolved to allocate organs with some reference to 

urgency. In the United States, the Model for End-Stage Liver Disease (MELD) 

score, based on serum creatinine, bilirubin, and international normalized ratio 

(INR), was developed initially during a retrospective study at the Mayo Clinic 

of patients undergoing transhepatic portosystemic shunts (TIPS). It was subsequently 

validated as a determinant of short-term prognosis in patients with 

chronic liver disease (9) and utilized as a disease severity index. In February 

2002, the MELD score was implemented by the United Network for Organ 

Sharing (UNOS) as a criterion for organ allocation to adult patients with 

chronic liver disease followed the ruling of the Department of Health that allocation 

be conducted according to medical urgency. Priority is still given to 

status 1 patients (fulminant hepatic failure or early graft failure following transplantation 

requiring emergency re-transplantation); these remain a local and 

regional priority. After these patients, livers are offered to patients based upon 

their probability of candidate death derived from MELD scores. With a MELD 

score of 6 or less, the time on the waiting list is also used as a prioritization 

factor (10). Early reports indicate that this allocation system based on medical 

severity may reduce the number of deaths on the waiting list (11). 

In the United Kingdom, four fundamental concepts underpin the allocation 

policy, as agreed at the Edinburgh colloquium in 1996 (12). First, guidelines 

need to be drawn up and agreed on by all those involved. Second, the main 

criteria for selection must be based on quality of life and anticipated life 

expectancy. Third, patients selected for transplantation should have a more 

than a 50% probability of being alive 5 yr after the transplant. Finally, livers 

are allocated to give the maximum outcome (in preference to every potential 

recipient having equal share of the donor pool by right). Thus, it is generally 

agreed that organ allocation should be based on utilitarian rather than 

deontological principles. 

In UK practice, certain patients (those with either fulminant liver failure or 

primary nonfunction of a transplant—the equivalent of UNOS status 1) have 

national priority (these patients are deemed “super-urgent”). Thereafter, livers 

are offered first to the retrieving unit and then, if there is no suitable recipient 

locally, around the rest of the country on a continually rolling priority based on 

the balance of net export at each individual center. Thus, livers are allocated to


the most urgent patients on an individual basis (i.e., ad hominem), but otherwise 

all livers are allocated to the transplant unit (rather than to the individual 

patient). At a local level, individual patient prioritization is usually established 

at a multidisciplinary meeting. These difficult decisions are based on the principles 

outlined above, with general co-morbidity of the recipient, length of 

time on the waiting list, as well as disease progression all taken into account. If 

a patient’s condition deteriorates while on the list, it may be necessary to consider 

removing him or her from the active waiting list. Effective communication 

not only between members of the medical team but also with the patient 

and his or her family is clearly essential at every level of the process. 

In addition to blood group matching and, to some extent, size matching, the 

selection of the recipient for a particular donor organ may also be affected by 

the quality of the liver on offer. In the interests of obtaining the maximum 

benefit for the maximum number of patients, there is a strong argument to 

utilize organs from the better donors in the sicker recipients—the patients who 

are least able to tolerate a poorly functioning transplant in the immediate postoperative 

period. Healthier recipients are more able to cope with the period of 

poor initial graft function that can be associated with the use of a marginal liver 

(see below). This is now a generally accepted principle in the interests of 

obtaining the maximum benefit from the limited donor supply, but one that 

clearly poses ethical issues on occasions. 

4. Hepatitis C/HIV Infection 

There has been a clear shift in indications for transplantation in the last 15 yr, 

with a continued increase in non-cholestatic liver diseases predominantly made 

up of hepatitis C and alcoholic liver disease. In the United States, the proportion 

of recipients with hepatitis C virus (HCV) infection increased from 12 to 37% 

between 1990 and 2000, with a similar increase in the number and proportion of 

liver transplant candidates registered with hepatitis C on the waiting list (13). 

According to the UNOS, in 2001 there were 9783 patients with hepatitis C awaiting 

a cadaveric liver transplant. Combined infection with hepatitis B or C and 

HIV (contracted together through either sexual or intravenous routes) has led to 

a cohort of such patients with chronic liver failure being considered for transplantation. 

Reservations have been voiced because of the potential for reemergence 

of hepatitis in CD4-deficient recipients, as well as the use of a scarce 

resource in an individual with a preexisting life-limiting disease. However, with 

continual improvements in anti-retroviral medication in HIV (the use of protease 

inhibitors in combination with non-nucleoside reverse-transcriptase inhibitors), 

there is now a greatly improved life expectancy with this condition. This 

allows many patients coinfected with HIV and hepatitis B/C to be considered 

for liver transplantation with reasonable prospects for survival.


A recent report on HCV-infected liver transplant recipients estimated the 

risk of developing recurrent cirrhosis to be as high as 44% at 5 yr posttransplant 

(14). Berenguer et al. reported data from the UNOS registry demonstrating that 

5-yr graft survival in recipients transplanted for hepatitis C was 56.8%, the 

worst of all indications with the exception of malignancy (14). Antiviral agents 

(interferon, including pegylated interferons, ribavarin, or combinations) have 

a low rate of success because of poor patient tolerance, side effects, or a limited 

and/or transient response. 

In contrast, significant progress has been achieved in the outcome of hepatitis 

B virus (HBV)-infected liver recipients with the use of current HBV antiviral 

agents. Han and colleagues reported negative hepatitis B surface antigen 

serology in 98.3% of patients after transplantation using intramuscular antihepatitis 

B immunoglobulin and lamivudine (15). 

5. Tumors 

Another major demographic shift is the reduction in the proportion of patients 

transplanted for primary liver cancer. This diagnosis is clearly associated with 

poor outcome because of recurrent disease. In the European Liver Transplant 

Registry (ELTR) data, the 1-, 5-, and 9-yr patient survivals for patients with 

cirrhosis (79, 69, and 62%) are significantly better than for patients treated for 

primary liver cancer (67, 40, and 26%). With improvements in imaging technology, 

as well as the adoption of defined selection policies, the proportion of 

livers being transplanted for cancer is falling. 

6. Retransplantation 

In recent years there has been a significant decrease in the number of retransplants 

performed. This reflects improvements in every step of the transplant 

process, including choice of donors, preservation fluids, surgical techniques, 

and, perhaps most important, postoperative recipient management and immunosuppressive 

protocols. This issue was addressed by Clemente et al. (16) in a 

large retrospective analysis covering more than a decade. They demonstrated 

a shift in the major cause of retransplantation from chronic rejection to primary 

graft failure, with 5-yr actuarial survival rates dependent on the cause 

of graft failure (45.5% for chronic rejection and 19.4% for primary failure) 

(16). Graft loss caused by rejection is now uncommon after liver trans-plantation. 

The incidence of chronic rejection in 1048 liver recipients followed for 

a mean period of more than 6 yr was only 3% (17). In a randomized trial 

comparing cyclosporine with tacrolimus after liver transplantation (the 

Tacrolimus vs Microemulsified Ciclosporin [TMC] study), the incidence of 

chronic rejection was only 0.3% in the tacrolimus group (18). Another study 

concluded that chronic rejection does not occur in the pediatric liver recipi-


ent population as long as baseline immunosuppression with tacrolimus is 

maintained (19). 

7. Immunosuppression 

The mainstay of post-liver-transplant immunosuppression is triple therapy 

with a calcineurin inhibitor (usually tacrolimus), together with an anti-proliferative 

agent (mycophenolate or azathioprine) and a corticosteroid (prednisolone). 

Increasingly, clinicians are tailoring the immunosuppressive regimen to 

the individual recipient. For example, faster withdrawal of corticosteroids has 

been shown to be efficacious in recipients transplanted for hepatitis B, where 

the drug is known to increase viral replication (20). In contrast, prolonged lowdose 

steroid use in autoimmune hepatitis has been shown to reduce disease 

recurrence in the graft (21). 

Particularly since publication of the TMC study in October 2002, the large 

majority of liver units have preferentially used tacrolimus over cyclosporine as 

a first-line calcineurin inhibitor (18). This randomized prospective multicenter 

study of 606 patients demonstrated a significantly better graft and patient survival 

at 1 yr in patients on tacrolimus. The combined primary endpoint of death, 

retransplantation, or treatment failure (owing to rejection) was reached in 21% 

patients on the tacrolimus arm and 32% in the cyclosporine arm of the trial— 

a significant difference. 

Tolerance remains the goal of the transplant physician. There is evidence 

that some patients are able to have immunosuppression withdrawn and yet 

maintain adequate graft function. Starzl’s group in Pittsburgh have proposed 

that dissemination of donor leukocytes (including pluripotent stem cells) occurs 

from allografts inducing donor/recipient nonreactivity. A series of 95 recipients 

was reported in which weaning from immunosuppression was attempted (22). 

These patients were all more than 5 yr from transplant and had stable graft 

function. At the time of the report, 20% were drug free up to 4.5 yr later, and 

39% remained in the weaning process. Twenty-six percent of patients required 

reinstitution of their immunosuppression for biopsy-proven or presumed acute 

rejection. Chronic rejection was not seen. This group has also described specific 

genetic polymorphisms of tumor necrosis factor (TNF)-α and interleukin 

(IL)-10 in children that have been successfully weaned from immunosuppression 

after liver transplantation (23). 

Other tolerance-induction strategies have been attempted in animals, including 

total body irradiation, costimulation blockade, development of chimerism, 

and lymphocyte depletion using a variety of monoclonal and polyclonal antibodies. 

Buhler and colleagues recently published a case report of combined 

human leukocyte antigen (HLA)-matched donor bone marrow and renal allotransplantation. 

This is the first example of an intentional and clinically appli-


cable approach to inducing renal allograft tolerance achieving potent and sustained 

antitumor effects in patients with multiple myeloma (24). 

8. Donors 

The biggest obstacle to the continued expansion of liver transplantation is 

the increasing gap between waiting lists and organ availability. If localized 

primary liver tumors, alcoholic liver disease, and allograft failure are accepted 

as indications, the demand for liver transplants has been calculated to be 25 per 

million population (25). Using current donor criteria, no more than 80% of all 

donor livers can be used (25); thus, depending on donor incidence, between 30 

and 80% of the patient demand can be met. In 2001, 1978 potential liver recipients 

died on the waiting list in the United States without receiving a graft 

(UNOS database). 

On first consideration, the prospects for the future are not encouraging. Donor 

numbers have decreased because of a progressive (and welcome) fall in the two 

leading causes of brain death in the United Kingdom: head injury from road 

traffic accidents and intracranial hemorrhage (26). Between 1989 and 1992, 

the annual number of donors in the United Kingdom resulting from road traffic 

accidents fell from 279 to 194, a decrease of 30%. The situation is further 

complicated by changes in neurosurgical practice. Improvements in imaging 

and shortage of intensive care beds have resulted in a more restrictive policy in 

the transfer of patients to regional neurosurgical units: patients with a very 

poor prognosis can now be identified at an early stage. For this reason many 

patients who would previously have been assessed in a neurosurgical intensive 

care unit are no longer identified as potential donors (27). 

A number of strategies are evolving to address the current situation. These 

include the use of organs from marginal donors (those outside the criteria previously 

used in respect to age, co-morbid condition, and cardiovascular stability), 

organs from NHBDs, the more extensive use of liver splitting (to obtain 

two transplants from one donor liver), and the transplantation of organs from 

living donors. Each of these potential solutions raises specific clinical and ethical 

issues. 

9. Marginal Donors 

What constitutes a “marginal donor” remains controversial, and different 

transplant units have developed their own arbitrary policies to determine whether 

a liver is used or discarded based on broadly accepted guidelines. A selection of 

10 major studies in the last decade on this subject includes no less than 32 separate 

parameters in the various definitions. These include preexisting liver damage 

(steatosis, obesity, alcohol, deranged liver function tests), adverse lifestyle 

(drug abuse, homosexual practice), age, hemodynamic instability (hypotension,


inotrope use, cardiac arrest, NHBDs), risks of sepsis and malignancy, and others 

(length of stay on intensive therapy unit [ITU], malnutrition, hypernatremia). 

Widening the acceptance criteria in an effort to expand the donor pool has 

become a necessity. The use of livers from marginal donors has been shown in 

several studies to lead to an increased risk of primary graft dysfunction (28– 

31). This term encompasses both catastrophic primary nonfunction, resulting in 

death or retransplantation in the first week, or impaired primary function manifest 

as a coagulation disturbance and increased transaminase levels and resulting 

in prolonged ITU stay and increased requirement for renal support (and 

greatly increased cost). 

Both primary nonfunction and impaired primary function represent the clinical 

manifestations of cumulative injury derived from the period of brain death 

within the donor, subsequent warm/cold ischemia during preservation, and 

reperfusion at the time of transplantation. 

A recent study from Birmingham suggested that the two most important independent 

donor variables that correlate with graft dysfunction are macrosteatosis 

(>30% on histopathological analysis) and donor age (32). In the study the outcome 

with such marginal organs could be dramatically improved if cold 

ischemia time was restricted to no more than 12 h. Strasberg et al. reaffirmed 

this association by describing cold preservation time, steatosis, and donor age 

as the only three parameters with a proven relationship to early graft outcome, 

the others having an uncertain relationship that required further evaluation (33). 

10. Reduced-Size Liver Transplantation 

Size reduction of an adult liver was implemented initially to overcome the 

need for size-matched grafts in pediatric recipients. The technique was introduced 

clinically in 1981, and the first successful transplant of part of a liver 

was reported by Bismuth and Houssin, who transplanted the left lobe from an 

adult to a child in 1984 (34). Further experience at several centers suggested 

that the use of the left lateral segment (segments II and III) taken from an adult 

donor would provide an ideal-sized graft for a small child and that the results 

were comparable to whole size-matched grafts (35). An additional refinement, 

reported from both Europe and Australia, was the retention of the recipient 

vena cava, to which the venous outflow (the left hepatic vein) of the graft was 

anastomosed (36,37). This allowed even larger donor-to-recipient size mismatches 

as well as retaining a right hemi-liver with intact vena cava. This 

enabled the concept of liver splitting and, subsequently, living donation. 

10.1. Liver Reduction 

Liver reduction involves transplantation of part of the liver, the remaining 

liver being discarded. It is a solution to size discrepancy, but does not affect the


overall availability of donor organs. Liver transplantation from reduced livers 

(as opposed to split livers) is now usually restricted to left liver grafts (segments 

I–IV), usually including the donor cava, and left lateral segmental grafts 

(segments II–III), excluding the vena cava. Generally, if a right lobe graft 

would fit, then the entire liver would be suitable. The technique has been 

developed further by the transplantation of a single hepatic segment—either 

segment II or segment III (38). 

Patient and graft survival is equivalent to, and in some circumstances better 

than, survival after full-size grafting (39). Rates of arterial thrombosis are lower 

when a pediatric recipient receives a reduced adult graft rather than a cadaveric 

whole pediatric graft, presumably because of the larger caliber of the donor 

vessel (40). Conversely, the presence of a cut surface increases the rate of 

bleeding and bile leaks in the reduced grafts. The development of liver reduction 

has made possible a reduction in pretransplant deaths in small children 

from 25% in 1989 to less than 10% today (41). This technique also led directly 

to the surgical techniques necessary for liver splitting and living donor transplants. 

11. Split Liver Transplantation 

Split liver transplantation, first reported by Pichlmayr et al. in 1988 (42), 

has the advantage of providing not only organs suitable for small children, but 

also additional transplants suitable for small adults. Usually, the adult would 

receive the right-liver graft including segment IV with the inferior vena cava 

attached and a child the left lateral segment. Segment I (the caudate lobe) is 

either preserved or discarded, depending on local preference. 

Transplants have also been performed of two adult recipients using a single 

split liver. In these cases, segment IV is retained with the left lobe. The main 

technical challenge is to provide an adequate mass of liver tissue to both recipients: 

the left lobe (typically 40% of the liver mass) is sufficient only for a 

recipient of small body mass. Postoperative liver function can be predicted 

based on the transplanted liver mass as a proportion of the weight of the recipient. 

A proportion of 1% (transplantation of a 700-g liver lobe into a 70-kg 

patient) is considered a safe limit. 

Although usually performed as an ex vivo procedure (the operation is performed 

on the explanted, cooled liver), the splitting procedure can also be performed 

in situ during the donor-procurement procedure. This has the 

advantages of less preservation injury (shorter cold ischemia time) and improved 

hemostasis of the cut surface (25). Ex vivo splitting is also associated with a 

higher rate of biliary complications (22% vs 27%) compared with whole-organ 

(4%) or in situ split grafts (0% vs 3%) (43). However, the logistics are complex 

because of the considerably prolonged donor operation and the necessity of a


very experienced retrieval team. It places enormous additional strain on the 

already stretched resources of liver-retrieval teams, other transplant teams, and 

donor hospitals. The ex situ technique is therefore generally employed, with 

the procedure performed once the liver has been returned to the transplanting 

center. 

The early experience of liver splitting involved application of the new procedure 

in high-risk patients, often as a desperate measure; this was reflected in 

a high morbidity rate (44). Between January 1987 and June 1999 a total of 

1036 split grafts (mostly ex situ) was transplanted in 898 patients. In adults, the 

1-yr patient and graft survival rates were 68 and 60%, respectively. In children 

(


whereby patients with catastrophic cerebral injury are identified at an early 

stage and allowed to die following withdrawal of medical support. These 

patients, therefore, are usually not diagnosed as brain dead, and death occurs 

and is defined by cardiac arrest. Because cardiac arrest in these donors is predicted, 

it is possible to prepare the transplant team and to await the moment of 

death. Such donors are, therefore, termed “controlled” NHBDs. Other situations 

are unpredictable (e.g., the cardiac arrest that occurs outside the hospital 

or in the emergency department), usually preceded by an unsuccessful attempt 

at cardiac resuscitation. The logistics of organ retrieval in such cases are more 

complex. These organ donors are termed “uncontrolled” NHBDs. 

Many ethical issues are involved in retrieval of organs from NHBDs. The 

points of potential conflict of interest (between care of the donor and recipient) 

include intervention prior to declaration of death and the duration of mandatory 

no-touch period after cardiac arrest before organ retrieval. The clinical 

and moral requirements governing NHBD cadaveric organ-procurement policy 

can be summarized as follows: (1) organs can only be taken from donors who 

are dead; (2) the care of the living must never be compromised in favor of 

potential recipients; and (3) informed consent must be obtained prior to retrieval. 

In HBDs death is defined by neurological criteria, whereas in NHBDs death 

is declared only after cardiac arrest. Thus, a fundamental difference between 

HBDs and NHBDs is that, until the moment after cardiac arrest, the NHBD is 

alive. The rationale for the mandatory “hands-off period” is to delay any intervention 

until such time as any central neurological activity, present before cardiac 

arrest, will have ceased beyond doubt. 

The time between cardiac arrest and the start of the organ-retrieval process 

varies in different institutions: intervals ranging from no waiting to 10 min 

have been reported. The first international workshop in Maastricht, Netherlands, 

held in 1995 recommended that a 10-min period after cardiopulmonary 

arrest be allowed before intervention by the transplant team. However, there is 

evidence that the 10-min no-intervention period contributes to an increased 

incidence of primary nonfunction and delayed graft function. 

Clinical experience with NHBD liver transplantation is limited (46–48). Under 

controlled circumstances, with shorter warm ischemia times, the results are 

acceptable (49). In an uncontrolled setting, when cardiac arrest occurs outside 

the operating room, results have been poor with a high rate of primary nonfunction 

(47). Otero and colleagues reported a primary nonfunction rate of 20% 

in 20 grafts from Maastricht category 2 (uncontrolled) NHBDs (50); the corresponding 

primary nonfunction rate in 40 HBDs was 2%. Most of the successful 

cases reported from this group utilized continuous in vivo perfusion with cardiopulmonary 

bypass or chest compressions with oxygenation. It is likely that 

this provides some recovery of cellular energy stores prior to cold storage.


14. Auxiliary Liver Transplantation 

There are two situations in which it is logical to transplant a donor liver but 

to preserve part of the patient’s own liver: transplantation for fulminant liver 

failure and transplantation for metabolic liver disease. 

In many patients with fulminant liver failure, regeneration of hepatocytes 

leads to recovery and avoids the need for transplantation—the operation is indicated 

in those patients who are unlikely to survive long enough for adequate 

regeneration to occur. The objective in auxiliary liver transplantation is to transplant 

enough healthy functioning liver tissue to bridge the patient over the period 

of acute liver failure while allowing the native liver time to recover. 

In patients with certain metabolic disorders, liver transplantation has been 

recommended in order to provide one liver-specific enzyme—the function of 

the liver is otherwise normal. It may be possible to provide adequate levels of 

enzyme function by transplanting part of a donor liver (34). Examples of such 

metabolic defects include Crigler–Najjar syndrome type I (51), ornithine transcarbamylase 

deficiency (52), and propionic acidemia (53). 

The advantages of auxiliary transplantation in these circumstances are clear— 

the patient is largely spared the risks normally associated with graft failure due 

to rejection and other causes. Importantly, in the case of fulminant liver failure, 

if the native liver recovers, immunosuppression can be gradually withdrawn, 

sparing the patients all the long-term morbidity of immunosuppression, including 

infection, malignancy, and nephropathy. 

Currently most groups performing auxiliary partial orthotopic liver transplants 

(APOLTs) use right, left, or left lateral splits/reduced grafts. Technical problems 

include compression of major venous vessels into and out of the graft, inadequate 

portal flow into the donor graft and subsequent thrombosis, inadequate 

graft size, and toxic liver syndrome in patients with acute failure. These problems 

have largely been overcome, and satisfactory results have been reported 

(54); auxiliary transplantation is being considered by a number of centers as a 

potential adjunct to orthotopic transplant (55). Experience with immunossuppression 

withdrawal is limited; however, the collected European experience 

found that 65% of patients surviving more than 1 yr with a successful auxiliary 

liver transplant were free of immunossuppression (54). In this series the overall 

1-yr patient survival rate of 62% in auxiliary liver transplantation was similar to 

that for orthotopic liver transplantation (61%). 

15. Xenotransplantation 

The use of animals, particularly pigs, as an organ source presents a very 

attractive alternative to human organs. Pigs can be bred and raised under very 

clean and controlled conditions. The anatomy and physiology is similar to 

human counterparts, and the waiting list could be cleared with huge expansion


of the potential donor pool. Before this can become a clinical reality, however, 

problems relating to immunological, microbiological, and physiological barriers 

need to be overcome. 

In 1992 and 1993, two orthotopic xenotransplantations were performed, 

placing baboon livers into patients with liver failure secondary to hepatitis B 

infection. These patients survived 70 and 26 d (56). The livers worked, but not 

normally, with levels of proteins including albumin remaining in the normal 

range for baboons and not humans. 

No long-term pig-to-primate liver transplants have been performed, although 

porcine livers transgenic for human complement regulatory proteins have functioned 

successfully in the short term. Patients with acute liver failure have been 

supported for a few hours to days with extracorporeal liver perfusion (ECLP) 

while a human donor liver is sought (57). These procedures have indicated the 

pig liver to be functional in the short term, with improvements in clinical status 

and reduction of blood ammonia and lactic acid levels. Whether genetic engineering 

would be able to “humanize” a pig liver adequately remains to be seen. 

The major porcine complement factors are only 70% homologous with human 

factors, and pig and human albumin 65% homologous, discrepancies that may 

be exaggerated in cascade or regulatory systems. 

Pigs and humans represent discordant species, and xenografts from one to 

the other would be expected to undergo hyperacute rejection because of the 

presence of preformed antibodies to the α-gal epitope on vascular endothelium 

leading to activation of the classical complement pathway. Transgenic techniques 

have been developed to prevent the hyperacute response. These include 

the production of pigs transgenic for a human complement regulatory proteins—the 

introduction of a single human complement regulator gene has been 

shown to abolish the immediate, complement-mediated hyperacute xenograft 

rejection. However, induced antibodies and subsequent cellular mechanisms 

are not controlled by this means (58). 

Having controlled the immediate effect of complement activation caused by 

preformed antibodies, a xenograft is at risk of damage from induced antibodies 

(delayed xenograft rejection). This has proved difficult to control using conventional 

immunosuppressive drugs. McGregor and colleagues recently reported 

that by combining the use of organs that express human decay accelerating factor 

(hDAF) with the administration of a soluble Gal glyco-conjugate and other 

immunosuppressive agents, the survival of pig hearts in baboons is extended to 

a median of 76 d (59). The recent generation of pigs that do not express the main 

target antigen (60) (α1,3-galactosyltransferase gene–knockout pigs [GT-KO]) 

might prevent the antibody response. 

Safety issues include concern about transmission of exogenous viral infections, 

such as cytomegalovirus, from donor pig to recipient. Early weaning and


subsequent isolation can lead to an absence of virus in these piglets. The presence 

of endogenous retroviruses in all pig cells has also led to concern. Oldmixon 

et al. showed that certain pigs lack the capacity to transmit porcine endogenous 

retrovirus to human cells in vitro (61). 

However, even if the safety and immunological barriers to porcine xenotransplantation 

were overcome, there are real doubts as to the potential value of liver 

xenotransplantation. Although probably useful in the short-term treatment of 

liver failure (as a liver-assist device), it is widely agreed that there would be 

large-scale incompatibilities involving many enzyme systems within the pig 

liver and proteins synthesized by the liver. It is unlikely, therefore, that the pig 

liver will prove to be a good substitute for the human liver in clinical transplantation, 

at least without major genetic engineering. 

16. The Future 

The practice of liver transplantation has become a victim of its own success, 

with an inexorable rise in patients waiting for surgery and a donor pool that 

remains static. The future must involve improved utilization of potential organ 

donors—current initiatives within the British transplant community are addressing 

this. Optimization of donors including improvements in nutrition as well as 

possible techniques for ameliorating reperfusion injury are being investigated, as 

are improvements in preservation techniques and viability assessment (including 

normothermic extracorporeal perfusion). Living donor transplantation remains a 

controversial technique, but one that could go a long way to redressing the shortage 

of donors. Improvements in immunosuppression have had a major effect on 

the survival of liver-transplant patients, a trend that is likely to continue. A clinically 

applicable means of achieving immunological tolerance would radically 

reduce the short- and long-term risks of liver transplantation. Although clearly 

desirable, this would have the effect of expanding still further the population of 

patients for whom transplantation is the preferred treatment. 

References 

1. Starzl, T. M., Marchioro, T. L., and Von Kaulia, K. N. (1963) Homotransplantation 

of the liver in humans. Surg. Gynecol. Obstet. 117, 659–676. 

2. Starzl, T. E., Iwatsuki, S., Van Thiel, D. H., et al. (1982) Evolution of liver transplantation. 

Hepatology 2, 614–636. 

3. (1984). National Institute’s of Health Consensus Development Conference Statement: 

Liver Transplantation. Hepatolog; 4, 107S–110S. 

4. Jain, A., Reyes, J., Kashyap, R., et al. (2000) Long-term survival after liver 

transplantation in 4,000 consecutive patients at a single center. Ann. Surg. 232, 

490–500. 

5. Gordon, R. D., Fung, J., Tzakis, A. G., et al. (1991) Liver transplantation at the 

University of Pittsburgh, 1984 to 1990. Clin. Transplant. 105–117.


6. Abbasoglu, O., Levy, M. F., Brkic, B. B., et al. (1997) Ten years of liver transplantation: 

an evolving understanding of late graft loss. Transplantation 64, 

1801–1807. 

7. Asfar, S., Metrakos, P., Fryer, J., et al. (1996). An analysis of late deaths after 

liver transplantation. Transplantation 61, 1377–1381. 

8. Neuberger, J., Adams, D., Macmaster, P., Maidment, A., and Speed, M. (1998) 

Assessing priorities for allocation of donor liver grafts: survey of public and clinicians. 

BMJ 317,172–175. 

9. Kamath, P. S., Wiesner, R. H., Malinchoc, M., et al. (2001) A model to predict 

survival in patients with end stage liver disease. Hepatology 33, 464–470. 

10. UNOS. Policy 3.6.: Allocation of livers. Available at: http://www.org/organData 

source/OrganSpecificPolicies.asp?display=Liver., Accessed August 13, 2003. 

11. Freeman, R. B., Rohrer, R. J., Katz, E., et al. (2001) Preliminary results of a liver 

allocation plan using a continuous medical severity score that de-emphasizes waiting 

time. Liver Transplant. 7, 173–178. 

12. Select Committee of Experts on the Organisational Aspects of Cooperation in 

Organ Transplantation. Meeting the organ shortage: current status and strategies 

for improvement of cadaveric organ donation. Madrid: ONT, 1996. 

13. Kim, W. R. (2002) The burden of hepatitis C in the United States. Hepatology 36, 

S30–S34. 

14. Berenguer, M.., Prieto, M., Rayon, J. M., et al. (2000) Natural history of clinically 

compensated HCV-related graft cirrhosis following liver transplantation. Hepatology 

32, 852–858. 

15. Han, S. H., Martin, P., Edelstein, M., et al. (2003) Conversion from intravenous to 

intramuscular hepatitis B immune globulin in combination with lamivudine is 

safe and cost-effective in patients receiving long term prophylaxis to prevent hepatitis 

B recurrence after liver transplantation. Liver Transplant. 9, 182–187. 

16. Clemente, G., Duran, F., Loinaz, C., et al. (1999) Late orthotopic liver retransplant 

indications and survival. Liver Transplant Spanish Group. Transplant Proc. 

31, 511–514. 

17. Jain, A., Demetris, A. J., Kashyap, R,. et al. (2001) Does tacrolimus offer virtual 

freedom from chronic rejection after primary liver transplantation? Risk and 

prognosic factors in 1048 liver transplants with a mean follow-up of 6 years. Liver 

Transplant. 7, 623–630. 

18. O’Grady, J.G., Burroughs, A., Hardy, P., Elbourne, D., Troesdale, A., and the UK 

and Republic of Ireland Liver Transplant Study Group (2002) Tacrolimus versus 

microemulsified ciclosporine in liver transplantation: the TMC randomised controlled 

trial. Lancet 360, 1119–1125. 

19. Jain, A., Mazariegos, G., Polzharna, R., et al. (2003) The absence of chronic 

rejection in paediatric primary liver transplant patients who are maintained on 

tacrolimus based immunosuppression: a long-term analysis. Transplantation 75, 

1020–1025. 

20. Yokosuka, O. (2000) Role of steroid priming in the treatment of chronic hepatitis. 

Br. J. Gastroenterol. Hepatol. (Suppl.), E41–45.


21. Heffron, T.G., Smallwood, G.A., Oakley, B., et al. (2002) Autoimmune hepatitis 

following liver transplantation: relationship to recurrent disease and steroid weaning. 


22. Mazariegos, G., Reyes, J., Marino, I.R., et al. (1997) Weaning of immunosuppression 

in liver transplant recipients. Transplantation 63, 243–249. 

23. Mazariegos, G. V., Reyes, J., Webber, S. A., et al. (2002) Cytokine gene polymorphisms 

in children successfully withdrawn from immunosuppression after 

liver transplantation. Transplantation 73, 1432–1435. 

24. Buhler, L. H., Spitzer, T. R., Sykes, M., et al. (2002) Induction of kidney allograft 

tolerance after transient lymphohematopoietic chimerism in patients with multiple 

myeloma and end-stage renal disease. Transplantation 74, 1405–1409. 

25. Busuttil, R. W. and Goss, J. A. (1999) Split liver transplantation. Ann. Surg. 229, 

313–321. 

26. New, W., Solomon, M., Dingwall, R., and McHale, J. (1994) A question of give 

and take: improving the supply of donor organs for transplantation. Research 

report, Kings Fund Institute, 18. 

27. Briggs, J. D., Crombie, A., Fabre, J., Major, E., Thorogood, J., and Veitch, P. S. 

(1997) Organ donation in the UK: a survey by a British Transplantation Society 

working party. Nephrol. Dial. Transplant. 12, 2251–2257. 

28. Ploeg, R. J., D’Alessandro, A. M., Knechtle, S. J., et al. (1993) Risk factors for 

primary dysfunction after liver transplantation—a multivariate analysis. Transplantation 

55, 807–813. 

29. Makowka, L., Gordon, R. D., Todo, S., et al. (1987) Analysis of donor criteria for 

the prediction of outcome in clinical liver transplantation. Transplant. Proc. 19, 

2378–2382. 

30. Rull, R., Vidal, O., Momblan, D., et al. (2003) Evaluation of potential liver 

donors: Limits imposed by donor variables in liver transplantation. Liver Transplant. 

9, 389–393. 

31. Salizzoni, M., Franchello, A., Zamboni, F., et al. (2003) Marginal grafts: finding 

the correct treatment for fatty livers. Transplant. Int. 16, 486–493. Epub 2003 

Mar 28. 

32. Tekin, K., Imber, C. J., Atli, M., et al. (2004) A simple scoring system to evaluate 

the effects of cold ischaemia on marginal donors. Transplantation 77, 411– 

416. 

33. Strasberg, M., Howard, T. K., Molmenti, E. P., and Hertl, M. (1994) Selecting the 

donor liver: risk factors for poor function after orthotopic liver transplantation 

[see comments]. Hepatology 20, 829–838. 

34. Bismuth, H. and Houssin, D. (1984) Reduced size orthotopic liver graft in hepatic 

transplantation in children. Surgery 95, 367–370. 

35. Broelsch, C. E., Emond, J. C., andThistlewaite, J. R. (1988) Liver transplantation 

including the concept of reduced size liver transplants in children. Ann. Surg. 208, 

410–420. 

36. Ringe, B., Pichlmayr, R., andBurdelski, M. (1988) A new technique of hepatic 

vein reconstruction in partial liver transplantation. Transplant. Int. 1, 3035.


37. Strong, R., Ong, T. H., Pillayb, P., Wall, D., Balderson, G., and Lynch, S. (1988) 

A new method of segmental orthotopic liver transplantation in children. Surgery 

104, 104–107. 

38. de Santibanes, E., McCormack, L., and Mattera, J. (2000) Partial left lateral segment 

transplant from a living donor. Liver Transplant. 6, 108–112. 

39. Badger, I. L., Czerniak, A., and Beath, S. (1992) Hepatic transplantation in children 

using reduced size grafts. Br. J. Surg. 79, 47–49. 

40. Houssin, D., Soubrane, O., Boillot, O., et al. (1992) Orthotopic liver transplantation 

with a reduced-size graft: an ideal compromise in paediatrics? Surgery 111, 

532–542. 

41. Malatack, J. J., Schaid, D. J., Urbach, A. H., et al. (1987) Choosing a paediatric 

recipient for orthotopic liver transplantation. J. Pediatr. Surg. 111, 479–489. 

42. Pichlmayr, R., Ringe, B., Gubernatis, G., and Hauss, J. (1988) Transplantation of 

a donor liver to two recipients (splitting transplantation)—a new method in the 

further development of segmental liver transplantation. Langenbecks Arch. Chir. 

373, 127–130. 

43. Rogiers, X., Malago, M., Gawad, K., et al. (1996) In situ splitting of cadaveric 

livers. The ultimate expanion of a limited donor pool. Ann. Surg. 224, 331–339. 

44. Bismuth, H, Morino, M, Castaing, D, et al. (1989) Emergency orthotopic liver 

transplantation in two patients using one donor liver. Br. J. Surg. 76, 722–724. 

45. Strong, R. W., Lych, S. V., Hin Ong, T. H., Matsunami, H., and Koido, Y. (1990) 

Successful liver transplantation from a living donor to her son. N. Engl. J. Med.. 

322, 1505–1507. 

46. Gomez, M., Garcia-Buitron, J. M., Fernandez-Garcia, A, et al. (1997) Liver transplantation 

with organs from non-heart-beating donors. Transplant. Proc. 29, 

3478–3479. 

47. Casavilla, A., Ramirez, C., Shapiro, R., et al (1995) Experience with liver and 

kidney allografts from non-heart-beating donors. Transplantation 59, 197–203. 

48. D’Alessandro, A. M., Hoffmann, R. M., Knechtle, S. J., et al. (1995) Successful 

extrarenal transplantation from non-heart-beating donors. Transplantation 59, 

977–982. 

49. Reich, D. J., Munoz, S. J., Rothstein, K. D., et al. (2000) Controlled non-heartbeating 

donor liver transplantation: a successful single centre experience, with 

topic update. Transplantation 70, 1159–1166. 

50. Otero, A., Gomez-Gutierrez, M., Suarez, F., et al. (2003) Liver transplantation 

from Maastricht category 2 non-heart-beating donors. Transplantation 76, 1068– 

1073. 

51. Rela, M., Muiesan, P., Vilca-Melendez, H., et al. (1999) Auxiliary partial orthotopic 

liver transplantation for Crigler-Najjar syndrome type I. Ann. Surg. 229, 565– 

569. 

52. Uemoto, S., Yabe, S., Inomata, Y., et al. (1997) Coexistenct of a graft with the 

preserved native liver in auxiliary partial orthotopic liver transplantation from a 

living donor for ornithine transcarbamylase deficiency. Transplantation 63, 1026– 

1028.


53. Saudubray, J. M., Touati, G., Delonlay, P., et al. (1999) Liver transplantation in 

propionic acidaemia. Eur J Pediatr. 158, S65–S69. 

54. van Hoek, B., de Boer, J., Boudjema, K., Williams, R., Corsmit, O., et al (1999) 

Auxiliary versus orthotopic liver transplantation for acute liver failure. J. Hepatol. 

30, 699–705. 

55. Langnas, A. N., Fox, I. J., Heffron, T. G., et al. (1995) University of Nabraska 

Medical Centre Liver Transplant Program. Clin. Transplant. 177–185. 

56. Starzl, T. E., Fung, J. J., Tzakis, A. G., et al. (1993) Baboon-to-human liver transplantation. 

Lancet 341, 65–71. 

57. Makowka, L., Cramer, D. V., Hoffman, A., et al. (1995) The use of a pig liver 

xenograft for temporary support of a patient with fulminant hepatic failure. Transplantation 

59, 1654–1659. 

58. Waterworth, P. D., Cozzi, E., and Tolan, M. J. (1997) Pig-to-primate cardiac 

xenotransplantation and cyclophosphamide therapy. Transplant. Proc. 29, 899– 

900. 

59. McGregor, C. G., Teotia, S. S., and Schirmer, J. M. (2003) Advances in preclinical 

cardiac xenotransplantation [abstr 47]. J. Heart Lung Transplant. 22, S89–S89. 

60. Phelps, C. J., Koike, C., Vaught, T. D., et al. (2003) Production of alpha-1,3 

galactosyltransferase-deficient pigs. Science. 299, 411–414. 

61. Oldmixon, B., Wood, J. C., Ericsson, T. A., et al. (2002) Porcine endogenous 

retrovirus transmission characteristics of an inbred herd of miniature swine. J. 

Virol. 76, 3045–3048.

Clinical Islet Cell Transplantation 47 

3 

Current Status of Clinical Islet Cell Transplantation 

Jonathan R. T. Lakey, Mohammadreza Mirbolooki, 

and A. M. James Shapiro 

Summary 

Clinical outcomes of pancreas transplantation were superior to that of islet transplantation 

until the introduction of the Edmonton protocol. Significant advances in islet isolation 

and purification technology, novel immunosuppression and tolerance strategies, 

and effective antiviral prophylaxis have renewed interest in clinical islet transplantation 

for the treatment of diabetes mellitus. The introduction of a steroid-free antirejection 

protocol and islets prepared from two donors led to high rates of insulin independence. 

The Edmonton protocol has been successfully replicated by other centers in an international 

multicenter trial. A number of key refinements in pancreas transportation, islet 

preparation, and newer immunological conditioning and induction therapies have led to 

continued advancement through extensive collaboration between key centers. This chapter 

provides an overview of the history of islet transplantation followed by a discussion 

of the state of the art of clinical islet transplantation. The challenges facing the clinician– 

scientist in the 21st century are also presented in this review. 

Key Words: Type 1 diabetes; transplantation; islet cell; islet isolation; Edmonton 

protocol. 


Diabetes mellitus (DM) is a clinical syndrome of abnormal carbohydrate, 

lipid, and protein metabolism characterized by hyperglycemia and glucosuria 

owing to the inadequate secretion and/or utilization of insulin. Insulin-dependent 

diabetes mellitus (IDDM) is an autoimmune disease caused by the progressive 

destruction of the insulin-secreting β-cells in the islets of Langerhans 

(1). The loss of more than 90% of the β-cell mass, triggered by unknown environmental 

factors and mediated by cytotoxic T cells, condemns genetically 

susceptible individuals to a lifelong dependence on insulin therapy (2,3). 



47

48 Lakey et al. 

There are an estimated 177 million diabetics worldwide. Of the 8 million 

patients in North America, 1 million have type 1 diabetes and 7 million have type 

2 diabetes; and another 8 million are believed to be undiagnosed. About 30,000 

new type 1 cases are diagnosed each year in North America, and the incidence is 

rising annually (4). According to the Diabetic Resources Network, there are an 

estimated 1.5 million diabetics in Canada, and this number is expected to double 

by 2010. It is the leading cause of death by disease and the number one cause of 

adult blindness (5). Diabetes is responsible for 25% of cardiac surgeries, 40% of 

end-stage renal disease (ESRD), and approx 50% of nontraumatic amputations. 

The economic costs and its burden on Canadian society are staggering, consuming 

in excess of 10% of health care expenditures, or about $9 billion in 2000 (6). 

1.1 Diabetes and the Quest for a Cure 

The Diabetes Control and Complications Trial (DCCT) of 1993 and its follow-up 

report in 1997 established that aggressive control of blood glucose lowered 

(but did not correct) glycated hemoglobin (HbA1C) values and significantly 

delayed the progression of chronic diabetic complications (7,8). The United 

Kingdom Prospective Diabetes Study Group (UKPDS) of type 2 diabetics with 

microvasculature disease reported similar findings (9). These studies confirmed 

unequivocally that tight control of blood glucose is essential if the microvascular 

complications are to be prevented. 

Intensive therapy is based on frequent self-monitoring of capillary blood glucose 

(four or more times each day) using skin puncture sampling and analysis 

with a portable glucose meter (10). Insulin can be self-administered by multiple 

injections (three or more times a day) or by pump therapy (11,12). The penalty 

for this optimal metabolic control is an alarming threefold increase in severe 

hypoglycemia. Even with aggressive medical management, exogenous (subcutaneous) 

insulin therapy will never recreate the real-time variation of blood 

glucose. The effects of chronic hyperglycemia and peripheral hyperinsulinemia 

are believed to accelerate diabetic microangiopathy (13,14). These observations 

have prompted researchers to explore alternative methods to restore physiological 

blood glucose regulation. 

β-Cell replacement is the only treatment that reestablishes and maintains 

long-term glucose homeostasis with near-perfect feedback controls (15). Pancreas 

transplantation is the standard therapy for insulin-dependent diabetics with 

established or imminent ESRD (16). Pancreas transplantation is also an option 

for patients who (1) require urgent third-party intervention for frequent, acute, 

and severe metabolic complications (hypoglycemia, hyperglycemia, ketoacidosis), 

(2) have incapacitating clinical and emotional problems with exogenous 

insulin therapy, or (3) exhibit frequent acute complications despite strict compliance 

with optimal medical management. Normalization of blood glucose can


reverse diabetic nephropathy (17) and stabilize or improve neuropathy (18) and 

cardiovascular status, but not advanced retinopathy (19). Clinical outcomes have 

improved dramatically since the first cadaveric pancreas–kidney transplant in 

1966 by Kelly and Lillehei at the University of Minnesota (20). The procedure 

is technically demanding and continues to have significant peri-operative mortality 

and morbidity despite refined surgical techniques, effective immunosuppression 

modalities, antiviral prophylaxis, and posttransplant monitoring 

(21,22). Although graft rejection rates are low, the risks associated with pancreas 

transplantation have generally limited its use to co-transplantation with 

other organs. The current 1-yr graft and patient survival rates are 80–90% and 

as high as 95%, respectively (23). In contrast, islet transplantation with its 

reduced antigen load, technical simplicity, and low morbidity has the potential 

to prevent chronic complications and improve quality of life. From a research 

perspective, islet transplantation is the ideal model for testing novel immunosuppression 

and tolerance, and cytoprotection protocols. It has several advantages 

over other experimental models because (1) unlike failed heart, lung, and 

liver transplants, which require life-saving emergency retransplantation, a diabetic 

would resume insulin therapy if the islet graft fails, (2) retransplantation is 

associated with low morbidity, (3) allogeneic and autoimmune barriers must be 

neutralized, and (4) islets can be cryopreserved or manipulated in vitro to reduce 

immunogenicity or to induce cellular expansion. 

The potential of pancreas transplantation for the treatment of diabetes began 

in 1889 when Minkowski and von Mering unexpectantly discovered that removal 

of the canine pancreas resulted in hyperglycemia and glucosuria, followed by 

ketoacidosis and death (24). The first clinical attempt to transplant the pancreas 

was performed 5 yr later by Williams, who implanted fragments of freshly 

slaughtered sheep’s pancreas in the subcutaneous tissues of a 13-yr-old boy 

dying of diabetic ketoacidosis (25). Although there was temporary improvement 

in glucosuria before his death 3 d later, it was inevitable that the xenograft would 

fail without the benefit of immunosuppression. Pioneering experiments by 

Minkowski, Ssobolew, Barron, and others quickly gave rise to the realization 

that the exocrine pancreas was not necessary to treat diabetes (26). In 1902, 

Ssobolew proposed transplanting only the endocrine tissue, but he had no practical 

means to separate the islets from the acinar tissue. Consequently, this 

approach would lie in a near-dormant state for more than 60 yr (27,28). 

The discovery of insulin by Banting and Best in 1922 transformed diabetes 

from an inevitably fatal disease following the onset of ketoacidosis to that of a 

chronic incurable illness with debilitating comorbidities and premature death 

(29,30). Clinicians were eager to declare that insulin therapy would cure diabetes, 

a fact that was not overlooked by Banting, who concluded his 1923 Nobel 

laureate lecture with: “Insulin is not a cure but is a treatment; it enables the


diabetic to burn sufficient carbohydrates, so that proteins and fats may be added 

to the diet in sufficient quantities to provide energy for the economic burdens of 

life” (31). Meanwhile, surgeons continued to refine pancreas and vascular surgery 

techniques that would eventually set the stage for future breakthroughs in 

organ transplantation and transplantation immunology. However, it was obvious 

by the 1930s that exogenous insulin therapy did not prevent the progression 

of the clinical syndromes now known as the complications of diabetes. It was 

not until the late 1940s that the scope and severity of the disease was really 

known. The consequences of 15–20 yr of persistent hyperglycemia resulted in 

renal failure, blindness, heart disease, neuropathy, and atherosclerosis (32). The 

clinical introduction of glucocorticoids and azathioprine (and later cyclosporine) 

coupled with the success of kidney transplantation in the early 1960s provided 

the impetus to once again explore the possibility of pancreas transplantation as 

a treatment for insulin-dependent diabetes (33). Canine and clinical studies of 

vascularized pancreas transplantation in the late 1960s and early 1970s were 

disastrous. While organ procurement and preservation were major obstacles, 

peritonitis, graft rejection, and septicemia secondary to the breakdown of the 

duodenal anastomosis in the presence of high-dose corticosteroids were largely 

responsible for a mortality rate in excess of 60% and a dismal 1-yr graft-survival 

rate of 3% (20). Because some of these problems resulted from contaminated 

exocrine tissue in the graft, efforts were undertaken to determine the 

feasibility and efficacy of grafting only the insulin-producing tissue. 

1.2. The Evolution of Clinical Islet Transplantation 

Prior to the late 1960s, the harvesting of islets for morphological and physiological 

studies required the meticulous microdissection of rodent pancreata 

(27). Lacy and Kostianovsky extensively refined Moskalewski’s technique of 

dispersing minced rodent pancreatic tissue into fragments from which large 

numbers of islets could then be separated (34,35). Briefly, the pancreas was 

distended with a balanced salt solution via the pancreatic duct, which was then 

chopped into small fragments and mechanically agitated with bacterial collagenase 

enzyme. In 1970, Younoszai et al. demonstrated some amelioration of glucosuria 

and glycemia in diabetic rats by intraperitoneal implantation of 

allografted islets (28). The first reports of successful islet transplantation in rats 

with chemically induced diabetes were published in 1972 by Ballinger and Lacy 

and others. Kemp et al. demonstrated that the liver was the most effective environment 

for islet implantation in rodents (36). The islets undergo a process of 

angiogenesis and neovascularization to form a rich nutritional blood supply and 

a core-to-mantle microvascular network that optimizes intercellular β-to-α/δ 

signaling for precise insulin and glucagon secretion. Transportal embolization 

is the method of choice in clinical islet transplantation, although there is some


debate as to whether the liver is the best site (37). In 1977, Najarian et al. at the 

University of Minnesota performed the first successful clinical islet allotransplant 

under protective cover with azathioprine and corticosteroids (38). One year 

later Largiader et al. reported the first C-peptide-negative diabetic to achieve 

insulin independence at 1 yr after simultaneous kidney transplant and 

intrasplenic infusion of nonpurified pancreatic tissue from a single donor (39). 

Researchers prematurely predicted that islet transplantation would cure diabetes 

and that vascularized pancreas transplantation would only be a footnote in 

the history books. However, the extrapolation of rodent islet transplant technology 

into the clinical arena proved to be very problematic. This was due in 

part to the inability to prepare an adequate islet implant mass from the more 

fibrous human pancreas. Little attention was given to the composition, purity, 

and viability of the pancreatic digest or the consequences of transplanting such 

tissue into human subjects (40). Most attempts were disappointing and very 

often catastrophic, with hepatic infarction, portal vein thrombosis, disseminated 

intravascular coagulation, and splenic infarction accounting for much of 

the morbidity and mortality (21). These events and ineffective immunosuppression 

would critically hinder the development of clinical islet transplantation 

for the next 20 yr (41). Methods would eventually be developed that 

enabled the isolation of islets from dogs, pigs, primates, and humans (42,43). 

Indeed, the present-day concept of clinical islet transplantation is based on 

techniques developed in large animal models (41). 

There were sporadic reports in the 1990s of insulin independence following 

islet allotransplantation for extended periods (44–48). In 1992, Pyzdrowski at 

the University of Minnesota reported a series of five patients (ages 12–37 yr) 

who became insulin independent after intrahepatic islet autotransplantation following 

total or near-total pancreatectomy (>99%) for severe chronic pancreatitis 

(49). Other autotransplant studies demonstrated that a critical mass of 

300,000 islets could reestablish and maintain insulin independence beyond 2 yr 

(50,51). These were the first studies to prove that islet autotransplantation was 

feasible and safe. More than 240 autotransplants have been performed worldwide 

in the last 15 yr (52). Most recipients had undergone total or near-total 

pancreatectomy for intractable pain and/or failure to thrive secondary to chronic 

pancreatitis. Oberholzer et al. recently reported long-term insulin independence 

in two patients who underwent islet autotransplantation following distal pancreatectomy 

for insulinomata well localized to the surgical neck of the pancreas, 

with no signs of recurrence at 3 and 6 yr posttransplant, respectively (53). 

To date, the longest period of insulin independence following autotransplantation 

is more than 13 yr (54). 

Of the 237 well-documented allotransplants recorded in the Islet Transplant 

Registry (ITR) database in Giessen, Germany, from January 1, 1990 to Decem-


ber 31, 2000, less than 12% of recipients were insulin-free at 1 yr posttransplant. 

Graft survival, defined as basal C-peptide less than 0.5 ng/mL, was 41% (48,52). 

The majority were islet–kidney transplants. Tolerance was induced with either 

antilymphocyte globulin (ALG) or antithymocyte globulin (ATG). Cyclosporine, 

azathioprine, and glucocorticoids were used for maintenance immunosuppression. 

Although these disappointing results were in sharp contrast to those of clinical 

autotransplantation, there were two notable exceptions. In 1990, Tzakis et al. 

at the University of Pittsburgh reported a small series of nondiabetics who had 

undergone islet and co-transplantation of a liver, kidney, and bowel following 

multivisceral resection for primary or secondary hepato-biliary malignancies 

(44). Two years later, Ricordi et al. reported a follow-up series of 22 cluster 

organ–islet allotransplants (45). Most grafts were from a single pancreas of a 

multi-visceral donor and were implanted in the liver via the portal vein following 

reperfusion. More than 50% of recipients were able to remain insulin-free (the 

longest >5 yr) before succumbing to recurrent metastatic disease. These studies 

provided a unique opportunity to study islet allografts in the absence of autoimmune 

reactivity. Other factors believed to contribute to the success of these multivisceral 

organ–islet transplants were as follows: (1) the use of partially purified 

preparations allowed a greater number of islets to be implanted (55); (2) the 

patients who were able to achieve insulin independence had a larger implant mass 

relative to their body weight (48); (3) tacrolimus monotherapy in the absence of 

corticosteroids provided effective immunosuppression (56); (4) experimental 

studies have shown that liver transplantation improves immunological tolerance 

to other organs from the same donor when simultaneously transplanted (57); and 

(5) cachectic individuals are known to be very sensitive to insulin (58). 

1.3. Early Clinical Trials: Prelude to the Edmonton Protocol 

In 1989, the first two of seven patients in an early cohort received approx 

260,000 islets isolated from two cadaveric donor pancreata. A kidney from the 

first donor was also implanted (59). Intravenous insulin was administered for 

10–14 d with intensive blood glucose monitoring to maintain normoglycemia 

and preserve β-cell function. Immunosuppressive therapy included Minnesota 

antilymphoblast globulin (MALG), corticosteroids, azathioprine, and 

cyclosporine. Posttransplant C-peptide production gradually declined over 1–3 

mo. Graft failure coincided with cytomegalovirus (CMV) infection, with neither 

patient achieving insulin independence. Subsequently, four patients were 

transplanted with fresh allografts supplemented with cryopreserved islets to 

create a total islet mass of more than 10,000 IE/kg (islet equivalent [IE]: standardized 

to the volume of an islet 150 µm in diameter per kilogram body weight 

of the recipient) (60). One patient remained insulin-free for more than 2 yr (48). 

The seventh patient underwent a simultaneous liver and islet transplant. Embo-


lization of partially purified pancreatic tissue into the liver via the portal vein 

resulted in complete portal vein thrombosis and required emergency retransplantation 

(55,56). All patients eventually required insulin therapy. Two allografts 

remained C-peptide positive, the longest for more than 9 yr. Researchers 

from Pittsburgh, St. Louis, Milan, and Miami also reported some early success 

with islet allotransplants, but technical problems, particularly with the collagenase, 

would temporarily dampen enthusiasm for developing islet transplantation 

(47,61,62). 

These data demonstrated that most patients were unable to achieve or maintain 

insulin independence because (1) the islet implant mass was subtherapeutic 

(63), (2) a high proportion of the islets failed to engraft (64), (3) the islets were 

damaged in the liver (the site of implantation) by direct, local toxic effects of the 

immunosuppressants (65), and (4) ineffective immunosuppression failed to prevent 

acute or chronic rejection or the recurrence of autoimmune diabetes (66). 

The high metabolic demand of preexisting insulin resistance in patients with 

incipient renal failure also placed undue stress on the islets (67,68). Implanted 

islets were also lost owing to functional exhaustion (69). Four criteria have been 

identified with insulin independence: (1) the critical islet implant mass was 6000 

IE/kg or more; (2) the critical cold ischemia (preservation) time (CIT) was less 

than 8 h; (3) polyclonal antibodies such as ALG or ATG were very effective in 

depleting cytotoxic T cells; and (4) the liver was the favored implantation site 

(70–72). 

By the late 1990s, controlled pancreas distension with low-endotoxin 

Liberaseô (Roche, Indianapolis, IN), automated tissue dissociation, and purification 

on continuous Ficoll gradients made it possible to manufacture high-yield 

islet preparations suitable for experimental and clinical transplantation (73,74) 

(Fig. 1). The Giessen protocol employed endotoxin-free reagents during processing 

and intravenous insulin, parenteral hyperalimentation, and antioxidant 

therapy (nicotinamide, pentoxifylline, vitamin D) to improve islet engraftment 

and overcome early graft rejection (75,76). Insulin independence was achieved 

in about 25% of patients with ATG induction and maintenance immunosuppression 

with methylprednisolone, azathioprine, and cyclosporine. Maffi et al. of 

Milan reported that mycophenolate mofetil (MMF), vitamin D, cyclosporine, 

steroids, and metformin enhanced islet allograft survival from 33% to more than 

50% (77). 

Using a similar strategy that emphasized strict quality-control criteria and 

aggressive peri-transplant management, Oberholzer et al. reported improved islet 

allograft function in 13 patients with IDDM followed over a period of 3 mo to 5 

yr under cover of basiliximab (a chimeric anti-interleukin ([IL]-2 receptor-α 

monoclonal antibody [anti-IL-2R-α MAb]), steroids, cyclosporine, and MMF 

(46). Based on these data, the Swiss-French (GRAGIL) consortium, using a cen-


Fig. 1. Schematic view of clinical islet cell transplantation. 

tral processing facility and refined peri-transplant management protocols, reported 

a 1-yr allograft survival rate of 50%. Two of five patients with single-donor 

allografts achieved insulin independence after 6–8 mo. Interestingly, both recipients 

received islets shipped from another center (78). Three individuals eventually 

resumed insulin therapy but remained C-peptide positive. There were no 

episodes of primary graft failure (PGF). The remaining five allografts eventually 

lost all function. 

1.4. Development of Steroid-Free Immunosuppression 

The resurgence of autoimmune activity is an ominous sign indicative of impending 

graft failure. The importance of an effective immunosuppressive regimen is 

well demonstrated by the fact that autoimmune recurrence following identical 

twin-to-twin segmental pancreas transplantation can be prevented (79). The limited 

success of early clinical islet transplants revealed that conventional immunosuppressants 

were relatively ineffective in preventing allograft rejection 

when compared to their effect on vascularized pancreas grafts. Most if not all 

agents were associated with impaired β-cell function, reduced graft revascularization, 

or serious long-term side effects such as nephrotoxicity and malignancy 

(80). Cyclosporine and glucocorticoids exert their diabetogenic synergism 

through reduced insulin secretion, increased peripheral insulin resistance, and


direct toxicity to the fl cell (81). Azathioprine, a purine analog originally developed 

as an anticancer agent, revolutionized renal transplantation in the early 

1960s. It inhibits T-cell proliferation by blocking DNA and RNA synthesis. 

Leukopenia is the most common side effect. Azathioprine toxicity is dose dependent 

and often reversible. Azathioprine monotherapy does not appear to adversely 

affect β-cell function or insulin sensitivity. MMF provides more specific potent 

immunosuppression by inhibiting the de novo synthesis of guanosine nucleotides 

in T and B cells. Unlike azathioprine, MMF is not teratogenic (82). MMF 

also potentiates the antiviral effects of ganciclovir and inhibits the upregulation 

of adhesion molecules on the surface of cytotoxic T cells. Overimmunosuppression 

can result in life-threatening opportunistic infections and malignancy, 

particularly lymphoma (83,84). Polyclonal antibodies such as ATG and ALG 

are very effective in high-immunological-risk patients (85). 

The introduction of sirolimus was a major key to the development of steroid-free 

immunosuppression (23,86). Unlike other immunosuppressants, 

sirolimus interrupts cell-cycle kinetics late in the G 1 phase, prior to entry into 

the S phase. The specific inhibition of the lymphocyte response (growth factor 

mediated) to mitogenic stimuli leaves other proliferative pathways unaffected. 

Thus, sirolimus blocks T- and B-cell recruitment, activation, and clonal expansion 

by inhibiting IL-2 and other cytokine production. Its low diabetogenic 

potential, minimal nephrotoxicity, and synergism with tacrolimus and other 

calcineurin inhibitors has been responsible for very low rejection rates in clinical 

liver, kidney, and pancreas transplantation (87). Sirolimus-based protocols 

have demonstrated prolonged islet graft survival and improved function through 

enhanced insulin half-life and increased insulin sensitivity (88). Tacrolimus is a 

more potent calcineurin inhibitor, and, like cyclosporine, its inhibitory effects 

on insulin secretion are dose-dependent (89). Low-dose tacrolimus combined 

with sirolimus and corticosteroids have resulted in unprecedented low rejection 

rates in liver, kidney, and pancreas transplantation (90). Daclizumab 

(Zenapax ® , Roche Pharmaceuticals) is a recombinant MAb engineered to specifically 

target the α-chain of the IL-2 IL-2R-α, which is expressed only by activated 

lymphocytes. It provides potent immunosuppression by inhibiting both Tand 

B-cell proliferation and inhibiting interferon-γ secretion (91,92). It has been 

very effective in renal transplants. Its safety profile is unmatched by any other 

immunosuppressive agent currently in use. Thus, triple therapy with tacrolimus, 

sirolimus, and daclizumab prevents activation of the immune cascade at several 

sites by inhibiting (1) T-cell activation, (2) IL-2 and other pro-inflammatory 

cytokine production, and (3) IL-2α receptor ligand engagement and T-cell 

proliferation and clonal expansion (93). This steroid-free strategy is particularly 

advantagous in the setting of a marginal islet engraftment mass in that it 

reduces β-cell toxicity substantially.


Table 1 

Effect of Islet Cell Transplantation 

2. The Edmonton Protocol 

Islet transplant Type 1diabetic Nondiabetic 

recipients subjects control subjects 

n 7 7 7 

Sex (M/F) 6/1 4/3 3/4 

BMI (kg/m 2 ) 23.0 ± 1.2 24.3 ± 1.4 24/2 ± 0.8 

Age (yr) 43 ± 3 39 ± 3 37 ± 5 

Duration of daibetes (yr) 27 ± 6 26 ± 3 — 

Total islets transplanted per patient 840,155 ± 52,943 — — 

HbA lc (%) 5.8 ± 0.1 9.7 ± 0.6 5.4 ± 0.1 

In 2000, we reported that seven consecutive nonuremic patients with type 1 

DM transplanted with an average of approx 800,000 islets were insulin independent 

beyond 1 yr (94). The Edmonton protocol, a glucocorticoid-free immunosuppression 

regimen combined with an optimal islet engraftment mass, was a 

dramatic departure from previous attempts. The protocol addressed specific 

barriers to insulin independence identified by Hering and Ricordi. Autoimmune 

recurrence and allograft rejection were counteracted with the novel cocktail of 

daclizumab, sirolimus, and low-dose tacrolimus. This landmark study confirmed 

for the first time in the history of clinical islet transplantation that long-term 

islet function and excellent blood glucose control could be achieved with results 

similar to that of vascularized pancreas transplantation (66). Expeditious graft 

processing followed by immediate transplantation, the limitation of prolonged 

cold ischemia, the avoidance of culture and cryopreservation, and the elimination 

of exposure to xenoproteins, such as fetal calf serum (FCS), further optimized 

the recovery of functionally viable islets. Subsequent follow-up of the 

original cohort confirmed that long-term insulin independence was possible and 

that the therapy was safe and well tolerated (95–97) (Table 1). 

2.1. Patient Selection and Preoperative Evaluation 

The benefits of insulin-free status must be carefully weighed against the 

potential risks of long-term immunosuppression on an individual basis. Most 

early islet transplants were combined with a kidney transplant in patients with 

end-stage diabetic nephropathy (52). These individuals often have significant 

peripheral insulin resistance, which can be very slow to reverse after successful 

transplantation (67,98). This problem and the concomitant nephrotoxicity 

of the calcineurin inhibitors can be easily overcome by transplanting only Cpeptide-negative 

diabetics who have adequate renal reserve (creatinine clearance 

>80 mL/min/1.73 m2 or microproteinuria


We select adults (18–65 yr) with type 1 DM for more than 5 yr who are at 

greatest risk and exhibit one or more of the following: (1) at least two episodes 

of severe hypoglycemia with reduced awareness during the preceding 12 mo, 

(2) marked glycemic lability (“brittle diabetes”) characterized by erratic blood 

glucose levels that interfere with daily activities and/or requiring third-party 

intervention on two or more occasions during the previous 12 mo (100), and 

(3) the presence of early but progressive secondary diabetic complications that 

fail to stabilize with intensive insulin therapy (7,8). Diabetics with severe coronary 

artery disease are excluded. Patients with unstable retinopathy should not 

be transplanted because sudden changes in blood glucose can precipitate retinal 

hemorrhage (101). Diabetics with a recent or active history of substance 

abuse (including smoking), daily insulin requirements of more than 0.7 IU/kg, 

body weight greater than 90 kg, BMI higher than 28 kg/m 2 , active infection 

(including hepatitis B and C, AIDS, and tuberculosis), or a history of malignancy 

(except basal cell carcinoma or squamous cell carcinoma) are not eligible. 

A positive pregnancy test, intention of future pregnancy, or failure to 

practice effective contraception also preclude enrollment. Only 10% of the 

more than 1500 Canadians with DM we have evaluated are suitable candidates 

for islet-alone transplantation. 

A thorough and independent review of potential candidates was performed 

by two diabetologists and a multidisicplinary transplant team. Upon enrollment, 

each patient gave written informed consent and underwent the following 

baseline tests: a complete blood count (CBC), liver function tests (LFTs), electrolytes, 

calcium, magnesium, thyroid function, lipid panel, renal function tests 

(RFTs), and coagulation profile. Patients with labile diabetes or recurrent hypoglycemia 

secondary to adrenal insufficiency and celiac disease were excluded. 

Prostate-specific antigen (PSA) levels were determined in men older than 40 yr. 

Women older than 40 yr underwent mammograms. Eye assessment, chest Xray, 

dental assessment, abdominal ultrasound, and an electrocardiogram (and 

other cardiac tests, if warranted) were also performed. All patients were screened 

for CMV, HIV, hepatitis, Epstein-Barr nuclear antigen (EBNA), varicella-zoster, 

syphilis, tuberculosis, and toxoplasmosis. Lymphocytotoxic antibody screens 

were performed. Blood glucose and C-peptide levels before and after 90 min of 

ingesting a standard mixed meal were recorded. Serum was analyzed for antiinsulin 

antibodies and islet autoantibodies. 

2.2. Pancreas Procurement 

We process organs that the Human Organ Procurement Exchange (HOPE) 

program does not allocate for pancreas transplantation. In 2000, Health Canada 

reported that only 65 organs from 473 donors were used for vascularized pancreas 

transplantation (102). Two-thirds of the pancreata were never recovered


from suitable donors, and a significant number arrived at the isolation laboratory 

with CITs exceeding 8 h. Donor pancreata were selected according to 

factors known to have a positive influence on islet yield and subsequent insulin 

independence: age over 20 yr, high BMI, blood glucose greater than 10 mMol/L, 

and no history of prolonged cardiac arrest or severe hypotension requiring inotropic 

support. Mean donor age was 44 ± 11 yr. Islet injury from excessive cold 

storage (mean CIT 7.5 ± 4 h) was minimized whenever possible by employing 

chartered jet transport. 

The pancreas is a difficult organ to procure for transplantation (103). Surgical 

expertise, procurement technique, and minimal warm ischemia time (WIT) 

of less than 20 min have a major impact on the recovery of functionally viable 

islets and posttransplant clinical outcomes (104). Most reports describe methods 

for the combined removal of the pancreas and liver (105). Until recently, 

the harvesting of the pancreas specifically for islet transplantation had not been 

addressed (106,107). The whole pancreas or a segmental graft can either be 

resected en bloc with the liver as part of the multiorgan retrieval process or 

removed while the liver is perfused with University of Wisconsin (Viaspan or 

Belzer UW; Barr Laboratories, Inc. Pomona, NY) solution (107). The following 

surgical principles are of paramount importance: (1) atraumatic handling 

of the pancreas (a damaged pancreatic capsule leads to enzyme leakage, loss of 

ductal integrity and, ultimately, poor islet yields) (108), (2) rapid in situ cooling 

to minimize WIT and stabilize endogenous enzyme activity (107), and (3) 

immediate processing to minimize cold ischemic injury. We have demonstrated 

that rapid mobilization of the spleen to the midline after cross-clamping the 

aorta and embedding the entire pancreas in iced saline-slush led to a doubling 

of islet yield and a significant improvement in islet viability (106,107). Ideally, 

the pancreas should be removed en bloc with the spleen and a stapled cuff of 

proximal and distal duodenum. 

2.3. Islet Preparation 

The islets were prepared using controlled pancreas perfusion with Liberase 

HIô, automated tissue dissociation in a modified Ricordi chamber, and osmotic 

stabilization with chilled UW solution for 30 min prior to purification on continuous 

Ficoll gradients using a refrigerated COBE 2991 cell apheresis system 

(COBE BCT, Inc. Lakewood, CO) (71). More recently, the islets were cultured 

in modified insulin-transferrin-selenium (ITS) medium containing hydroxyethyl 

piperazine ethane sulfonate (HEPES) buffer and nicotinamide for 48 h 

(97,109). Insulin independence is rarely achieved with less than 9000 IE/kg 

(about 640,000 islets) (52). The mean cumulative islet mass transplanted at our 

institution is currently 13,000 IE/kg. Although we usually do not use preparations 

with less than 250,000 IE, the smallest islet mass that has secured insulin


independence in our series is 230,000 IE. Islets were prepared from two (and 

sometimes three or four) sequential donors in the majority of cases. The mean 

time between the first and second implants was 70 d. Each preparation was 

matched to the recipient’s blood type and cross-matched for lymphocytoxic antibodies 

but not HLA phenotypes. Samples of the final preparation were submitted 

for signal transduction and activation of transcription (STAT) Gram 

stain and aerobic, anaerobic, fungal, and Mycoplasma culture. Islet viability 

was determined by the membrane dye exclusion technique. Islet function was 

assessed using static incubation in low- and high-glucose media. The endocrine 

composition of the grafts was determined by immunohistochemistry (110). 

2.4. Islet-Alone Transplantation 

Preoperatively, blood glucose was maintained between 6 and 10 mMol/L 

using a 10% dextrose infusion supplemented with potassium chloride and insulin 

(7,8). The islets were transplanted in the liver by percutaneous transhepatic 

intraportal embolization using the modified Seldinger technique (111). Performed 

under local anesthesia with conscious sedation, the procedure was usually completed 

within 15 –30 min. A portal venogram was used to visualize the intraparenchymal 

venous architecture and to confirm the position of the needle and 

catheter tip within the main vein. Some centers prefer direct visualization of the 

portal (or mesenteric) vein to minimize the risk of hemorrhage and portal vein 

thrombosis. This can be safely accomplished by either mini-laparotomy or handassisted 

laparoscopic surgery in conjunction with therapeutic heparinization. 

These methods may be more suitable for centers with little or no experience in 

islet transplantation. The transjugular route offers an alternate means of avoiding 

multiple punctures. However, serious complications such as biliary rupture, capsular 

puncture, and extrahepatic portal vein puncture have been reported (112). 

The majority of patients (>90%) were safely discharged within 12–24 h. 

2.5. Pretransplant Conditioning and Posttransplant Therapy 

Posttransplant blood glucose was maintained between 4 and 10 mMol/L. 

Blood glucose is often normal for the first 16–24 h, after which time it is usually 

necessary to resume insulin therapy (Lispro preprandial and neutral Protamine 

Hagedora at bedtime), albeit at much lower doses. Daily insulin requirements 

were about one-half that of pretransplant (7,8). Daclizumab (1 mg/kg) was given 

intravenously at the time of transplant and repeated at 2-wk intervals for a total 

of five doses (91,92,113). This method allows time for a supplemental transplant 

procedure. The induction course was repeated if another transplant was 

required beyond 10 wk. Sirolimus was given orally as a loading dose of 0.2 mg/ 

kg orally immediately pretransplant. The maintenance dose (initially 0.1 mg/kg/ 

d) was adjusted to 24-h target serum trough levels of 12–15 ng/mL (as deter-


mined by high-performance liquid chromatography) for 3 mo and were then 

reduced to 7–10 µg/L thereafter (87,114). To minimize the risk of drug-induced 

islet injury, low-dose tacrolimus (at one-quarter to one-half the standard dose for 

other organ transplants) was administered beginning on d 10 at 2 mg orally twice 

daily and adjusted to target 12-h serum trough levels of 3–6 µg/L (87,115). All 

patients received ganciclovir (1 g orally three times a day) for 3 mo for CMV 

and posttransplant lymphoproliferative disorder (PLPD) prophylaxis (84,116), 

preemptive oral trimethoprimsulfamethoxazole if the white blood cell (WBC) 

count was less than 2.5 × 10 9 /L (target range 5–10 × 10 9 /L), and pentamidine 

(300 mg/mo) for prevention of Pneumocystis carinii pneumonia (PCP) (84). 

Campath-1H, a humanized MAb (Millennium Pharmaceuticals, Cambridge, 

MA) directed against the surface antigen CD52 expressed by lymphocytes and 

monocytes, has been proven to be highly effective in the treatment of many 

hematological malignancies and autoimmune diseases (117). To date, there 

have been no reports of increased risk of malignancy, posttransplant lymphoma, 

or life-threatening infections among the more than 200 kidney transplant 

recipients worldwide (118,119). Despite its excellent safety profile and 

its ability to induce profound lymphocyte depletion, the use of campath-1H 

and sirolimus without calcineurin inhibitor therapy has raised some concern. 

Kirk et al. treated seven living-related kidney transplant recipients with only 

campath-1H (110,118). In the absence of maintenance immunosuppression, 

acute rejection was evidenced by an increase in the number of circulating 

monocytes, an atypical monocytic infiltrate in the graft, and augmented tumor 

necrosis factor (TNF)-α expression. Low-dose sirolimus reversed graft rejection 

and provided excellent renal function in all cases. After careful consideration, 

it was felt that the risk of endothelium-directed monocyte-mediated 

rejection would be much less likely in the islet setting. Although most donorderived 

endothelial cells are removed during the purification process, we felt it 

prudent to add a micro-dose of tacrolimus. Micro-dosing without drug-level 

monitoring (0.5 mg orally once every other day or about 10% of the low dose 

currently used in Edmonton protocol) was delayed until d 7 posttransplant to 

minimize toxicity to the freshly transplanted islets. Unlike previous trials, 

which relied on extensive preconditioning with corticosteroids, only campath- 

1H (20 mg iv) was given on d 2 and 1. Complement-mediated cytokine “storm,” 

a toxic condition characterized by low-grade fever, mild hypertension, nausea, 

vomiting, and urticaria, was avoided by predosing campath-1H on d 2 with a 

single dose (10 mg/kg iv) of anti-TNF-α (infliximab [Remicade]). 

Abdominal ultrasound with Doppler interrogation of the portal vein was conducted 

within 24 h of transplantation. Postoperative hemorrhage was detected in 

9 of 98 procedures by the presence of free fluid and/or a drop in hemoglobin. 

Five patients required transfusion for non-life-threatening hemorrhage, while


Fig. 2. Peak aspartate aminotransferase (AST) after sequential islet transplantation. 

another experienced a rise in portal pressure following infusion of the final (less 

pure) layer of islets. The patient was anticoagulated and transfused and underwent 

successful decompression of a subcapsular hematoma and partial hepatectomy 

because of an expanding intrahepatic hematoma. These risks are potentially 

avoidable, particularly if the procedure is performed under ultrasound, computed 

tomography (CT), or fluoroscopic guidance, and the catheter tract is plugged 

with Gelfoam (Pharmacia and Upjohn, Mississauga, ON) after islet infusion. 

Hemostatic gelatin-sponge embolization was abandoned early in the study when 

a customized stiffened 4-Fr micropuncture catheter became available (Cook 

Canada Inc., Stouffville, ON). The percutaneous transhepatic intraportal approach 

has a proven safety record and remains our method of choice. We are currently 

evaluating the efficacy of catheter tract ablation with laser photocoagulation and 

mini-laparotomy in conjunction with full-dose heparinization and preemptive 

anti-inflammatory treatment with anti-TNF-α (infliximab) (120). 

Postoperative liver enzyme levels were elevated in about 50% of procedures. 

This phenomenon is self-limiting and resolves within 3 wk posttransplant. 

Although the exact cause is unknown, islet embolization most likely induces 

hepatic injury by obstructing peripheral portal inflow. Liver transaminase levels 

were lower following subsequent transplants, suggesting that immunosuppression 

may have a protective effect (121). The difference in the median peak 

aspartate aminotransferase (AST) after sequential islet transplantation was not 

statistically significant (Fig. 2). Even though portal venous pressures returned


Fig. 3. (A) Mean portal pressures measured during first, second, and third islet 

infusions. (B) The mean acute change in portal pressure increases as patients receive 

more than one islet transplant. 

to baseline between procedures, the incremental rise in peak postinfusion portal 

pressure with successive transplants suggests that the elasticity of the portal 

system is limited (Fig. 3). It is unknown at this time whether these acute changes 

will have any long-term significance; however, multiple (two to four) sequential 

islet transplants can be performed safely if only highly purified islets are 

implanted and portal venous pressure is carefully monitored (122). The risk of 

portal vein thrombosis can be minimized even further by using a closed-bag 

gravity infusion system, graded low-dose intraportal heparinization (35 U/kg 

body weight if the packed cell volume [PCV] is 5 mL), 

and smaller infusion volumes (


Fig. 4. Kaplan–Meier survival curves showing a mean 82% insulin independence 

in 118 cosecutive islet-alone transplantations. 

2.6. Clinical Outcomes 

Our latest series includes data from 48 consecutive C-peptide-negative patients 

and 98 percutaneous transhepatic procedures and is the largest single-center 

series worldwide (97). All patients had chronic complications including metabolic 

lability (86%), microalbuminuria (64%), retinopathy (50%), neuropathy 

(29%), and vasculopathy (7%). As of January 2003, 34 patients have received 

completed transplants (mean cumulative islet mass 369,940 ± 130,000 IE), 

whereas another 14 await a second transplant. Gender was well matched (21 

males, 27 females). The mean recipient age was 42 ± 9 yr. Mean duration of 

type 1 diabetes was 25 ± 11 yr. Mean pretransplant recipient weight was 70 ± 9 

kg. Daily mean pretransplant insulin requirement was 0.6 ± 0.2 IU/kg. The transplant 

is considered to be a success if there is restoration of sustained euglycemia 

either without any exogenous insulin or with reduced insulin requirement. Independence 

from insulin injections is defined by (1) fasting glucose levels of more 

than 7.8 mMl/L more than three times a week (using the morning fasting glucose 

level) and (2) 2-h postprandial glucose values (using any postmeal glucose) 

of more than 10 mM/L more than four times a week. The transplant is also 

considered to be a success even if an intercurrent illness or other event (such as 

high tacrolimus levels) requires insulin for more than 14 d, provided medical 

assessment after the event demonstrates insulin independence and adequate glucose 

control. 

Islets were transplanted under either the original or modified Edmonton protocol 

incorporating infliximab and/or campath-1H. Using Kaplan–Meyer survival 

analysis, the rate of insulin independence at 1-yr post-transplant is 82%. 

(Fig. 4) This compares favorably with previous reports by our group (94–96).


Fig. 5. HbA1c at 3-mo intervals after islet transplantation in subjects who remained 

insulin independent. 

The majority of grafts remain functional beyond 3 yr. Micro anti-insulin antibody 

(MIAA) concentrations generally returned to normal after the discontinuation 

of insulin therapy (124). It is interesting to note, however, that even 

with effective immunosuppression, the presence of autoimmune reactivity in 

some autoantibody-negative recipients with vascularized pancreas allografts 

suggests that an increase in autoantibodies (glutamic acid decarboxylase 

[GAD] and ICA 512 [islet cell antibodies]) and not their presence pretransplant 

may be a better predictor of pancreas and islet graft failure (125). In our latest 

series, prophylactic immunosuppression failed to prevent autoimmune recurrence 

in two cases (at 8.5 and 9 mo, respectively). Both individuals had GAD 

levels in excess of 30 times the upper limit of normal. We intend to retransplant 

these patients using protocols that specifically inhibit the autoimmune 

pathway (126). Tacrolimus toxicity and islet “burnout” (complete loss of insulin 

reserve) resulted in PGF in two patients at 9.5 and 11 mo, respectively. 

Most patients have excellent glycemic control and exhibit normal or improved 

HbA 1C values. Mean HbA 1C values fell significantly from 8.0% pretransplant to 

6.0% posttransplant (Fig. 5). Graft survival (as defined by detectable C-peptide 

>0.5 ng/mL) is 88% over 3 yr, confirming that islet allografts can retain longterm 

function. C-peptide secretion (fasting 2.3 ng/mL vs stimulated 5.8 ng/mL) 

remained stable over 3 yr. Mean body weight was reduced by 6%. 

The treatment has been generally safe and well tolerated. To date there have 

been no deaths, life-threatening infections, malignancies (including posttransplant 

lymphoproliferative disorder [PTLD]), CMV infections, or CMV seroconversions 

despite the use of multiple donor/recipient mismatches, presumably


because the infected lymphocytes are removed during the purification process. 

Two patients developed potentially fatal neutropenia (


All patients enjoy a marked improvement in overall quality of life. The elimination 

of glycemic lability and the life-threatening consequences of unrecognized 

hypoglycemia have been the most obvious benefits (94–97,130). Despite 

prolonged insulin independence and near-normal glycemic control, islet transplantation 

does not restore hypoglycemic counterregulation or symptom recognition 

in recipients with longstanding diabetes and loss of hypoglycemic 

awareness (131). While robust glucagon response to arginine stimulation confirms 

the presence of functioning β-cells, the absence of glucagon and epinephrine 

response to a stepwise hypoglycemic clamp suggests that islets implanted 

in the liver do not function in a physiological manner. This abnormal metabolic 

sensing and signaling may be due to the influence of an unidentified soluble 

factor in the liver or an acquired defect following transplantation such as the 

loss of β-cells during processing. Because the liver is the site of endogenous 

glucose production, higher intrahepatic glucose levels could potentially prevent 

transplanted islets from sensing peripheral hypoglycemia, thus impairing 

glucagon secretion (132). However, this explanation is not satisfactory, as 

intrahepatic islets are implanted on the portal venous side, which has a slightly 

lower ambient glucose level as a result of the mixture of portal vein and hepatic 

artery blood (133,134). The absence of the recovery of epinephrine response to 

glucose and symptom recognition may reflect posttransplant subclinical hypoglycemia 

or the incomplete renervation of the islets in the presence of an underlying 

chronic autonomic neuropathy (133). Tacrolimus, like cyclosporine, has 

been shown to have a direct negative effect on β-cell function, but its effect on 

α-cell function is unclear (87). Although sirolimus has little diabetogenic potential, 

its effect on α-cell function is also unknown (139). The correction of hypoglycemic 

awareness, even in patients with partial grafts, appears to have little 

or no impact on clinical outcomes. However, the failure to restore counterregulatory 

responsiveness has the potential to jeopardize susceptible recipients to 

recurrent episodes of hypoglycemia, especially in individuals who may require 

temporary insulin therapy for an intercurrent illness. Long-term prospective 

studies are therefore needed to determine the significance of this defect and 

whether it regresses over time. 

Metabolic tests have confirmed that graft function remains relatively stable 

over time, but mean insulin reserve is only about 20% of normal. Unfortunately, 

the onset of hyperglycemia often heralds the irreversible destruction of 

more than 90% of the β-cell mass. Glucose tolerance is markedly impaired in 

most patients. To date, only one patient has normal glucose tolerance (95–97). 

There is no simple test to detect islet graft rejection, unlike the situation in 

patients with kidney grafts, where a progressive rise in serum creatinine is 

indicative of organ dysfunction and impending graft failure. The acute insulin 

response to arginine correlated better with transplanted islet mass than acute


insulin response to glucose (AIR g) and area under the curve for insulin (AUC i). 

The AIR g and AUC i were more closely related to glycemic control. The AUC i 

directly posttransplant was lower in those individuals who eventually became 

C-peptide deficient. Therefore, a reduction in AIR g as well as proinsulin levels 

and split-proinsulin levels over time may be an early indicator of graft dysfunction 

(136,137). Preliminary findings in our series suggest that both total 

intact and split-proinsulin levels and total intact and total split- proinsulin–to– 

insulin ratios are significantly lower in transplanted patients. Low proinsulin 

levels may reflect a suboptimal β-cell mass. Low proinsulin-to-insulin ratios 

strongly suggest that intrahepatic islets release insulin into the systemic circulation 

via the hepatic vein rather than into the portal venous system. It is 

unknown at this time whether impaired glucose tolerance with insulin independence 

and a normal HbA 1C will be adequate protection against secondary 

complications of diabetes. Thus, the long-term outcome of islet transplantation 

remains under proactive review. 

2.7. International Multicenter Trial of the Edmonton Protocol 

The Immune Tolerance Network (ITN) is a collaborative international agency 

dedicated to developing clinical tolerance therapies for a wide range of immunerelated 

conditions, including transplantation and autoimmune diseases (138). The 

ITN, with generous financial support from the Juvenile Diabetes Research Foundation 

(JDRF) and the National Institutes of Health (NIH), is committed to implementing 

(1) novel short-term immunotherapeutic strategies that involve gradual 

weaning and complete withdrawal of all immunosuppressants by 1 yr and (2) 

tolerance protocols incorporating hemopoietic chimerism with an emphasis on 

T-cell depletion and irradiation-free regimens. 

The Edmonton protocol and its minor variants have been successfully replicated 

in more than 25 centers worldwide, with cumulative data from more than 

300 patients. Encouraging findings from the ongoing (3-yr) ITN international 

multicenter trial include the following: 

1. Insulin independence has been achieved in 75% of single-donor islet transplants 

using a protocol of perfluorochemical-based (two-layer) preservation, short-term 

culture, and preemptive co-stimulatory signal blockade (139,140). 

2. Islets cultured for 24–48 h in antioxidant-enriched Miami medium improves the 

quality of islet preparations and facilitates the shipment of islets between centers 

(141). 

3. Perfluorochemical (PFC)-based preservation optimizes islet recovery and posttransplant 

graft function without inducing oxidative stress (142–147). 

4. Rescue gradients improve the recovery of trapped islets lost during purification 

(C. Ricordi, personal communication). 

5. Insulin independence has been achieved with islet grafts derived from NHBDs 

(148).


6. Sirolimus-based therapy can induce insulin independence following sequential 

kidney–islet transplants (149). 

7. Anti-inflammatory and calcineurin-inhibitor-free strategies with profound T-cell 

depletion have been shown to improve islet engraftment (97,150). 

3. In Search of the Elusive Islet 

The Collaborative Islet Transplant Registry (CITR), funded by the NIH and 

administered by the EMMES Corporation of Rockville, Maryland, is collecting 

comprehensive data from centers in the United States and Canada and will 

share this information with the ITR (151). 

3.1. Technical Challenges in Clinical Islet Transplantation 

Many technical and ethical challenges must be addressed if clinical islet 

transplantation is to move forward (152). Cooperation between organ transplant 

centers, the procurement team, and the isolation laboratory is crucial if 

all available cadaveric pancreata are to be referred appropriately and expeditiously. 

Islet yields remain quite variable (typically 25–75% of the potential 

islet mass). Clinical results vary considerably across centers despite comprehensive 

efforts to standardize isolation/purification procedures and establish 

strict quality control criteria in accordance with World Health Organization 

(WHO) Good Manufacturing Practice (GMP) guidelines (153). The production 

of high-quality islets is expensive, labor-intensive, and time-consuming. 

Because the process has a steep learning curve and has yet to be standardized, 

the technology would be best served by establishing centralized processing 

facilities and regional networks dedicated to recruiting potential recipients and 

procuring and transplanting organs (78). 

Efforts to manufacture high-yield preparations suitable for clinical transplantation 

have been challenging. Numerous methods have been attempted, 

including continuous or discontinuous density (isopygnic) gradients, magnetic 

microspheres coated with islet or cytotoxic antiacinar MAbs, photothermolysis 

of exocrine tissue by antibody-mediated radiosensitization, exploitation of the 

osmotic permeability differential between the exocrine and endocrine tissues, 

fluorescence-activating cell sorting, cryopreservation, antiacinar cytotoxic antibodies, 

tissue culture, and cell sorting by simple filtration (154). 

Some concern has been raised about the assay used to determine islet viability. 

The gold standard is the fluorescein diacetate/propidium iodide (FD/PI) 

membrane integrity technique (110,155). Preliminary data from our laboratory 

using Syto-Green and ethidium bromide (SG/EB) suggests that the former 

method considerably overestimates the extent of islet viability (156). 

Despite efforts to manufacture highly purified and standardized collagenase 

blends, the heterogeneity of the preparations, the quality and nature of


Fig. 6. The Continuous Glucose Monitor System (CGMS) (MiniMed, Sylmar, CA). 

donor pancreata, and prolonged cold ischemia times hamper a process that is 

inherently difficult to control (157). One solution would be to determine the 

acinar, ductal, and endocrine elements of the donor pancreas using sophisticated 

genetic or phenotypic and molecular assays and then prepare an enzyme 

cocktail incorporating specific recombinant collagenase enzymes for each 

donor pancreas (158,159). 

Careful patient selection is essential as clinical islet transplantation becomes 

more widely available. Lability has been difficult to characterize (160). We 

have developed a new scoring system, the lability index (LI), as a means to 

better assist the selection of potential recipients, particularly those with severe 

metabolic lability, who may have been overlooked by the less reliable mean 

amplitude glycemic excursion scoring system (161). The latter, which is based 

upon seven readings per 24 h for 2 consecutive days, provides an inaccurate 

analysis of lability. The Continuous Glucose Monitor System (CGMS; Mini- 

Med, Sylmar, CA) has been very effective in monitoring real-time blood glucose 

trends of highly labile diabetics (162). This device has helped to document 

improvements in blood glucose control and predict whether another transplant 

is required (Fig. 6). Metabolic studies have shown that an implant mass of 

16,400 IE/kg is necessary to reduce insulin requirements by 1 IU. 

3.2. Pancreas Preservation Before Islet Isolation 

Although UW solution has proven to be very effective for vascularized pancreas 

preservation, organs stored in UW solution before islet isolation for even


Fig. 7. Two-layer (University of Wisconsin solution/perfluorochemical [UW/PFC]) 

cold-storage method. The pancreatic graft is on the surface of PFC, covered with UW, 

and oxygenated during preservation mainly because of direct diffusion of dissolved 

oxygen in PFC. 

short periods has a profoundly negative impact on islet yields and clinical outcomes. 

In some circumstances it may be more appropriate to defer a cadaveric 

graft intended for vascularized pancreas transplantation, the rationale being 

that a pancreas destined for islet transplantation has a more critical CIT (ideally 


Fig. 8. Prepurification (white) and postpurification (black) islet yields from human 

pancreases after >10 h of cold storage in UW. Additional preservation by the twolayer 

method was performed in the UW–PFC group. *p > 0.05. 

been well documented, little is known about the mechanisms of cold ischemic 

injury on diminishing islet yield over time. Reliable methods for the detection 

of ischemically damaged tissue as well as specific markers predictive of successful 

clinical outcomes are also lacking. 

3.3. Strategies to Improve Islet Engraftment 

Clinical outcomes are influenced by numerous factors that are known to 

exist prior to the donor’s demise, during procurement and preservation, 

throughout the isolation and purification process, during culture, and following 

transplantation (66). Posttransplant metabolic data suggest that 25–75% of 

the islets fail to engraft (95,96). Islets are lost during the early posttransplant 

phase by a variety of non-immune-related mechanisms, including ischemia, 

apoptosis, and nonspecific blood-mediated platelet binding and complement 

activation, a process known as the instant blood-mediated inflammatory reaction 

(IBMIR) (167). Ozmen et al. have demonstrated that IBMIR was responsible 

for both the loss of transplanted islets and portal vein thrombosis (168). 

The reaction, which is mediated by exposure to ABO-compatible blood, can be 

abrogated in an in vitro loop system by blocking the activation of islet-bound 

tissue factor (TF) with MAbs or inhibiting thrombin activity with Melagatran 

or its oral prodrug principle, H376/95 (Astra Zeneca, Gothenburg, Sweden).

72 

Table 2 

Human Islet Transplantation from Pancreases With Additional Preservation by the Two-Layer Method 

Fasting glucose C-peptide at 90 min Glycosylated Exogenous isulin 

Transplanted islets 

(mmol/L) (ng/mL) hemoglobin (%) use (U/kg/d) 

(IE/kg) of recipient’s 

Patient body weight Pre-Tx Post-Tx Pre-Tx Post-Tx Pre-Tx Post-Tx Pre-Tx Post-Tx 

1st Tx 

A 7007 17.6 6.4


These studies suggest that inhibition of TF activity before transplantation or 

clinical protocols incorporating thrombin inhibitors or site-inactivated factor 

VIIa might prevent IBMIR (169). Pretreating islets before transplantation with 

antisensing agents that either block the expression or inhibit the synthesis 

of TF would also eliminate the adverse effects associated with systemic 

therapy. 

Most centers employ short-term culture (typically 24–48 h) prior to transplantation 

(170). It is unknown at this time whether the 10–20% of islets that 

die during culture would also be lost if they were transplanted immediately 

following isolation and purification as described in the original Edmonton 

protocol. Human islets cultured in modified serum-free media (M-SFM) and 

antioxidant-enriched ITS media have exhibited sustained posttransplant viability 

and function (171). Islets cultured in TCM-199 and 95% FCS for 24 h at 

37°C, followed by cooling to 24°C for an additional 24 h, has been shown to 

enhance islet survival in a single-donor–to–single-recipient rat allotransplant 

model (172). Because short-term culture eliminates the need for fresh islets, 

potential recipients are no longer required to live within close proximity of 

the transplant center. Tissue culture also reduces immunogenicity, improves 

islet purity, and possibly prevents portal vein thrombosis. Extended islet culture 

(for days or even months) has the potential to improve clinical outcomes 

by allowing time to (1) better match the donor to the recipient, (2) precondition 

the recipient, (3) expand the islet mass in vitro, and (4) manipulate the 

islets in vitro to improve islet purity, prevent thrombosis, and reduce immunogenicity. 

Encouraging strategies in development or early clinical trials include: 

1. Therapies with growth factors and other biologics to promote neovascularization 

and islet growth (173,174) 

2. Macrophage sequestration therapy with 15-deoxyspergualin (DSG) to enable 

the use of unpurified preparations derived from single-donor pancreata (175, 

176) 

3. Anti-inflammatory treatment directed at neutralizing the effects of pro-inflammatory 

cytokines, most notably TNF-α, with monoclonal antibodies to improve 

engraftment of a marginal islet implant mass (97) 

4. Low-dose aspirin and other platelet antagonists, low molecular weight heparins, 

soluble complement receptor-1 antagonists (TP-10) to prevent portal vein thrombosis 

(177) 

5. Antioxidant therapies (nicotinamide with or without verapamil, vitamin D3 analogs, 

pentoxifylline, lazaroid compounds, and cholesterol-lowering agents) to 

minimize nonimmunological islet injury (178) 

6. Inactivation of major histocompatibility complex (MHC) class II passenger 

dendritic cells by low-temperature high-oxygen culture, antidentritic cell antibodies, 

cryopreservation, or ultraviolet irradiation (179,180)


3.4. Single-Donor Islet Transplantation 

β-Cell replacement therapy will no doubt replace pancreas transplantation 

as the definitive treatment for diabetes. The critical shortage of donor pancreata 

and the inability to recover large numbers of high-quality islets from a single 

pancreas are major obstacles to the widespread application of clinical islet 

transplantation. Some clinicians have argued that the ultimate goal should not 

be insulin independence but rather blood glucose stability (181). Although this 

approach would benefit more patients, we strongly believe that most diabetics, 

particularly those disabled by recurrent episodes of hypoglycemic unawareness 

and marked metabolic lability, would be reluctant to accept the potential 

risks of long-term immunosuppressive therapy if they were to have only partial 

control over their diabetes. While multiple-donor transplants continue to be 

the norm, single-donor–to–single-recipient transplantation may soon become 

a reality as better methods of pancreas preservation, improved islet isolation 

and purification techniques, and innovative strategies designed to promote islet 

engraftment are developed (182). Therefore, insulin independence should remain 

a priority. Autotransplant studies have shown that if ischemic injury and immune 

reactivity can be circumvented, it is possible to induce and maintain normoglycemia 

with fewer islets. Several strategies have shown promise in facilitating 

single-donor islet transplantation limiting non-immune-mediated graft loss and 

improving islet engraftment, including (1) the taming of endogenous enzyme 

activity with serine protease inhibitors during the digestion phase, (2) the use 

of less toxic non-Ficoll gradients, and (3) anti-inflammatory strategies coupled 

with insulin-sensitizing drugs (183,184). 

3.5. Living-Donor Islet Transplantation 

Large animal studies with nonpurified islet grafts suggest that it may be 

possible to treat multiple recipients from a single pancreas (185). A review of 

111 live-donor segmental pancreas transplants performed at the University of 

Minnesota initially demonstrated that donors had only a modest increase in 

procedure-related complications (21,22). The avoidance of obese donors and 

high-risk individuals with positive autoantibody serology has largely eliminated 

this problem (41). Live donation of a segmental graft specifically for 

islet transplantation (perhaps by laparoscopic and hand-assisted removal) is an 

attractive alternative, but the risk of inducing diabetes or creating a pancreatic 

fistula in an otherwise healthy donor is a major concern (186). 

3.6. Stem Cell Technology, Xenotransplantation, and Gene Therapy 

Islet transplantation in its present form would benefit less than 0.5% of type 

1 diabetics. It has long been recognized that alternative sources of insulinproducing, 

glucose-responsive tissue must be found to treat the more than 175


million children and adult diabetics worldwide (187). ”Islet farming” may be 

one solution. Embryonic stem cells have been transformed into islet-like clusters 

that reverse diabetes in mice (188). Human embryonic stem cells have 

been coaxed to secrete insulin, albeit in low concentrations and without glucose 

feedback (189). Human adult stem cells and pancreatic ductal elements 

have been induced to transdifferentiate into islet-like or insulin-producing cells 

(190). Adult stem cells expressing c-kit have induced islet regeneration and 

reduced hyperglycemia in streptozotocin-induced diabetic mice (191). A novel 

proliferating insulin-secreting cell line derived from a neonate with persistent 

hyperinsulinemic hypoglycemia of infancy (PHHI), also known as nesidioblastosis, 

has proven to be a useful tool in diabetes-related research. NES2Y βcells 

not only lack functional ATP-sensitive K + channels, they also exhibit 

impaired expression of the insulin gene-regulatory protein transcription factor, 

PDX-1 (or IUF-1). Triple transfection with the genes encoding the two subunits 

of the K + ATP channel and PDX-1 appears to restore glucose-responsive 

insulin secretion in vitro. However, preclinical studies are required to determine 

if these cells can indeed maintain physiological glucose homeostasis and 

will not undergo senescence or degenerate into malignant cells over time 

(192). 

Xenotransplantation has great potential as a means to alleviate the critical 

shortage of organs, but controversial ethical and epidemiological concerns must 

be overcome. Pigs are the most favored source of donor tissue because they are 

in plentiful supply and share a number of physiological and anatomical similarities 

with humans. Porcine insulin, which differs from human insulin by 

only one amino acid, was used successfully for decades but has since been 

replaced with recombinant insulin (193). The public fear of a porcine endogenous 

retrovirus (PERV) pandemic has significantly delayed clinical trials. 

Even though there have been reports that PERV is transcriptionally active and 

infectious across species in vitro, there is no evidence of viral transmission, 

clinical infection, or disease in humans with porcine xenografts (194). Selective 

breeding, targeted gene deletion (colloquially termed gene knockout), and 

cloning are possible solutions to this dilemma. Transgenic pigs expressing 

human complement-regulatory proteins have been developed to overcome 

hyperacute discordant rejection, but very large doses of cyclophosphamide are 

required (195). The role of this phenomenon in xenotransplantation is uncertain 

because xenograft rejection also occurs in complement-deficient rodent 

models, suggesting that other mechanisms are also involved (196). Fetal porcine 

islet-like cell clusters (ICCs) have reversed diabetes in experimental animals. 

Although co-transplantation of porcine ICCs and a kidney in human 

diabetics did not induce insulin independence, porcine C-peptide was detectable 

in the urine for 200–400 d (197). Adult porcine islets are very fragile and


difficult to isolate, although some researchers have reported some success 

(43,198). Korbutt et al. have developed an isolation and culture technique that 

consistently yields large numbers of functional neonatal porcine islet clusters 

(110). Neonatal porcine islets, which have the unique ability to replicate in 

vitro and in vivo, are more susceptible to hyperacute xenorejection than adult 

porcine islets. Since the latter expresses very little of the gal α [1,3] gal epitope, 

microencapsulation of transgenic neonatal pig islet clusters might overcome 

these barriers (199). Despite the concerns and problems of xenotransplantation 

described above, clinical trials using porcine fetal and neonatal ICCs have been 

undertaken worldwide (197,200,201). 

Conceptually, gene therapy involves treating an organ prior to transplantation 

by activating or dampening specific genes known to be involved during 

the early phase of acute graft rejection. The goal is to convince the host immune 

system to recognize the transplanted organ as self. One major advantage of 

pretreating the organ before transplantation is the elimination of the recipient’s 

immune response to the viral vector itself when it is administered systemically. 

Other promising approaches in β-cell replacement therapy include the generation 

of a human endocrine pancreatic cell line by transfection with SV40 

DNA, induction of islet neogenesis, transformation of hepatocytes to secrete a 

single-chain insulin analog, expansion of cloned human insulin-producing cell 

lines, tissue engineering of β-and non-β-cells to secrete insulin, and genetic 

engineering of intestinal mucosal K-cells to secrete insulin (202,203). Major 

challenges thwarting clinical application of these technologies at this time 

include the inability to both induce physiological glucose-sensing with positive 

feedback mechanisms and prevent senescence or malignant transformation. 

Many technological and biological limitations as well as ethical, political, 

and regulatory obstacles must be overcome (204,205). While many of these 

issues appear to be insurmountable, a large prospective multicenter trial based 

on a classical randomized control-test paradigm with clearly defined endpoints 

and rigorous scrutiny of all data would allow these technologies to move closer 

to clinical reality. 

4. Novel Immunosuppressive Strategies 

in Clinical Islet Transplantation 

The ultimate goal of islet transplantation is to reestablish physiological glucose 

homeostasis with an abundant source of insulin-producing tissue and 

eliminate the need for immunosuppressive therapy. However, the complexity 

of the human immune system (and a limited understanding of the mechanisms 

of autoimmune recurrence in particular), the inability to detect early allograft 

rejection, and the lack of a preclinical autoimmune model of diabetes are major


obstacles (64,206). Despite overwhelming success in small animal models, the 

induction of permanent graft function or stable tolerance in large animals, nonhuman 

primates, and humans have been elusive. 

4.1. Graft Accommodation and Minimal Immunosuppression Therapy 

Accommodation, or the acceptance of a graft as self, is a well-recognized 

phenomenon in experimental and clinical organ transplantation. Although the 

mechanism is not completely understood, it enables the tapering of drug dosages 

to subtherapeutic levels and, in some cases, the complete withdrawal of 

all antirejection agents without destabilizing the graft (207–211). This approach 

has the potential to significantly reduce the risk of drug-related side effects, 

lymphoma and other malignancies, graft-vs-host disease (GVHD), and lifethreatening 

nosocomial and opportunistic infections. One of the most effective 

means of promoting robust tolerance is donor-specific bone marrow transplantation 

following myeloablation (212). High-dose whole-body irradiation and 

powerful chemotherapeutic agents are very effective cytoablative modalities 

for treating hemopoietic malignancies, but this approach is difficult to justify 

in islet transplantation. Unlike other transplant recipients whose only hope for 

survival is a vital organ transplant, the majority of diabetics can be safely managed 

with insulin (7,8). However, carefully selected patients with unstable 

diabetes arguably represent the ideal population to test the efficacy of nonmyeloablative 

methods and new tolerance protocols as the risk–benefit ratio is 

clearly in their favor (213). 

Some liver, kidney, and pancreas transplant recipients have been successfully 

withdrawn from all immunosuppressants for one or more reasons at various 

times posttransplant (207). Starzl et al. were able to deliberately wean a 

small number of patients with liver and kidney grafts off all immunosuppression 

(208). This concept of late operational tolerance was further developed in 

a large study of liver, kidney, pancreas, and intestinal transplants using 

thymoglobulin induction and tacrolimus monotherapy unless other agents were 

required to suppress breakthrough rejection (209). Despite histological evidence 

of immune activity, about 60% of recipients with surviving grafts after 1 

yr were safely weaned to tacrolimus dosing once a week. Tanaka and Kiuchi 

were also able to successfully withdraw all immunosuppressive agents in more 

than 60 children who received living-donor liver transplants (214). Tacrolimus 

monotherapy was reduced to once a week prior to complete drug withdrawal. 

Although the mechanism of operational tolerance in these patients has not been 

defined, it is believed to be a result of the large number of host CD4 + CD25 + 

regulatory T-cells (211). It is not known whether this tolerance will remain 

stable over time. Experimental and clinical studies have shown that there is a 

risk of accelerated chronic rejection (212).


4.2. Islet Transplantation in Immunoprivileged Sites 

The existence of immunoprivileged sites was recognized very early in the 

development of organ transplantation when researchers attempted to transplant 

nonhemopoietic tissues and cells such as thyroid and parathyroid tissue following 

radical surgery for malignancy and fetal brain tissue or adult adrenal 

tissue to treat Parkinson’s disease (215). The immunoprotective properties of 

the testis (the most studied site), vitreous humor of the eye, brain, and thymus 

cannot be explained solely on the basis of a simple physical barrier. Fas-Fas 

ligand (Fas-FasL) interaction and other antiapoptotic pathways are most likely 

responsible for this unique feature (216). Islets transplanted in immunoprivileged 

sites have demonstrated marked prolongation or indefinite survival (217). 

Islet allografts transplanted into intra-abdominally placed testes, co-transplantation 

of allogeneic islets and testicular cell aggregates, and co-encapsulation 

of Sertoli-enriched testicular cell fractions with islet xenografts have afforded 

some degree of immunological protection (218,219). 

4.3. Immunoprotection Through Bioencapsulation 

Cell encapsulation technology has enormous clinical potential as a therapeutic 

modality for the management of a wide range of diseases including diabetes, 

hemophilia, cancer, and renal failure (220,221). In 1954 Algre et al. 

demonstrated that cultured cells enveloped by a semi-permeable membrane 

prevented allograft rejection (222). Ten years later, Chang proposed using artificial 

microcapsules for the immunoprotection of transplanted cells (223). 

While bioengineering initially promised to prevent allograft and xenograft rejection 

by eliminating cell–cell contact and interaction with large molecular 

weight immuno-globulins, islet graft destruction through toxic cytokine-mediated 

pathways suggests that complete immunological protection will be a more 

formidable obstacle if only insulin, nutrients, and metabolic waste products are 

to diffuse freely across the membrane (224). Several immunoisolation systems 

have been developed including devices anastomosed to the vascular system as 

arteriovenous (AV) shunts, diffusion chambers or macrocapsules, and spherical 

microcapsules (225). Experimental diabetes has been cured in rodents implanted 

with microencapsulated islets. The intense fibrosis and destruction of the encapsulated 

tissue induced by contaminants in the alginate carrier or by shed graft 

antigens has been a frustrating obstacle. Few studies have been able to demonstrate 

consistent and unequivocal protection against autoimmune recurrence 

unless combined with immunosuppressants or monoclonal antibodies (226). 

However, sustained insulin independence has been achieved beyond 9 mo in 

spontaneously diabetic dogs after intraperitoneal implantation of microencapsulated 

islet allografts (227). To date, only one patient treated with microencapsulated 

islets transplanted into the peritoneal space has achieved insulin


independence in the absence of immunosuppression (228). Sun et al. demonstrated 

the potential of microencapsulated xenografts when cynomologus 

monkeys with autoimmune diabetes were implanted with adult porcine alginate-encapsulated 

islets and remained normoglycemic for 803 d without any 

adjunctive immunosuppression (229). BALB/c and nonobese diabetic (NOD) 

mice transplanted with syngeneic and allogeneic islets encapsulated with an 

inert non-poly-L-lysine-alginate (barium chloride) carrier were rendered normoglycemic 

beyond 350 d (230). 

4.4. Innovations in Tolerance Induction 

T-cell activation and clonal expansion is a complex process that involves 

engagement of donor antigen with a T-cell receptor (TCR), which consists of 

the TCR itself and its corresponding CD3 complex, or a non-antigen-specific 

inductive stimulus (co-stimulator) provided by an antigen-presenting cell (APC) 

(231,232). There are two pathways of graft antigen presentation: (1) the direct 

pathway, where recipient T cells recognize antigens in the context of a major 

histocompatability complex (MHC) on the surface of donor APCs that are 

capable of co-stimulatory activity (donor APC dependent), and (2) the indirect 

pathway, whereby host T cells recognize graft antigen in the form of a peptide 

in the cleft of the recipient class II molecules, which is then processed and 

presented by host APCs (host APC dependent). Both pathways are believed to 

play a role in allograft rejection, although the direct pathway is perhaps the 

most crucial initially, whereas the indirect pathway is the primary mediator of 

chronic rejection, particularly in xenograft rejection. The interaction of the TCR 

complex with the donor antigen activates the first signal (signal 1). Co-stimulation, 

or signal 2, is provided by the interaction of a myriad of surface molecules 

and APCs, the most prominent chimeric cell being the dendritic leukocyte (233). 

T-cell co-stimulation by molecules on the APC is required for optimal T-cell 

proliferation (signal 3). Co-stimulation blockade results in functional inactivation 

(anergy) of the corresponding T cell and triggers apoptosis. 

A number of novel immunosuppressive biologics are in preclinical development 

or early clinical trials (234) (Table 3). The major targets of these agents 

are (1) cell-surface molecules involved in recipient/donor immune cell interactions 

(most importantly, the co-stimulatory pathway), (2) signaling pathways 

involved in T-cell activation, cytokine production, and T-cell proliferation, and 

(3) trafficking and recruitment of immune cells associated with graft rejection. 

Some of the most promising agents include (1) campath-1H induction and 

anti-inflammatory prophylaxis with infliximab (97), (2) a humanized anti- 

CD11a MAb (anti-LFA1), (3) a second-generation humanized CTLA4-Ig MAb 

(LEA29Y) directed against B7.1/B7.2, (4) a humanized CD45 MAb (anti- 

CD45RB), and (5) a humanized anti-CD52 antibody (anti-CD52).


Table 3 

Major Targets of New Agents in Immunosuppression Development 

• Interference with cell-surface molecules important in immune cell interactions 

• Inhibiting signaling mechanisms 

• Inhibiting T-cell proliferation 

• Alter trafficking and recruitment of immune cells responsible for rejection 

4.5. Intrathymic Induction 

The recent discovery by Nomura et al. that the thymus also produces small 

amounts of insulin has important implications in the pathogenesis and treatment 

of type 1 diabetes (235). It is believed that the higher levels of thymic 

pro-insulin expression might promote negative selection (deletion) of autoreactive 

T lymphocytes. This may explain why NOD mice are protected from 

primary disease when islets are implanted in the thymus (236). Tolerance is 

achieved by the deletion of alloreactive cells migrating through the thymus 

before they encounter donor antigen in the peripheral circulation (237). 

Intrathymic inoculation of donor antigens such as islets, splenocytes, lymphocytes, 

and donor-specific MHC peptides has resulted in the long-term survival 

of rodent islet allografts (238). Intrathymic implantation of bone marrow 

supplemented with a single dose of ALG has also been shown to induce tolerance 

in rodents by thymic T-cell-negative selection after donor-specific islet 

transplantation (239). While small animal studies have confirmed the effectiveness 

of this approach, clinical application has been limited as a result of 

age-related thymic atrophy, technical difficulties, and the fact that alternative 

sites for either positive or negative T-lymphocyte selection have been poorly 

characterized (240). 

4.6. Mixed Hemopoietic Microchimerism 

Donor bone marrow infusion following myeloablation has been used to 

induce high-level microchimerism and tolerance of donor immune cells in 

recipients with hematological malignancies (212,241). The extent of stable nonresponsiveness 

depends on the degree of chimeric activity (242). High-dose 

bone marrow transplantation in the presence of effective immunosuppression 

significantly reduces human liver rejection rates and enhances graft survival 

(243). Preliminary trials of bone marrow infusion combined with other solid 

organ or islet transplants suggest that donor-specific tolerance can be achieved 

(244). Ricordi et al. demonstrated that donor-specific bone marrow transplantation 

without myeloablation and temporary immunosuppression resulted in a 

high level of donor microchimerism and unresponsiveness to islet allografts in 

rats for more than 6 mo (245).


4.7. Co-Stimulation Blockade 

One of the most interesting strategies is co-stimulation blockade with monoclonal 

antibodies to prevent signal 2 activation at the time of transplantation 

while leaving signal 1 TCR–antigen engagement unaltered. In 1991 Linsley et 

al. reported that the fusion protein antigen-4-immunoglobulin (CTA4-Ig) could 

uncouple second-signal interaction and prevent activation by binding to CD28- 

B7.1/B7.2 molecules on both cytotoxic T and B cells, respectively (246). 

CTLA4-Ig has been shown to prolong allograft and xenograft function in cardiac, 

renal, small bowel, and lung transplant models in rodents and was more 

efficacious when combined with donor-specific bone marrow transplantation 

and/or low-dose immunosuppression (229,247). CTLA4-Ig administration has 

enhanced survival of islet allografts and xenografts (248,249). Co-transplantation 

of CTLA4-Ig-secreting myoblasts or biolistic delivery of the CTLA4-Ig 

gene have also been shown to improve islet allograft survival in diabetic mice 

(250). Humanized CTLA4-Ig and monkey islet allografts led to suppression of 

both humoral and cellular immune responses and a prolonged graft-survival 

rate of 40% (251). An even more potent CTLA4-Ig, LEA29Y, has been shown 

in primate islet transplant studies and clinical trials of patients with rheumatoid 

arthritis and renal transplantation to be safe and effective (252,253). Murineskin 

allograft transplant models treated with either CTLA4-Ig or anti-CD40L 

alone did not result in long-term engraftment. However, combined co-stimulation 

blockade with both agents led to dramatic synergistic interaction and longterm 

survival and function (254). These inhibitors were also effective in 

preventing antigen sensitization in murine islet transplantation (255). This has 

important implications for clinical islet transplantation, particularly when multiple 

donors are required to achieve insulin independence. Kirk et al. found that 

administering anti-CD40L or CTLA4-Ig significantly extended renal graft survival 

in rhesus monkeys but that co-administration of both agents led to indefinite 

survival and donor-specific tolerance to secondary skin grafts (256). We 

have found that inducible co-stimulator (ICOS) signaling blockade in combination 

with sirolimus or additional co-stimulatory blockade significantly reduced 

allospecific T-cell proliferation and effector function and induced operational 

tolerance of islet allografts (257). 

CD40-CD40L interaction plays a critical role by upregulating T-cell adhesion 

(B7) molecules and TF expression on the surface of endothelial cells 

(258,259). CD40L is expressed on activated CD4 + T cells, stimulated mast cells, 

basophils, activated platelets, and vascular endothelium of various organs. 

Blockade of the CD40/CD40 ligand (CD40L) pathway can induce long-term 

tolerance of renal allografts in monkeys and other nonhuman primates (260– 

261). Despite impressive evidence in rodent models and preclinical studies with 

primates, the phase I trial of a humanized monoclonal antibody directed against


CD40L (anti-CD154) in patients with rheumatoid arthritis was abruptly halted 

following reports of unexpected thromboembolic complications, including one 

fatality (254). Biogen’s Hu5C8 MAb has an increased binding capacity for 

islets, which in turn sets up the scenario for thromboembolism. While thromboembolic 

complications have been reported previously with other antibodies 

in humans and monkeys, highly refined humanized preparations have eliminated 

most of the risk (262). Kenyon et al. demonstrated that Hu5C8 MAb 

extended functional islet allograft survival in rhesus monkeys and baboons but 

also reversed multiple episodes of rejection without any evidence of thromboembolic 

complications (260,261). IDEC131 (E6040) (IDEC Pharmaceuticals 

Corporation, San Diego, CA), which targets a different epitope of Hu5C8, 

has been used effectively in patients with systemic lupus erythematosus and 

psoriasis. Anti-CD40 therapy, which targets CD40 directly, has safely extended 

renal allograft survival in nonhuman primates (263). 

If techniques to induce robust tolerance to alloantigens fail to protect the 

graft from autoimmune attack, an adjuvant strategy of co-stimulatory blockade 

or bone marrow conditioning in combination with micro-dose immunosuppression 

would be a logical approach. Low-dose sirolimus in the absence of glucocorticoids, 

which are also known to interfere with active tolerance pathways, 

has a distinct advantage because apoptosis remains unimpaired in activated T 

cells (264). 

Another effective strategy is the induction of peripheral tolerance with 

anti-CD3-based diphtheria-conjugated immunotoxin (265,266). Knechtle et 

al. reported that renal allografts transplanted into nonhuman primates were 

able to maintain rejection-free tolerance for more than 4 yr following a 2-wk 

induction course with diphtheria immunotoxin (266). The underlying mechanism 

of this operational tolerance involved the immunotoxin-mediated depletion 

of circulating and sessile naive and memory T-cell subtypes, while the 

dual action of DSG blocked the activation of pro-inflammatory cytokines 

induced by the immunotoxin and promoted indefinite systemic production of 

T-helper cell (Th2) cytokines. 

Calcineurin inhibitors have been the cornerstone of immunosuppression regimens 

since the introduction of cyclosporine in 1983. However, they have not 

had a dramatic impact on long-term renal graft outcome as measured by graft 

half-life (267). In a side-by-side study of tacrolimus vs cyclosporine, 66% of 

renal allograft biopsies at 2-yr posttransplant had evidence of chronic transplant 

nephropathy (268). Acute rejection and acute nephrotoxicity (especially 

in cyclosporine-treated patients) at 1 yr posttransplant had a strong correlation 

with the development of chronic transplant nephropathy. While these agents no 

doubt provide effective immunosuppression, calcineurin inhibitors also undermine 

the mechanisms of establishing tolerance. Consequently, there has been


much debate about eliminating or reducing the reliance on calcineurin inhibitors. 

In 1999, Solez et al. reported the first multicenter trial of a calcineurininhibitor-sparing 

regimen in primary renal transplants (269). Daclizumab, 

MMF, and steroids were demonstrated to be safe and effective. At 4-mo follow-up, 

45% of patients had developed biopsy-proven acute rejection and were 

treated with corticosteroids and/or a humanized anti-CD3 monoantibody 

(OKT3-α1-Ala-Ala or OKT3). Patients exhibiting signs of graft failure were 

treated with calcineurin inhibitors. Even so, 60% of recipients were able to 

remain off calcineurin inhibitors with excellent renal function, as evidenced by 

significantly prolonged mean and median times to rejection. 

The most promising tolerance protocols use a combination of modalities. 

Central tolerance through mixed chimerism is based on the intrathymic clonal 

deletion of alloreactive T cells and the removal of immunoreactive antibodies 

to the donor graft by implanting donor-specific bone marrow cells in the recipient 

prior to islet transplantation. This method has been successful with skin 

allografts in rodents, skin and kidney allografts in pigs, kidney and discordant 

heart xenografts (pig-to-sheep), and kidney transplants in primates (245,270). 

Bone marrow replacement following total body irradiation and anti-CD40L 

(CD154) antibody therapy induced donor-specific allotolerance in NOD mice 

without autoimmune recurrence and prolonged islet graft function beyond 100 

d (271). Durham et al. showed that B6 recipients of totally MHC-mismatched 

BALB/c skin grafts treated with repeated doses of donor bone marrow and anti- 

CD40L developed durable (>300 d) multilineage hemopoietic chimerism and 

both indefinite (>300 d) allograft acceptance and donor-specific tolerance to 

secondary skin grafts without cytoreductive conditioning (272). 

5. Islet Cell Transplantation, Children, and Type 2 Diabetes 

Judicious split/mixed or basal/bolus insulin therapies are excellent treatment 

modalities for the majority of pediatric patients (273,274). The risks associated 

with islet transplantation are significantly lower than those associated with pancreas 

transplantation (21,94). Because end-organ damage evolves over many 

years, the trade-off of exchanging frequent blood glucose testing, daily insulin 

injections, and dietary restrictions for life-long immunosuppression cannot be 

justified in all children or adolescents at this time (275). However, deliberately 

exposing high-risk individuals to the risks of a steroid-free immunosuppression 

regimen has some merit, especially those experiencing (1) recurrent episodes 

of unexplained severe hypoglycemia and its life-threatening sequelae, 

despite optimal medical management (7,8), (2) the presence of progressive vascular 

complications (particularly retinopathy and nephropathy), which have the 

potential of severe disability and premature death in early or mid-adulthood 

(276), and (3) concurrent immunosuppressive therapy for a co-morbidity (such


as kidney, heart, or liver transplant) that can be safely and effectively treated 

with a steroid-free regimen (277,278). Clinical trials are underway in North 

America and Europe to assess the efficacy of OKT3 in children and adolescents 

with new-onset type 1 diabetes. We are also assessing the impact of de novo 

islet-alone transplantation in children who are at risk of premature death from 

severe metabolic lability. In the meantime, insulin therapy will continue to be 

the method of choice for the majority of type 1 diabetics. 

The underlying metabolic defect in type 2 diabetes is the result of insulin 

resistance from abnormalities in insulin receptor number, function, and 

postreceptor signaling (279). β-Cell dysfunction can also coexist in type 2 diabetes 

and has been demonstrated in small animal models of type 2 diabetes 

(280). Chronic liver disease is associated with impaired glucose tolerance and 

diabetes (281). Combined islet–liver allografts in patients with cirrhosis and 

overt type 2 diabetes, which occurs in about 20% of cirrhotic patients, have 

much greater improvements in insulin requirements, HbA 1C levels, and overall 

metabolic control than one would expect with orthoptic liver transplantation 

alone (282,283). Retrospective studies of pancreas transplants performed inadvertently 

in type 2 diabetics have shown excellent long-term graft function 

with insulin independence (284). It is unclear at this time if pancreas transplantation 

can override the abnormal insulin demand caused by peripheral insulin 

resistance without β-cell exhaustion, or whether patients with high C-peptide 

levels inadvertently transplanted represent an atypical subgroup of type 2 diabetics 

with mutations in the glucokinase gene. Small animal and preliminary 

clinical studies suggest that 10 times more islets might be required to overcome 

the effects of peripheral insulin resistance (285). While islet and pancreas 

transplantation will continue to dominate the management of type 1 

diabetes, prospective randomized trials incorporating metabolic studies would 

help to define the nature of the disease and whether β-cell replacement therapy 

has a role in the treatment of type 2 diabetes. Islet transplantation as a treatment 

option for type 2 diabetes must therefore await the development of other 

tissue sources. 

6. Conclusions 

There has been remarkable progress in clinical islet transplantation since 

the introduction of the Edmonton protocol nearly 5 yr ago. Insulin independence 

with effective immune prophylaxis can be achieved in more than 83% 

of recipients at 1 yr posttransplant. Islet transplantation has effectively eliminated 

glycemic lability and the sequelae of severe hypoglycemia. All of our 

patients, even those who are not insulin-free, consider the transplant to be 

worthwhile and beneficial. Emerging worldwide data suggest that positive 

protective effects on secondary diabetic complications will emerge at 5–10 yr


posttransplant. The clinical reality of immunologic tolerance is on the horizon 

and may very well be first accomplished in the field of islet transplantation. 

The continuing success of the Edmonton protocol is most encouraging and is 

only one of many developments in the quest to cure diabetes. 

References 

1. Gepts, W. (1984) Islet morphology in type I diabetes. Behring Ins t. Mitt. (75), 

39–41. 

2. Atkinson, M. A. and Eisenbarth, G. S.(2001) Type 1 diabetes: new perspectives 

on disease pathogenesis and treatment. Lancet 358(9277), 221–229. Erratum in 

Lancet 358(9283), 766. 

3. Rabinovitch, A. and Suarez-Pinzon, W. L. (2003) Role of cytokines in the pathogenesis 

of autoimmune diabetes mellitus. Rev. Endocr. Metab. Disord. 4(3), 291– 

299. 

4. Boyle, J. P., Honeycutt, A. A., Narayan, K. M., et al. (2001) Projection of diabetes 

burden through 2050: impact of changing demography and disease prevalence in 

the U.S. Diabetes Care 24, 1936–1940. 

5. Tan, M. H. and MacLean, D. R. (1995) Epidemiology of diabetes mellitus in 

Canada. Clin. Invest. Med. 18(4), 240–246. 

6. Rubin, R. J., Altman, W. M., and Mendelson, D. N. (1994) Health care expenditures 

for people with diabetes mellitus. J. Clin. Endocrinol. Metab. 78(4), 809A– 

809F. 

7. The Diabetes Control and Complications Trial Research Group. (1993) The effect 

of intensive treatment of diabetes on the development and progression of longterm 

complications in insulin-dependent diabetes mellitus. N. Engl. J. Med. 329 

(14), 977–986. 

8. The Diabetes Control and Complications Trial Research Group. (1997) Hypoglycemia 

in the Diabetes Control and Complications Trial. The Diabetes Control and 

Complications Trial Research Group. Diabetes 46(2), 271–286. 

9. Turner, R. C. and Holman, R. R. (1996) The United Kingdom Prospective Diabetes 

Study. UK Prospective Diabetes Study Group. Ann. Med. 28(5), 439– 

444. 

10. Chase, H. P., Lockspeiser, T., Peery, B., Shepherd, M., MacKenzie, T., Anderson, 

J., and Garg, S. K. (2001) The impact of the diabetes control and complications 

trial and humalog insulin on glycohemoglobin levels and severe hypoglycemia in 

type 1 diabetes. Diabetes Care 24(3), 430–434. 

11. American Diabetes Association. (2002) Position statement: evidence-based nutrition 

principles and recommendations for the treatment and prevention of diabetes 

and related complications. J. Am. Diet. Assoc. 102(1), 109–118. 

12. American Diabetes Association. (2003) Position statement: continuous subcutaneous 

insulin infusion. Diabetes Care 26(Suppl. I), S125. 

13. Howard, G., O’Leary, D. H., Zaccaro, D., et al. (1996) Insulin sensitivity and 

atherosclerosis. The Insulin Resistance Atherosclerosis Study (IRAS) Investigators. 

Circulation 93(10), 1809–1817.


14. Despres, J. P., Lamarche, B., Mauriege, P., et al. (1996) Hyperinsulinemia as an 

independent risk factor for ischemic heart disease. N. Engl. J. Med. 334(15), 952– 

957. 

15. Ryan, E. A. (1998) Pancreas transplants: for whom? Lancet 351(9109), 1072–1703. 

16. Robertson, R. P., Davis, C., Larsen, J., Stratta, R., and Sutherland, D. E. (2003) 

American Diabetes Association. Pancreas transplantation for patients with type 1 

diabetes. Diabetes Care 26(Suppl. 1), S120. 

17. Fioretto, P., Steffes, M. W., Sutherland, D. E., Goetz, F. C., and Mauer, M. (1998) 

Reversal of lesions of diabetic nephropathy after pancreas transplantation. N. Engl. 

J. Med. 339(2), 69–75. 

18. Martinenghi, S., Comi, G., Galardi, G., Di Carlo, V., Pozza, G., and Secchi, A. 

(1997) Amelioration of nerve conduction velocity following simultaneous kidney/pancreas 

transplantation is due to the glycaemic control provided by the pancreas. 

Diabetologia 40(9), 1110–1112. 

19. Jukema, J. W., Smets, Y. F., van der Pijl, J. W., et al. (2002) Impact of simultaneous 

pancreas and kidney transplantation on progression of coronary atherosclerosis 

in patients with end-stage renal failure due to type 1 diabetes. Diabetes Care 

25(5), 906–911. 

20. Kelly, W. D., Lillehi, R. C., Lerkel, F. K., Idezuki, Y., and Goetz, F. C. (1967) 

Allotransplantation of the pancreas and duodenum along with the kidney in diabetic 

nephropathy. Surgery 61(6), 827–837. 

21. Sutherland, D. E, Gruessner, R. W., and Gruessner, A. C. (2001) Pancreas transplantation 

for the treatment of diabetes mellitus. World J. Surg. 25, 487–496. 

22. Sutherland, D. E., Gruessner, R. W., Dunn, D. L., et al. (2001) Lessons learned 

from more than 1,000 pancreas transplants at a single institution. Ann. Surg. 233 

(4), 463–501. 

23. Odorico, J. S. and Sollinger H. W. (2002) Technical and immunosuppressive 

advances in transplantation for insulin-dependent diabetes mellitus. World J. 

Surg. 26(2), 94–211. 

24. von Mering, J. and Minkowski, O. (1889) Diabetes mellitus after pancreas extirpation. 

Archiv. Exp. Path ol. Pharmakol. 26, 111. 

25. Williams, P. (1894) Notes on diabetes treated with extract and by grafts of sheep’s 

pancreas. Br. Med. J. 2, 1303–1304. 

26. Barron, M. (1920) The relation of the islet of Langerhans to diabetes with a special 

reference to cases of pancreatic lithiasis. Surg. Gynecol. Obstet. 31, 437. 

27. Hellerstrôm, C. (1964) A method for the microdissection of intact pancreatic islets 

of mammals. Acta Endocrinol. 45, 122–132. 

28. Younoszai, R., Sorensen, R., and Lindall, A. (1970) Homotransplantation of isolated 

pancreatic islets. Diabetes 19(Suppl. 1), 406. 

29. Banting, F. G., Best, C. H., Collip, J. B., Campbell, W. R., and Fletcher, A. A. 

(1922) Pancreatic extracts in the treatment of diabetes mellitus: preliminary report. 

Can. Med. Assoc. J. 12, 141. 

30. Burrow, G. N., Hazlett, B. E., and Phillips, M. J. (1982) A case of diabetes mellitus. 

N. Engl. J. Med. 306, 340–343.


31. Nobel Lectures, Physiology or Medicine 1922–1941, (1965) Elsevier Publishing 

Company, Amsterdam. 

32. Marble, A. (1965) Relation of control of diabetes to vascular sequelae. Med. Clin. 

North Am. 49, 1137–1145. 

33. Starzl, T. E. (1990) The development of clinical renal transplantation. Am. J. Kidney 

Dis. 16(6), 548–556. 

34. Lacy, P. and Kostianovsky, M. (1967) Method for the isolation of intact islets of 

Langerhans from the rat pancreas. Diabetes 16, 35–39. 

35. Moskalewski, S. (1965) Isolation and culture of the islets of Langerhans of the 

guinea pig. Gen. Comp. Endocrinol. 5, 342–353. 

36. Kemp, C. B., Knight, M. J., Scharp, D. W., Ballinger, W. F., and Lacy, P. E. 

(1973) Effect of transplantation site on the results of pancreatic islet isografts in 

diabetic rats. Diabetologia 9(6), 486–491. 

37. White, S. A., James, R. F., Swift, S. M., Kimber, R. M., and Nicholson, M. L. 

(2001) Human islet cell transplantation—future prospects. Diabet. Med. 18(2), 

78–103. 

38. Najarian, J. S., Sutherland, D. E., Matas, A. J., Steffes, M. W., Simmons, R. L., 

and Goetz, F. C. (1977) Human islet transplantation: a preliminary report. Transplant. 

Proc. 9(1), 233–236. 

39. Largiader, F., Kolb, E., Binswanger, U., and Illig, R. (1979) Successful allotransplantation 

of an island of Langerhans. Schweiz. Med.Wochenschr. 109(45), 1733– 

1736. 

40. Langerhans, P. (1989) Beiträge zur mikroskopischen Anatomie der Bauchspeicheldruse. 

Inaur disert. Berlin Lange. 

41. Lacy, P. (1994) Pancreatic islet cell transplant. Mt. Sinai J. Med. 61(1), 23–31. 

42. Noel, J., Rabinovitch, A., Olson, L., Kyriakides, G., Miller, J., and Mintz, D. H. 

(1982) A method for large-scale, high-yield isolation of canine pancreatic islets 

of Langerhans. Metabolism 31(2), 184–187. 

43. Sutherland, D. E., Steffes, M. W., Bauer, G. E., McManus, D., Noe, B. D., and 

Najarian, J. S. (1974) Isolation of human and porcine islets of Langerhans and 

islet transplantation in pigs. J. Surg. Res. 16(2), 102–111. 

44. Tzakis, A. G., Ricordi, C., Alejandro R., Zeng, Y., Fung, J. J., Todo, S., Demetris, 

A. J., Mintz, D. H., and Starzl, T. E. (1990) Pancreatic islet transplantation after 

upper abdominal exenteration and liver replacement. Lancet 336, 402–405. 

45. Ricordi, C., Tzakis, A. G., Carroll, P. B., Zeng, Y. J., Rilo, H. L., Alejandro, R., 

Shapiro, A., Fung, J. J., Demetris, A. J., Mintz, D. H., et al. (1992) Human islet 

isolation and allotransplantation in 22 consecutive cases. Transplantation 53 

(2), 407–414. 

46. Oberholzer, J., Triponer, F., Mage, R., Andereggen, E., Buhler, L., Cretin, N., 

Fournier, B., Goumaz, C., Lou, J., Philippe, J., and Morel, P. (2000) Human islet 

transplantation: lessons from 13 autologous and 13 allogeneic transplantations. 

Transplantation 69(6), 1115–1123. 

47. Socci, C., Davalli, A. M., Vignali, A., Bertuzzi, F., Maffi, P., Zammarchi, O., 

Ci Carlo, V., and Pozza, G. (1992) Evidence of in vivo human islet graft func-


tion despite a weak response to in vitro perfusion. Transplant. Proc. 24, 3056– 

3057. 

48. Warnock, G. L., Kneteman, N. M., Ryan, E. A., Rabinovitch, A., and Rajotte, R. 

V. (1992) Long-term follow-up after transplantation of insulin-producing pancreatic 

islets ito patients with wild type I (insulin-dependent) diabetes mellitus. 

Diabetologia 35(1), 89–95. 

49. Pyzdrowski, K. L., Kendall, D. M., Halter, J. B., Nakhleh, R. E., Sutherland, D. 

E., and Robertson, R. P. (1992) Preserved insulin secretion and insulin independence 

in recipients of islet autografts. N. Engl. J. Med. 327(4), 220–226. 

50. Sutherland, D. E., Gruessner, R. W., Gores, P. F., Brayman, K., Wahoff, D., and 

Gruessner, A. (1995) Pancreas transplantation: an update. Diabetes Metab. Rev. 

11(4), 337–363. 

51. Farney, A. C., Hering, B. J., Nelson, L., Tanioka, Y., Gilmore, T., Leone, J., 

Wahoff, D., Najarian, J., Kendall, D., and Sutherland, D.E. (1998) No late failures 

of intraportal human islet autografts beyond 2 years. Transplant. Proc. 30(2), 

420. 

52. Brendel, M. (2001) International Islet Transplant Registry Newsletter No. 9. Volume 

8. Number 1. 

53. Oberholzer, J., Mathe, Z., Bucher, P., Triponez, F., Bosco, D., Fournier, B., 

Majno, P., Philippe, J., and Morel, P. (2003) Islet autotransplantation after left 

pancreatectomy for non-enucleable insulinoma. Am. J. Transplant. 3(10), 1302– 

1307. 

54. Robertson, R. P., Lanz, K. J., Sutherland, D. E., and Kendall, D. M. (2001) Prevention 

of diabetes for up to 13 years by autoislet transplantation after pancreatectomy 

for chronic pancreatitis. Diabetes 50(1), 47–50. 

55. Ricordi, C. and Rastellini, C. (1995) Automated method for pancreatic islet separation, 

in (Ricordi, C., ed.) Methods in Islet Implantation. RG Landes, Austin, 

TX, p. 433. 

56. Yasunami, Y., Ryu, S., and Kamei, T. (1990) FK506 as the sole immunosuppressive 

agent for prolongation of islet allograft survival in the rat. Transplantation 

49(4), 682–686. 

57. Reece-Smith, H., Muller, G., McShane, P., and Morris, P. J. (1983) Combined 

liver and pancreatic islet transplantation in the rat. Transplantation 36(2), 230– 

231. 

58. Fukushima, M., Nakai, Y., Taniguchi, A., Imura, H., Nagata, I., and Tokuyama, 

K. (1993) Insulin sensitivity, insulin secretion, and glucose effectiveness in anorexia 

nervosa: a minimal model analysis. Metabolism 42(9), 1164–1168. 

59. Warnock, G. L., Kneteman, N. M., Ryan, E. A., et al. (1989) Continued function 

of pancreatic islets after transplantation in type I diabetes. Lancet 2(8662), 570– 

572. 

60. Ricordi, C., Gray, D. W., Hering, B. J., et al. (1990) Islet isolation assessment in 

man and large animals. Acta Diabetol. Lat. 27, 185–195. 

61. Ricordi, C., Tzakis, A., Alejandro, R., et al. (1991) Detection of pancreatic islet 

tissue following islet allotransplantation in man. Transplantation 52, 1079–1080.


62. Scharp, D. W., Lacy, P. E., Santiago, J. V., McCullough, C. S., Weide, L. G., 

Boyle, P. J., et al. (1991) Results of our first nine intraportal islet allografts in type 

1, insulin-dependent diabetic patients. Transplantation 51, 76–85. 

63. Rosenberg, L., Wang, R., Paraskevas, S., and Maysinger, D. (1999) Structural 

and functional changes resulting from islet isolation lead to islet cell death. Surgery 

126(2), 393–398. 

64. Kenyon, N. S., Ranuncoli, A., Masetti, M., Chatzipetrou, M., and Ricordi, C. 

(1998) Islet transplantation: present and future perspectives. Diabetes Metab. Rev. 

14(4), 303–313. 

65. Shapiro, A. M., Hao, E., Lakey, J. R., Finegood, D., Rajotte, R V., and Kneteman, 

N.M. (1998) Diabetogenic synergism in canine islet autografts from cyclosporine 

and steroids in combination. Transplant. Proc. 30(2), 527. 

66. Hering, B. and Ricordi, C. (1999) Islet transplantation for patients with type 1 

diabetes mellitus: results, research priorities and reasons for optimism. Graft 2, 

12–27. 

67. Luzi, L., Secchi, A., Facchini, F., et al. (1990) Reduction of insulin resistance by 

combined kidney-pancreas transplantation in type 1 (insulin-dependent) diabetic 

patients. Diabetologia 33(9), 549–556. 

68. Drachenberg, C. B., Klassen, D. K., Weir, M. R., et al. (1999) Islet cell damage 

associated with tacrolimus and cyclosporine: morphological features in pancreas 

allograft biopsies and clinical correlation. Transplantation 68(3), 396–402. 

69. Patane, G., Piro, S., Rabuazzo, A. M., Anello, M., Vigneri, R., and Purrello, F. 

(2000) Metformin restores insulin secretion altered by chronic exposure to free 

fatty acids or high glucose: a direct metformin effect on pancreatic beta-cells. 

Diabetes 49(5), 735–740. 

70. Ricordi, C., Scharp, D. W., and Lacy, P. E. (1988) Reversal of diabetes in nude 

mice after transplantation of fresh and 7-day-cultured (24 degrees C) human pancreatic 

islets. Transplantation 45(5), 994–996. 

71. Lake, S. P., Bassett, P. D., Larkins, A., et al. (1989) Large-scale purification of 

human islets utilizing discontinuous albumin gradient on IBM 2991 cell separator. 

Diabetes 38, 143–145. 

72. Carlsson, P. O., Palm, F., Andersson, A., and Liss, P. (2001) Markedly decreased 

oxygen tension in transplanted rat pancreatic islets irrespective of the implanted 

site. Diabetes 50(3), 489–495. 

73. Ricordi, C., Lacy, P. E., and Scharp, D. W. (1989) Automated islet isolation from 

human pancreas. Diabetes 38, 140–142. 

74. Lakey, J. R., Warnock, G. L., Shapiro, A. M., et al. (1999) Intraductal collagenase 

delivery into the human pancreas using syringe loading or controlled perfusion. 

Cell Transplant. 8 (3), 285–292. 

75. Hering, B. J., Bretzel, R. G., Hopt, U. T., et al. (1994) New protocol toward prevention 

of early human islet allograft failure. Transplant. Proc. 26(2), 570–571. 

76. Bretzel, R. G., Brandhorst, D, Brandhorst, H., et al. (1999) Improved survival of 

intraportal pancreatic islet cell allografts in patients with type-1 diabetes mellitus 

by refined peritransplant management. J. Mol. Med. 77(1), 140–143.


77. Maffi, P., Bertuzzi, F., Guiducci, D., et al. (2001) Pre- and perioperative management 

influences the clinical outcome of islet transplantation. Am. J. Transplant. 

1(Suppl. 1), 10. 

78. Benhamou, P. Y., Oberholzer, J., Toso, C., et al.; GRAGIL Consortium. (2001) 

Human islet transplantation network for the treatment of Type I diabetes: first 

data from the Swiss-French GRAGIL consortium (1999–2000). Diabetologia 

44(7), 859–864. 

79. Sutherland, D. E., Sibley, R., Xu, X. Z., et al. (1984) Twin-to-twin pancreas transplantation: 

reversal and reenactment of the pathogenesis of type I diabetes. Trans. 

Assoc. Am. Physicians 97, 80–87. 

80. Feutren, G. and Mihatch, M. J. (1992) Risk factors for cyclosporine-induced nephropathy 

in patients with autoimmune diseases. International Kidney Biopsy Registry 

of Cyclosporine in Autoimmune Diseases. N. Engl. J. Med. 326(25), 

1654–1660. 

81. Yakimets, W. J., Lakey, J. R., Yatscoff, R. W., et al. (1993) Prolongation of canine 

pancreatic islet allograft survival with combined rapamycin and cyclosporine 

therapy at low doses. Rapamycin efficacy is blood level related. Transplantation 

56(6), 1293–1298. 

82. Allison, A. C. (2002) Mechanisms of action of mycophenolate mofetil in preventing 

chronic rejection. Transplant. Proc. 34(7), 2863–2866. 

83. Trofe, J., Buell, J. F., First, M. R., Hanaway, M. J., Beebe, T. M., and Woodle, E. 

S. (2002) The role of immunosuppression in lymphoma. Recent Results Cancer 

Res. 159, 55–66. 

84. Fishman, J. A. and Rubin, R. H. (1998) Infection in organ-transplant recipients. 

N. Engl. J. Med. 338(24), 1741–1751. 

85. Gaber, A. O., First, M. R., Tesi, R. J., et al. (1998) Results of the double-blind, 

randomized, multicenter, phase III clinical trial of thymoglobulin versus Atgam 

in the treatment of acute graft rejection episodes after renal transplantation. Transplantation 

66(1), 29–37. 

86. Sehgal, S. N., Baker, H., and Vezina, C. (1975) Rapamycin (AY-22,989), a new 

antifungal antibiotic. II. Fermentation, isolation and characterization. J. Antibiot. 

28(10), 727–732. 

87. Shapiro, A. M., Gallant, H., Hao, E., et al. (1998) Portal vein immunosuppressant 

levels and islet graft toxicity. Transplant. Proc. 30(2), 641. 

88. Yakimets, W. J., Lakey, J. R., Yatscoff, R. W., Ket al. (1993) Prolongation of 

canine pancreatic islet allograft survival with combined rapamycin and 

cyclosporine therapy at low doses. Rapamycin efficacy is blood level related. 


89. Chen, H., Qi, S., Xu, D., et al. (1998) Combined effect of rapamycin and FK 506 

in prolongation of small bowel graft survival in the mouse. Transplant. Proc. 

30(6), 2579–2581. 

90. McAlister, V. C., Gao, Z., Peltekian, K., Domingues, J., Mahalati, K., and 

MacDonald, A. S. (2000) Sirolimus-tacrolimus combination immunosuppression. 

Lancet 355(9201), 376–377.



with daclizumab to prevent acute rejection in renal transplantation. Daclizumab 

Triple Therapy Study Group. N. Engl. J. Med. 338(3), 161–165. 

92. Kahan, B. D., Rajagopalan, P. R., and Hall, M. (1999) Reduction of the occurrence 

of acute cellular rejection among renal allograft recipients treated with basiliximab, 

a chimeric anti-interleukin-2-receptor monoclonal antibody. United States Simulect 

Renal Study Group. Transplantation 67(2), 276–284. 

93. Halloran, P. F. (1999) T-cell activation pathways: a transplantation perspective. 

Transplant. Proc. 31(1–2), 769–771. 

94. Shapiro, A. M., Lakey, J. R., Ryan, E. A., et al. (2000) Islet transplantation in seven 

patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive 

regimen. N. Engl. J. Med. 343(4), 230–238. 

95. Ryan, E. A., Lakey, J. R., Rajotte, R. V., et al. (2001) Clinical outcomes and insulin 

secretion after islet transplantation with the Edmonton protocol. Diabetes 50(4), 

710–719. 

96. Ryan, E. A., Lakey, J. R., Paty, B. W., et al. (2002) Successful islet transplantation: 

continued insulin reserve provides long-term glycemic control. Diabetes 51(7), 

2148–2157. 

97. Shapiro, A., et al. (2003) Three-year follow-up in clinical islet-alone transplant with 

the Edmonton protocol, and preliminary impact of infliximab and Campath-1H. 

Am. J. Transplant. 3(Suppl. 5), 296. 

98. Luzi, L. (1999) Metabolic strategies to predict and improve intrahepatic islet graft 

function. J. Mol. Med. 77(1), 49–56. 

99. de Mattos, A. M., Olyaei, A. J., and Bennett, W. M. (2000) Nephrotoxicity of 

immunosuppressive drugs: long-term consequences and challenges for the future. 

Am. J. Kidney Dis. 35(2), 333–346. 

100. Cryer, P. E., Fisher, J. N., and Shamoon, H. (1994) Hypoglycemia. Diabetes Care 

17(7), 734–755. 

101. Dahlquist, G. (1999) Primary and secondary prevention strategies of pre-type 1 

diabetes. Potentials and pitfalls. Diabetes Care 22 (Suppl. 2), B4–B6. 

102. http//:www.organandtissue.ca 

103. D’Alessndro, M. D., James, H., Southard, J. H., Love, R. B., and Belzer, F. O. 

(1994) Organ preservation. Surg. Clin. North Am. 74(5), 1083–1095. 

104. Lakey, J. R., Warnock, G. L., Rajotte, R. V., et al. (1996) Variables in organ donors 

that affect the recovery of human islets of Langerhans. Transplantation 61(7), 047– 

1053. 

105. Kalayoglu, M., D’Alessandro, A. M., Knechtle, S.J, et al. (1996) Preliminary experience 

with split liver transplantation. J. Am. Coll. Surg. 182(5), 381–387. 

106. Kneteman, N. M., Lakey, J. R., Kizilisik, T. A., Ao, Z., Warnock, G. L., and Rajotte, 

R. V. (1994) Cadaver pancreas recovery technique. Impact on islet recovery and in 

vitro function. Transplantation 58(10), 1114–1119. 

107. Lakey, J. R., Kneteman, N. M., Rajotte, R. V., Wu, D. C., Bigam, D., and Shapiro, 

A. M. (2002) Effect of core pancreas temperature during cadaveric procurement on 

human islet isolation and functional viability. Transplantation 73(7), 1106–1110.


108. Idezuki, Y., Goetz, F. C., and Lillehei, R.C. (1969) Experimental allotransplantation 

of the preserved pancreas and duodenum. Surgery 485–493. 

109. Fraga, D. W., Sabek, O., Hathaway, D. K., and Gaber, A. O. (1998) A comparison 

of media supplement methods for the extended culture of human islet tissue. 


110. Korbutt, G. S., Elliot, J. F., Ao, Z., Smith, D. K., Warnock, G. L., and Rajotte, R. 

V. (1996) Large scale isolation, growth and function of porcine neonatal islet 

cells. J. Clin. Invest. 97, 2119–2129. 

111. Weimar, B., Rauber, K., Brendel, M. D., Bretzel, R. G., and Rau, W. S. (1999) 

Percutaneous transhepatic catheterization of the portal vein: a combined CTand 

fluoroscopy-guided technique. Cardiovasc. Intervent. Radiol. 22(4), 342– 

344. 

112. Luca, A., D’Amico, G., La Galla, R., Midiri, M., Morabito, A., and Pagliaro, L. 

(1999) TIPS for prevention of recurrent bleeding in patients with cirrhosis: metaanalysis 

of randomized clinical trials. Radiology 212(2), 411–421. 

113. Vincenti, F. (2001) Interleukin-2 receptor monoclonal antibodies in renal transplantation: 

current use and emerging regimens. Transplant. Proc. 33(7–8), 3169– 

3171. 

114. Halloran, P. F. (2000) Sirolimus and cyclosporin for renal transplantation. Lancet 

356(9225), 179–180. 

115. Shapiro, A. M., Geng Hao, E., Lakey, J. R., Finegood, D. T., Rajotte, R. V., and 

Kneteman, N. M. (2002) Defining optimal immunosuppression for islet transplantation 

based on reduced diabetogenicity in canine islet autografts. Transplantation 

74(11), 1522–1528. 

116. Darenkov, I. A., Marcarelli, M. A., Basadonna, G. P., et al. (1997) Reduced incidence 

of Epstein-Barr virus-associated posttransplant lymphoproliferative disorder 

using preemptive antiviral therapy. Transplantation 64(6), 848–852. 

117. Flynn, J. M. and Byrd, J. C. (2000) Campath-1H monoclonal antibody therapy. 

Curr. Opin. Oncol. 12(6), 574–581. 

118. Kirk, A. D., Hale, D. A., Mannon, R. B., et al. (2003) Results from a human renal 

allograft tolerance trial evaluating the humanized CD52-specific monoclonal 

antibody alemtuzumab (CAMPATH-1H).Transplantation 76(1), 120–129. 

119. Tzakis, A. G., Kato, T., Nishida, S., et al. (2002) Campath-1H in intestinal and 

multivisceral transplantation: preliminary data. Transplant. Proc. 34(3), 937. 

120. Farney, A. C., Xenos, E., Sutherland, D. E., et al. (1993) Inhibition of pancreatic 

islet beta cell function by tumor necrosis factor is blocked by a soluble tumor 

necrosis factor receptor. Transplant. Proc. 25, 865–866. 

121. Rafael, E., Ryan, E. A., Paty, B. W., et al. (2003) Changes in liver enzymes after 

clinical islet transplantation. Transplantation 76(9), 1280–1284. 

122. Casey, J. J., Lakey, J. R., Ryan, E. A., et al. (2002) Portal venous pressure changes 

after sequential clinical islet transplantation. Transplantation 74(7), 913–915. 

123. Shapiro, A. M., Lakey, J. R., Rajotte, R. V., et al. (1995) Portal vein thrombosis 

after transplantation of partially purified pancreatic islets in a combined human 

liver/islet allograft. Transplantation 59(7), 1060–1063.


124. Sacks, D. B., Bruns, D. E., Goldstein, D. E., Maclaren, N. K., McDonald, J. M., 

and Parrott, M. (2002) Guidelines and recommendations for laboratory analysis in 

the diagnosis and management of diabetes mellitus. Clin. Chem. 48(3), 436–472. 

125. Braghi, S., Bonifacio, E., Secchi, A., Di Carlo, V., Pozza, G., and Bosi, E. (2000) 

Modulation of humoral islet autoimmunity by pancreas allotransplantation influences 

allograft outcome in patients with type 1 diabetes. Diabetes 49(2), 218– 

224. 

126. Jaeger, C., Allendorfer, J., Hatziagelaki, E., et al. (1997 Persistent GAD 65 antibodies 

in longstanding IDDM are not associated with residual beta-cell function, 

neuropathy or HLA-DR status. Horm. Metab. Res. 29(10), 510–515. 

127. Xavier, L., Cunha, M., Goncalves, C., et al. (2003) Hematological remission and 

long term hematological control of acute myeloblastic leukemia induced and 

maintained by granulocyte-colony stimulating factor (G-CSF) therapy. Leuk. 

Lymphoma 44(12), 2137–2142. 

128. Vasquez, E. M. (2000) Sirolimus: a new agent for prevention of renal allograft 

rejection. Am. J. Health Syst. Pharm. 57(5), 437–448. 

129. Hirshberg, B., Mog, S., Patterson, N., Leconte, J., and Harlan, D. M. (2002) 

Histopathological study of intrahepatic islets transplanted in the nonhuman primate 

model using Edmonton protocol immunosuppression. J. Clin. Endocrinol. 

Metab. 87(12),5424–5429. 

130. Johnson, J. A., Kotovych, M., Ryan, E. A., and Shapiro, A. M. (2004) Reduced 

fear of hypoglycemia in successful islet transplantation. Diabetes Care 27(2), 

624–625. 

131. Paty, B. W., Ryan, E. A., Shapiro, A. M., Lakey, J. R., and Robertson, R. P. 

(2002) Intrahepatic islet transplantation in type 1 diabetic patients does not 

restore hypoglycemic hormonal counterregulation or symptom recognition after 

insulin independence. Diabetes 51(12), 3428–3434. 

132. Hevener, A. L., Bergman, R. N., and Donovan, C. M. (1997) Novel glucosensor 

for hypoglycemic detection localized to the portal vein. Diabetes 46, 1521–1525. 

133. Gupta, V., Wahoff, D. C., Rooney, D. P., et al. (1997) The defective glucagon 

response from transplanted intrahepatic pancreatic islets during hypoglycemia is 

transplantation site-determined. Diabetes 46, 28–33. 

134. Hevener, A. L., Bergman, R. N., and Donovan, C. M. (2001) Hypoglycemic detection 

does not occur in the hepatic artery or liver: findings consistent with a portal 

vein glucosensor locus. Diabetes 50, 399–403. 

135. Kneteman, N. M., Lakey, J. R., Wagner, T., and Finegood, D. (1996) The metabolic 

impact of rapamycin (sirolimus) in chronic canine islet graft recipients. 


136. Davalli, A. M., Maffi, P., Socci, C., et al. (2000) Insights from a successful case 

of intrahepatic islet transplantation into a type 1 diabetic patient. J. Clin. 

Endocrinol. Metab. 85(10), 3847–3852. 

137. White, S. A., Koppiker, N. P., Burden, A. C., et al. (1998) Insulin deficiency 

and increased intact and 32/33 split proinsulin secretion following human islet 

autotransplantation. Transplant. Proc. 30(2), 627–628.


138. http://www.immunetolerance.org 

139. Hering, B. J., Matsumoto, I., Sawada, T., et al. (2002) Impact of two-layer pancreas 

preservation on islet isolation and transplantation. Transplantation 74(12), 

1813–1816. 

140. Herold, K. C., Burton, J. B., Francois, F., Poumian-Ruiz, E., Glandt, M., and 

Bluestone, J. A. (2003) Activation of human T cells by FcR nonbinding anti- 

CD3 mAb, hOKT3gamma1(Ala-Ala). J. Clin. Invest. 111(3), 409–418. 

141. Gaber, A. O., Fraga, D. W., Callicutt, C. S., Gerling, I. C., Sabek, O. M., and 

Kotb, M. Y. (2001) Improved in vivo pancreatic islet function after prolonged in 

vitro islet culture. Transplantation 72(11), 1730–1736. 

142. Tsujimura, T., Kuroda, Y., Kin, T., et al. (2002) Human islet transplantation 

from pancreases with prolonged col ischemia using additional preservation by 

the two-layer (UW solution/perfluorochemical) sold-storage method. Transplantation 

74(12), 1687–1691. 

143. Lakey, J. R., Tsujimura, T., Shapiro, A. M., and Kuroda, Y. (2002) Preservation 

of the human pancreas before islet isolation using a two-layer (UW solution/ 

perfluorochemical) cold storage method. Transplantation 74(12), 1809– 

1811. 

144. Ricordi, C., Fraker, C., Szust, J., et al. (2003) Improved human islet isolation 

outcome from marginal donors following addition of oxygenated perfluorocarbon 

to the cold-storage solution. Transplantation 75, 1524–1527. 

145. Fraker, C. A., Alejandro, R., and Ricordi, C. (2002) Use of oxygenated perfluorocarbon 

toward making every pancreas count. Transplantation 74, 1811– 

1813. 

146. Matsumoto, S., Rigley, T. H., Qualley, S. A., Kuroda, Y., Reems, J. A., and 

Stevens, R. B. (2002) Efficacy of the oxygen-charged static two-layer method 

for short-term pancreaspreservation and islet isolation from nonhuman primate 

and human pancreata. Cell Transplant. 11, 769–777. 

147. Matsumoto, S. and Kuroda, Y. (2002) Perfluorocarbon for organ preservation 

before transplantation. Transplantation 74, 1804–1809. 

148. Markmann, J. F., Deng, S., Desai, N. M., et al. (2003) The use of non-heartbeating 

donors for isolated pancreatic islet transplantation. Transplantation 

75(9), 1423–1429. 

149. Kaufman, D. B., Baker, M. S., Chen, X., Leventhal, J. R., and Stuart, F. P. (2002) 

Sequential kidney/islet transplantation using prednisone-free immunosuppression. 


150. Hering, B., et al. (2003) Successful single donor islet transplantation in type 1 

diabetes. Am. J. Transplant. 3, 296. 

151. http://spitfire.emmes.com/study/isl/index.html 

152. Ricordi, C., Lakey, J. R., and Hering, B. J. (2001) Challenges toward standardization 

of islet isolation technology. Transplant. Proc. 33(1–2), 1709. 

153. Lakey, J. R. T, Ricordi, D., Hering, B., et al. (2003) Standardization of human 

islet isolation for a international multicenter transplant trial. Am. Transplant. 

Congress 3(Suppl. 5), 297.


154. Salvalaggio, P. R., Deng, S., Ariyan, C. E., et al. (2002) Islet filtration: a simple 

and rapid new purification procedure that avoids ficoll and improves islet mass 

and function. Transplantation 74(6), 877. 

155. Kirlew, T. (1999) Viability estimation of islets using fluorescent stains. Cell 

Transplant Center, Diabetes Research Institute, University of Miami School of 

Medicine, Miami, FL, pp. 1–6. 

156. Bennett, M. J., McGhee-Wilson, D., Shapiro, A. M. J., and Lakey, R. J. T. Variation 

in human islet viability based on different membrane integrity stains. Cell 

Transplant., in press. 

157. Wolters, G. H., Vos-Scheperkeuter, G. H., Lin, H. C., and van Schilfgaarde, R. 

(1995) Different roles of class I and class II Clostridium histolyticum collagenase 

in rat pancreatic islet isolation. Diabetes 44(2), 227–233. 

158. Brandhorst, H., Brandhorst, D., Hesse, F., et al. (2003) Successful human islet 

isolation utilizing recombinant collagenase. Diabetes 52(5), 1143–1146. 

159. Rose, N. L., Palcic, M. M., Helms, L. M., and Lakey, J. R. (2003) Evaluation of 

Pefabloc as a serine protease inhibitor during human-islet isolation. Transplantation 

75(4), 462–466. 

160. Ryan, E. A., Shandro, T., Green, K., et al. (2004) Assessment of the severity of 

hypoglycemia and glycemic lability in type 1 diabetic subjects undergoing islet 

transplantation. Diabetes 53(4), 955–962. 

161. Service, F. J., Molnar, G. D., Rosevear, J. W., Ackerman, E., Gatewood, L. C., 

and Taylor, W. F. (1970) Mean amplitude of glycemic excursions, a measure of 

diabetic instability. Diabetes 19(9), 644–655. 

162. Bode, B. W., Sabbah, H., and Davidson, P. C. (2001) What’s ahead in glucose 

monitoring? New techniques hold promise for improved ease and accuracy. 

Postgrad. Med. 109(4), 41–44, 47–49. 

163. Rabkin, J. M., Olyaei, A. J., Orloff, S. L., et al. (1999) Distant processing of 

pancreas islets for autotransplantation following total pancreatectomy. Am. J. 

Surg. 177(5), 423–427. 

164. D’Alessandro, A. M., Southard, J. H., Love, R. B., and Belzer, F. O. (1994) 

Organ preservation. Surg. Clin. North. Am. 74(5), 1083–1095. 

165. Matsumoto, S., Kuroda, Y., Fujita, H., et al. (1996) Extending the margin of 

safety of preservation period for resuscitation of ischemically damaged pancreas 

during preservation using the two-layer (University of Wisconsin solution/ 

perfluorochemical) method at 20 degrees C with thromboxane A2 synthesis 

inhibitor OKY046. Transplantation 62(7), 879–883. 

166. Kuroda, Y., Morita, A., Fujino, Y., Tanioka, Y., Ku, Y., and Saitoh, Y. (1993) 

Successful extended preservation of ischemically damaged pancreas by the twolayer 

(University of Wisconsin solution/perfluorochemical) cold storage method. 


167. Stadlbauer, V., Schaffellner, S., Iberer, F., et al. (2003) Occurrence of apoptosis 

during ischemia in porcine pancreas islet cells. Int. J. Artif. Organs 26, 205–210. 

168. Ozmen, L., Ekdahl, K. N., Elgue, G., Larsson, R., Korsgren, O., and Nilsson, B. 

(2002) Inhibition of thrombin abrogates the instant blood-mediated inflamma-


tory reaction triggered by isolated human islets: possible application of the 

thrombin inhibitor melagatran in clinical islet transplantation. Diabetes 51, 

1779–1784. 

169. Gustafsson, D., Nystrom, J., Carlsson, S., et al. (2001) The direct thrombin inhibitor 

Melagatran and its oral prodrug H 376/95: intestinal absorption properties, biochemical 

and pharmacodynamic effects. Thromb. Res. 101, 171–181. 

170. Warnock, G. L., Dabbs, K. D., Cattral, M. S., and Rajotte, R. V. (1994) Improved 

survival of in vitro cultured canine islet allografts. Transplantation 57, 17–22. 

171. Gysemans, C., Van Etten, E., Overbergh, L., et al. (2002) Treatment of autoimmune 

diabetes recurrence in non-obese diabetic mice by mouse interferon-beta 

in combination with an analogue of 1alpha,25-dihydroxyvitamin-D3. Clin. Exp. 

Immunol. 128, 213–220. 

172. Jahr, H., Hussmann, B., Eckhardt, T., and Bretzel, R. G. (2002) Successful single 

donor islet allotransplantation in the streptozotocin diabetes rat model. Cell 


173. Beattie, G. M., Montgomery, A. M., Lopez, A. D., et al. (2002) A novel approach 

to increase human islet cell mass while preserving beta-cell function. Diabetes 

51, 3435–3439. 

174. Brand, S. J., Tagerud, S., Lambert, P., et al. (2002) Pharmacological treatment of 

chronic diabetes by stimulating pancreatic beta-cell regeneration with systemic 

co-administration of EGF and gastrin. Pharmacol. Toxicol. 91, 414–420. 

175. Gores, P. F., Najarian, J. S., Stephanian, E., Lloveras, J. J., Kelley, S. L., and 

Sutherland, D. E. (1993) Insulin independence in type I diabetes after transplantation 

of unpurified islets from single donor with 15-deoxyspergualin. Lancet 341, 

19–21. 

176. Kaufman, D. B., Gores, P. F., Field, M. J., et al. (1994) Effect of 15deoxyspergualin 

on immediate function and long-term survival of transplanted 

islets in murine recipients of a marginal islet mass. Diabetes 43, 778–783. 

177. Brandhorst, D., Brandhorst, H., Zwolinski, A., Nahidi, F., and Bretzel, R. G. 

(2002) High-dosed nicotinamide decreases early graft failure after pig to nude 

rat intraportal islet transplantation. Transplantation 73, 74–79. 

178. Shapiro, A. M., Hao, E., Rajotte, R. V., and Kneteman, N. M. (1996) Impact of 

Lazaroid U74006F on ischemia and reperfusion injury of islets after transplantation 

in the rat. Transplant. Proc. 28, 85–86. 

179. Papas, K. K., Colton, C. K., Gounarides, J. S., et al. (2001) NMR spectroscopy 

in beta cell engineering and islet transplantation. Ann. NY Acad. Sci. 944, 96– 

119. 

180. Burridge, P., Lakey, J., and Rajotte, R. (2002) Cryopreservation of human pancreatic 

islets. Graft 5(5), 266–273. 

181. Waugh, N. (2000) Could fewer islet cells be transplanted in type 1 diabetes? Br. 

Med. J. 321(7275), 1534. 

182. Shapiro, J., Ryan, E., Warnock, G. L., et al. (2001) Could fewer islet cells be 

transplanted in type 1 diabetes? Insulin independence should be dominant force 

in islet transplantation. Br. Med. J. 322(7290), 861.


183. Lakey, J. R., Helms, L. M., Kin, T., et al. (2001) Serine-protease inhibition during 

islet isolation increases islet yield from human pancreases with prolonged 

ischemia. Transplantation 72(4), 565–570. 

184. Huang, G. C., Zhao, M., Jones, P., et al. (2004) The development of new density 

gradient media for purifying human islets and islet-quality assessments. Transplantation 

77(1), 143–145. 

185. Payne, W. D., Sutherland, D.E, Matas, A. J., Gorecki, P., and Najarian, J. S. 

(1979) DL-Ethionine treatment of adult pancreatic donors. Amelioration of diabetes 

in multiple recipients with tissue from a single donor. Ann. Surg. 189 (2), 

248–256. 

186. Gruessner, R. W., Kendall, D. M., Drangstveit, M. B., Gruessner, A. C., and 

Sutherland, D. E. (1997) Simultaneous pancreas-kidney transplantation from live 

donors. Ann. Surg. 226(4), 471–480. 

187. http://www.who.int/hpr/gs.fs.diabetes.shtml 

188. Soria, B., Roche, E., Berna, G., et al. (2000) Insulin-secreting cells derived from 

embryonic stem cells normalize glycemia in streptozotocin-induced diabetic 

mice. Diabetes 49, 157–162. 

189. Lumelsky, N., Blondel, O., Laeng, P., Velasco, I., Ravin, R., and McKay, R. 

(2001) Differentiation of embryonic stem cells to insulin-secreting structures 

similar to pancreatic islets. Science 292(5520), 1389–1394. Erratum in Science 

293(5529), 428. 

190. Ulrich, A. B., Schmied, B. M., Standop, J., Schneider, M. B., and Pour, P. M. 

(2002) Pancreatic cell lines: a review. Pancreas 24(2), 111–120. 

191. Hess, D., Li, L., Martin, M., et al. (2003) Bone marrow-derived stem cells initiate 

pancreatic regeneration. Nat. Biotechnol. 21, 763–770. 

192. Macfarlane, W. M., O’Brien, R. E., Barnes, P. D., et al. (2000) Sulfonylurea 

receptor 1 and Kir6.2 expression in the novel human insulin-secreting cell line 

NES2Y. Diabetes 49(6), 953–960. 

193. Hannon, J. P., Bossone, C. A., and Wade, C. E. (1990) Normal physiological 

values for conscious pigs used in biomedical research. Lab. Anim. Sci. 40(3), 

293–298. 

194. van der Laan, L. J., Lockey, C., Griffeth, B. C., et al. (2000) Infection by porcine 

endogenous retrovirus after islet xenotransplantation in SCID mice. Nature 407 

(6800), 90–94. 

195. Cowan, P. J., Shinkel, T. A., Aminian, A., et al. (1998) High-level co-expression 

of complement regulators on vascular endothelium in transgenic mice: CD55 

and CD59 provide greater protection from human complement-mediated injury 

than CD59 alone. Xenotransplantation 5, 184–190. 

196. Karlsson-Parra, A., Ridderstad A., Wallgren, A. C., Moller E., Ljunggren, H. 

G., and Korsgren, O. (1996) Xenograft rejection of porcine islet-like cell clusters 

in normal and natural killer cell-depleted mice. Transplantation 61(9), 

1313–1320. 

197. Groth, C. G., Korsgren, O., Tibell, A., et al. (1994) Transplantation of porcine 

fetal pancreas to diabetic patients. Lancet 344, 1402–1404.


198. O’Neil, J. J., Stegemann, J. P., Nicholson, D. T., Gagnon, K. A., Solomon, B. A., 

and Mullon, C. J. (2001) The isolation and function of porcine islets from market 

weight pigs. Cell Transplant. 10(3), 235–246. 

199. Rayat, G. R., Rajotte, R. V., Elliott, J. F., and Korbutt, G. S. (1998) Expression 

of Gal alpha(1,3)gal on neonatal porcine islet beta-cells and susceptibility to 

human antibody/complement lysis. Diabetes 47(9), 1406–1411. 

200. Birmingham, K. (2002) Skepticism surrounds diabetes xenograft experiment. 

Nat. Med. 8(10), 1047. 

201. Valdes, R. (2002) Xenotransplantation trials. Lancet 359(9325), 2281. 

202. Lee, H. C., Kim, S. J., Kim, K. S., Shin, H. C., and Yoon, J. W. (2000) Remission 

in models of type 1 diabetes by gene therapy using a single-chain insulin analogue. 

Nature 408(6811), 483–488. 

203. Cheung, A. T., Dayanandan, B., Lewis, J. T., et al. (2000) Glucose-dependent insulin 

release from genetically engineered K cells. Science 290(5498), 1959–1962. 

204. Orive, G., Hernandez, R. M., Gascon, A. R., Igartua, M., and Pedraz, J. L. (2003) 

Controversies over stem cell research. Trends Biotechnol. 21(3), 109–112. 

205. Chapman, L. E. (2003) Xenotransplantation: public health risks — patient vs. 

society in an emerging field. Curr. Top. Microbiol. Immunol. 278, 23–45. 

206. Boitard, C., Timsit, J., Larger, E., Sempe, P., and Bach, J. F. (1993) Pathogenesis 

of IDDM: immune regulation and induction of immune tolerance in the NOD 

mouse. Autoimmunity 15 (Suppl.), 12–13. 

207. Mazariegos, G. V., Reyes, J., Marino, I., Flynn, B., Fung, J. J., and Starzl, T. E. 

(1997) Risks and benefits of weaning immunosuppression in liver transplant 

recipients: long-term follow-up. Transplant. Proc. 29, 1174–1177. 

208. Starzl, T. E., Murase, N., Abu-Elmagd, K., et al. (2003) Tolerogenic immunosuppression 

for organ transplantation. Lancet 361, 1502–1510. 

209. Wood, K. J. and Sakaguchi, S. (2003) Regulatory T cells in transplantation tolerance. 

Nat. Rev. Immunol. 3, 199–210. 

210. Sakaguchi, S. (2003) Control of immune responses by naturally arising CD4+ 

regulatory T cells that express toll-like receptors. J. Exp. Med. 197, 397–401. 

211. Buhler, L. H., Spitzer, T. R., Sykes, M., et al. (2002) Induction of kidney 

allograft tolerance after transient lymphohematopoietic chimerism in patients with 

multiple myeloma and end-stage renal disease. Transplantation 74, 1405–1409. 

212. Buhler, L. H., Spitzer, T. R., Sykes, M., et al. (2002) Induction of kidney 

allograft tolerance after transient lymphohematopoietic chimerism in patients with 

multiple myeloma and end-stage renal disease. Transplantation 74, 1405–1409. 

213. Shapiro, A. M., Nanji, S. A., and Lakey, J. R. (2003) Clinical islet transplant: 

current and future directions towards tolerance. Immunol. Rev. 196, 219–236. 

214. Tanaka, K. and Kiuchi, T. (2002) Living-donor liver transplantation in the new 

decade: perspective from the twentieth to the twenty-first century. J. Hepatobiliary 

Pancreat. Surg. 9(2), 218–222. 

215. Madrazo, I., Leon, V., Torres, C., et al. (1988) Transplantation of fetal substantia 

nigra and adrenal medulla to the caudate nucleus in two patients with Parkinson’s 

disease. N. Engl. J. Med. 318(1), 51.


216. Takeda, Y., Gotoh, M., Dono, K., et al. Protection of islet allografts transplanted 

together with Fas ligand expressing testicular allografts. Diabetologia 1998 41, 

315–321. 

217. Levy, M. M., Ketchum, R. J., Tomaszewski, J. E., Naji, A., Barker, C. F., and 

Brayman, K. L. (2002) Intrathymic islet transplantation in the canine: I. Histological 

and functional evidence of autologous intrathymic islet engraftment 

and survival in pancreatectomized recipients. Transplantation 73(6), 842–852. 

218. Korbutt, G. S., Elliott, J. F., and Rajotte, R. V. (1997) Cotransplantation of allogeneic 

islets with allogeneic testicular cell aggregates allows long-term graft 

survival without systemic immunosuppression. Diabetes 46, 317–322. 

219. Yang, H. and Wright, J. R., Jr. (1999) Co-encapsulation of Sertoli enriched testicular 

cell fractions further prolongs fish-to-mouse islet xenograft survival. 


220. Xu, W., Liu, L., and Charles, I. G. (2002) Microencapsulated iNOS-expressing 

cells cause tumor suppression in mice. FASEB J. 16, 213–215. 

221. Prakash, S. and Chang, T. M. S. (1996) Microencapsulated genetically engineered 

live E. coli DH5 cells administered orally to maintain normal plasma urea 

level in uremic rats. Nat. Med. 2, 883–887. 

222. Algre, G. H., Weaver, J. M., and Prehn, R. T. (1954) Growth of cells in vivo in 

diffusion chambers. I Survival of homografts in immunized mice. J. Natl. Cancer 

Inst. 15, 493–507. 

223. Chang, T. M. S. (1964) Semipermeable microcapsules. Science 146, 524–525. 

224. Orive, G., Hernandez, R. M., Gascon, A. R., et al. (2003) Cell encapsulation: 

promise and progress. Nat. Med. 9, 104–107. 

225. Lanza, R. P. and Chick W. L. (1997) Transplantation of pancreatic islets. Ann. 

NY Acad. Sci. 831, 323–331. 

226. Calafiore, R., Basta, G., Luca, G., et al. (2003) Grafts of microencapsulated pancreatic 

islet cells for the therapy of diabetes mellitus in nonimmunosuppressed 

animals. Biotechnol. Appl. Biochem. [Epub ahead of print.] 

227. Soon-Shiong, P., Feldman, E., Nelson, R., et al. (1992) Successful reversal of 

spontaneous diabetes in dogs by intraperitoneal microencapsulated islets. Transplantation 

54, 769–774. 

228. Soon-Shiong, P., Heintz, R. E., Merideth, N., et al. (1994) Insulin independence 

in a type 1 diabetic patient after encapsulated islet transplantation. Lancet 343, 

950–951. 

229. Sun, W., Wang, Q., Zhang, L., et al. (2003) Blockade of CD40 pathway enhances 

the induction of immune tolerance by immature dendritic cells genetically modified 

to express cytotoxic T lymphocyte antigen 4 immunoglobulin. Transplantation 

76(9), 1351–1359. 

230. Duvivier-Kali, V. F., Omer, A., Parent, R. J., O’Neil, J. J., and Weir, G. C. (2001) 

Complete protection of islets against allorejection and autoimmunity by a simple 

barium-alginate membrane. Diabetes 50(8), 1698–1705. 

231. Delves, P. J. and Roitt I. M. (2000) The immune system. First of two parts. N. 

Engl. J. Med. 343(1), 108–117.


232. Delves, P. J. and Roitt I. M. (2000) The immune system. Second of two parts. N. 

Engl. J. Med. 343(2), 37–49. 

233. Coyle, A. J. and Gutierrez-Ramos, J. C. (2001) The expanding B7 superfamily: 

increasing complexity in costimulatory signals regulating T cell function. Nat. 

Immunol. 2, 203–209. 

234. Vincenti, F. (2002) What’s in the pipeline? New immunosuppressive drugs in 

transplantation. Am. J. Transplant. 2(10), 898–903. 

235. Nomura, Y., Mullen, Y., and Stein, E. (1993) Syngeneic islets transplanted into 

the thymus of newborn mice prevent diabetes and reduce insulitis in the NOD 

mouse. Transplant. Proc. 25, 963–964. 

236. Pugliese, A. (2002) Peripheral antigen-expressing cells and autoimmunity. 

Endocrinol. Metab. Clin. North Am. 31(2), 411–430, viii. 

237. Remuzzi, G., Perico, N., Carpenter, C. B., and Sayegh, M. H. (1995) The thymic 

way to transplantation tolerance. J. Am. Soc. Nephrol. 5(9), 1639–1646. 

238. Chowdhury, N. C., Saborio, D. V., Garrovillo, M., et al. (1998) Comparative 

studies of specific acquired systemic tolerance induced by intrathymic inoculation 

of a single synthetic Wistar-Furth (RT1U) allo-MHC class I (RT1.AU) 

peptide or WAG (RT1U)-derived class I peptide. Transplantation 66, 1059– 

1066. 

239. Posselt, A. M., Odorico, J. S., Barker, C. F., and Naji, A. (1992) Promotion of 

pancreatic islet allograft survival by intrathymic transplantation of bone marrow. 

Diabetes 41, 771–775. 

240. Ali, A., Garrovillo, M., Jin, M. X., Hardy, M. A., and Oluwole, S. F. (2000) Major 

histocompatibility complex class I peptide-pulsed host dendritic cells induce antigen-specific 

acquired thymic tolerance to islet cells. Transplantation 69(2), 221– 

226. 

241. Starzl, T. E., Demetris, A. J., Murase, N., Thomson, A. W., Trucco, M., and 

Ricordi, C. (1998) Transplantation tolerance, microchimerism, and the two-way 

paradigm. Theor. Med. Bioeth. 19(5), 441–455. 

242. Wekerle, T., Blaha, P., Koporc, Z., Bigenzahn, S., Pusch, M., and Muehlbacher, 

F. (2003) Mechanisms of tolerance induction through the transplantation of 

donor hematopoietic stem cells: central versus peripheral tolerance. Transplantation 

75(9 Suppl.), 21S–25S. 

243. Ricordi, C., Karatzas, T., Nery J., Webb, M., Selvaggi, G., Fernandez, L., 

Khan, F. A., Ruiz, P., Schiff, E., Olson, L., Fernandez, H., Bean, J., Esquenazi, 

V., Miller, J., and Tzakis, A. G. (1997) High-dose donor bone marrow infusions 

to enhance allograft survival: the effect of timing. Transplantation 63(1), 

7–11. 

244. Li, H., Inverardi, L., Molano, R. D., Pileggi, A., and Ricordi, C. (2003) Nonlethal 

conditioning for the induction of allogeneic chimerism and tolerance to islet 

allografts. Transplantation 75(7), 966–970. 

245. Ricordi, C., Murase, N., Rastellini, C., Behboo, R., Demetris, A. J., and Starzl, T. 

E. (1996) Indefinite survival of rat islet allografts following infusion of donor 

bone marrow without cytoablation. Cell Transplant. 5(1), 53–55.


246. Linsley, P. S., Wallace, P. M., Johnson, J., et al. (1992) Immunosuppression in 

vivo by a soluble form of the CTLA-4 T cell activation molecule. Science 257, 

792–795. 

247. Jordan, S. C., Matsumara Y., Zuo, X. J., Marchevsky, A., Linsley, P., and 

Matloff, J. (1996) Donor-specific transfusions enhance the immunosuppressive 

effects of single-dose cyclosporine A and CTLA4-Ig but do not result in longterm 

graft acceptance in a histoincompatible model of rat lung allograft rejection. 

Transplant. Immunol. 4, 33–37. 

248. Roy-Chaudhury, P., Nickerson, P. W., Manfro, R. C., Zheng, X. X., Steiger, J., 

Li, Y. S., and Strom, T. B. (1997) CTLA4Ig attenuates accelerated rejection 

(presensitization) in the mouse islet allograft model. Transplantation 64, 172– 

175. 

249. Lenschow, D. J., Zeng, Y., Thistlethwaite, J. R., et al. (1992) Long-term survival 

of xenogeneic pancreatic islet grafts induced by CTLA4lg. Science 257, 789– 

792. 

250. Gainer, A. L., Suarez-Pinzon, W. L., Min W. P., et al. (1998) Improved survival 

of biolistically transfected mouse islet allografts expressing CTLA4-Ig or soluble 

Fas ligand. Transplantation 66, 194–199. 

251. Levisetti, M. G., Padrid, P. A., Szot, G. L., et al. (1997) Immunosuppressive 

effects of human CTLA4Ig in a non-human primate model of allogeneic pancreatic 

islet transplantation. J. Immunol. 159, 5187–5191. 

252. Adams, A. B., Shirasugi, N., Durham, M. M., et al. (2002) Calcineurin inhibitorfree 

CD28 blockade-based protocol protects allogeneic islets in nonhuman primates. 

Diabetes 51, 265–270. 

253. Moreland, L. W., Alten, R., Van den Bosch, F., et al. (2002) Costimulatory blockade 

in patients with rheumatoid arthritis: a pilot, dose-finding, double-blind, placebo-controlled 

clinical trial evaluating CTLA-4Ig and LEA29Y eighty-five days 

after the first infusion. Arthritis Rheum. 46, 1470–1479. 

254. Larsen, C. P., Elwood, E. T., Alexander, D. Z., et al. (1996) Long-term acceptance 

of skin and cardiac allografts after blocking CD40 and CD28 pathways. 

Nature 381, 434–438. 

255. Zheng, X. X., Markees, T. G., Hancock, W. W., et al. (1999) CTLA4 Signals are 

required to optimally induce allograft tolerance with combined donor-specific 

transfusion and anti-CD154 monoclonal antibody treatment. J. Immunol. 162, 

4983–4990. 

256. Kirk, A. D., Harlan, D. M., Armstrong, N. N., et al. (1997) CTLA4-Ig and anti- 

CD40 ligand prevent renal allograft rejection in primates. Proc. Natl. Acad. Sci. 

USA 94, 8789–8794. 

257. Nanji, S. A., Hancock, W. W., Anderson, C. C., Zhu, L. F., Kneteman, N. M., 

and Shapiro, A. M. (2003) Combination therapy with anti-ICOS and cyclosporine 

enhances cardiac but not islet allograft survival. Transplant. Proc. 35(7), 2477– 

2478. 

258. Yang, Y. and Wilson, J. M. (1996) CD40 ligand-dependent T cell activation. 

requirement of B7-CD28 signaling through CD40. Science 273, 1862–1864.


259. Grewal, I. S., Foellmer, H. G., Grewal, K. D., et al. (1996) Requirement for CD40 

ligand in costimulation induction, T cell activation, and experimental allergic 

encephalomyelitis. Science 273, 1864–1867. 

260. Kenyon, N. S., Chatzipetrou, M., Masetti, M., et al. (1999) Long-term survival and 

function of intrahepatic islet allotrafts in rheses monkeys treated with humanized 

anti-CD154. Proc. Natl. Acad. Sci. USA 96(14), 8132–8137. 

261. Kenyon, N. S., Fernandez, L. A., Lehmann, R., et al. (1999) along-term survival 

and function of intrahepatic islet allografts in baboons treated with humanized 

anti-CD154. Diabetes 48(7), 1473–1481. 

262. Kawai, T., Andrews, D., Colvin, R. B., Sachs, D. H., and Cosimi, A. B. (2000) 

Thromboembolic complications after treatment with monoclonal antibody 

against CD40 ligand. Nat. Med. 6(2), 114. 

263. Pearson, T. C., Trambley, J., Odom, K., Aet al. (2002) Anti-CD40 therapy extends 

renal allograft survival in rhesus macaques. Transplantation 74, 933–940. 

264. Li, Y., Li, X. C., Zheng, X. X., Wells, A. D., Turka, L. A., and Strom, T. B. 

(1999) Blocking both signal 1 and signal 2 of T-cell activation prevents apoptosis 

of alloreactive T cells and induction of peripheral allograft tolerance. Nat. 

Med. 5, 1298–1302. 

265. Asiedu, C. K., Dong, S. S., Lobashevsky, A., Jenkins, S. M., and Thomas, J. M. 

(2003) Tolerance induced by anti-CD3 immunotoxin plus 15-deoxyspergualin 

associates with donor-specific indirect pathway unresponsiveness. Cell Immunol. 

223(2), 103–112. 

266. Knechtle, S. J. (2001) Treatment with immunotoxin. Philos. Trans. R. Soc. Lond. 

B Biol. Sci. 356(1409), 681–689. Knechtle, S. J., Hamawy, M. M., Hu, H., 

Fechner, J. H., Jr., Cho, C. S. (2001) Tolerance and near-tolerance strategies in 

monkeys and their application to human renal transplantation. Immunol. Rev. 

183, 205–213. 

267. Vincenti, F. (1999) Daclizumab: novel biologic immunoprophylaxis for prevention 

of acute rejection in renal transplantation. Transplant. Proc. 31(6), 2206– 

2207. 

268. Spitzer, T. R., Delmonico, F., Tolkoff-Rubin, N., et al. (1999) Combined histocompatibility 

leukocyte antigen-matched donor bone marrow and renal transplantation 

for multiple myeloma with end stage renal disease: the induction of 

allograft tolerance through mixed lymphohematopoietic chimerism. Transplantation 

68, 480–484. 

269. Solez, K., Vincenti, F., and Filo, R. S. (1998) Histopathologic findings from 2year 

protocol biopsies from a U.S. multicenter kidney transplant trial comparing 

tacrolimus versus cyclosporine: a report of the FK506 Kidney Transplant Study 

Group. Transplantation 66(12), 1736–1740. 

270. Jin, Y., Zhang, Q., Hao, J., Gao, X., Guo, Y., and Xie, S. (2003) Simultaneous 

administration of a low-dose mixture of donor bone marrow cells and splenocytes 

plus adenovirus containing the CTLA4Ig gene result in stable mixed chimerism 

and long-term survival of cardiac allograft in rats. Immunology 110(2), 275– 

286.


271. Seung, E., Iwakoshi, N., Woda, B. A., et al. (2000) Allogeneic hematopoietic 

chimerism in mice treated with sublethal myeloablation and anti-CD154 antibody: 

absence of graft-versus-host disease, induction of skin allograft tolerance, 

and prevention of recurrent autoimmunity in islet-allografted NOD/Lt mice. 

Blood 95, 2175–2182. 

272. Durham, M. M., Bingaman, A. W., Adams, A. B., et al. (2000) Cutting edge: 

administration of anti-CD40 ligand and donor bone marrow leads to hemopoietic 

chimerism and donor-specific tolerance without cytoreductive conditioning. 

J. Immunol. 165(1), 1–4. 

273. Dunger, D. B. (2002) Use of continuous glucose monitoring to investigate nocturnal 

hypoglycaemia prevalence in relation to insulin regimen and exercise. Diabetes 

51(Suppl. 2), A2. 

274. Amin, R., Ross, K., Acerini, C. L., Edge, J. A., Warner, J., and Dunger, D. B. 

(2003) Hypoglycemia prevalence in prepubertal children with type 1 diabetes on 

standard insulin regimen: use of continuous glucose monitoring system. Diabetes 

Care 26(3), 662–667. 

275. Hathout, E., Lakey, J., and Shapiro, J. (2003) Islet transplant: an option for childhood 

diabetes? Arch. Dis. Child. 88(7), 591–594. 

276. Edge, J. A., Hawkins, M. M., Winter, D. L., and Dunger, D. B. (2001) The risk 

and outcome of cerebral oedema developing during diabetic ketoacidosis. Arch. 

Dis. Child. 85, 16–22. 

277. Wallot, M. A., Mathot, M., Janssen, M., et al. (2002) Long-term survival and late 

graft loss in pediatric liver transplant recipients—a 15-year single-center experience. 

Liver Transplant. 8, 615–622. 

278. Gjertson, D. W. and Cecka, J. M. (2001) Determinants of long-term survival of 

pediatric kidney grafts reported to the United Network for Organ Sharing kidney 

transplant registry. Pediatr. Transplant. 5, 5–15. 

279. Goldstein, B. J. (2003) Insulin resistance: from benign to type 2 diabetes mellitus. 

Rev. Cardiovasc. Med. 4(Suppl. 6), S3–S10. 

280. Polonsky, K. S. (1995) Lilly Lecture 1994. The beta-cell in diabetes: from molecular 

genetics to clinical research. Diabetes 44(6), 705–717. 

281. Petrides, A. S. and DeFronzo R. A. (1989) Glucose metabolism in cirrhosis: a 

review with some perspectives for the future. Diabetes Metab. Rev. 5(8), 691–709. 

282. Ricordi, C., Alejandro, R., Angelico, M. C., et al. (1997) Human islet allografts 

in patients with type 2 diabetes undergoing liver transplantation. Transplantation 

63(3), 473–475. 

283. Angelico, M. C., Alejandro, R., Nery, J., et al. (1999) Transplantation of islets of 

Langerhans in patients with insulin-requiring diabetes mellitus undergoing orthotopic 

liver transplantation—the Miami experience. J. Mol. Med. 77(1), 144–147. 

284. Sasaki, T. M., Gray, R. S., Ratner, R. E., et al. (1998) Successful long-term kidney-pancreas 

transplants in diabetic patients with high C-peptide levels. Transplantation 

65(11), 1510–1512. 

285. Ricordi, C., Angelico, M. C., Alejandro, R., et al. (1997) Liver-islet transplantation 

in type 2 diabetes. Transplant. Proc. 29(4), 2240.

Status of Lung Transplantation 105 

4 

Current Status of Lung Transplantation 

Allan R. Glanville 

Summary 

Lung transplantation has come of age with the development of a critical mass of 

experienced clinicians who are committed to pooling their knowledge to solve the clinical 

problems that continue to confound the benefits individual patients may enjoy from 

these life-saving procedures. Adequately powered clinical trials are in progress to assist 

decision making regarding the role of newer immunosuppressive agents. Therapeutic 

drug monitoring has become critical to minimizing preventable complications such as 

renal dysfunction with calcineurin inhibitors. Fibroproliferation inhibitors are used more 

widely to ameliorate the abnormal healing response to allodependent or alloindependent 

injury, the latter perhaps related to underrecognized gastroesophageal reflux disease for 

which fundoplication is now proposed as an effective preventative measure. Cumulative 

damage to the graft from low-grade rejection is now appreciated as a potential cause of 

graft loss perhaps via an insidious small vessel vasculitis causing bronchiolar ischemic 

injury. Clearly, despite some progress, substantive challenges remain. 

Key Words: Lung transplantation; broncholitis obliterans; rejection; therapeutic 

monitoring. 


The last 20 yr have been both exciting and fulfilling for those privileged to be 

involved in this rapidly changing modality of care. Patients for whom no other 

therapy offered a realistic chance of ongoing survival and quality of life at last 

had hope. During these years the science of lung transplantation evolved from 

an experimental procedure to an investigative procedure to an accepted mainstream 

therapy for patients with life-threatening pulmonary diseases (1–5). 

Similarly, living lobar pulmonary transplantation, first performed in 1993, has 

now achieved a position as a legitimate therapy, particularly where lung transplantation 

using a cadaveric donor is not available in a timely fashion (6,7). 



105

106 Glanville 

International guidelines for the referral of patients for the consideration of listing 

for lung transplantation have been promulgated, debated, and revised (8,9). 

The consensus achieved by the working groups involved with the production 

of these documents has not only set a benchmark for international collaboration 

in the field of solid organ transplantation, but also typifies the willingness 

of the medical community to identify and solve key problem areas in this new 

field. As a result of this type of collaboration, adequately powered multicenter 

trials of new immunosuppressive agents are building on earlier single-center 

studies (10) to identify superior drug combinations for the prevention of rejection 

and obliterative bronchiolitis (OB) (11). Similar trials using rapamycin 

derivative (RAD; everolimus; Novartis Pharmaceuticals Corporation, East 

Hanover, NJ) are investigating effective therapies for established bronchiolitis 

obliterans syndrome (BOS), and a new position paper has been developed to 

assist in the diagnosis of BOS (12,13). Experiences gained in lung transplantation 

have provided new insights into other orphan diseases, such as primary 

pulmonary hypertension (PPH) (14–17), α 1-antitrypsin deficiency (AATD) 

(18), and pulmonary lymphangioleiomyomatosis (19). Viable alternatives to 

lung transplantation have been developed for certain patients, including PPH 

(20), postthromboembolic pulmonary hypertension (21), and, most importantly 

for emphysema, where the role of lung-volume-reduction surgery is under 

review (22). Diagnostic bronchoscopic techniques such as transbronchial lung 

biopsy (23) and interventional techniques such as laser therapy (24), balloon 

dilatation, and stent placement have undergone major advances as a direct 

result of the need to examine the allograft for rejection and infection (25) and 

to manage the sequelae of bronchial anastomotic strictures (26–29). These techniques 

have been transferred to the management of patients with conditions 

including lung cancer, posttuberculosis stricture, and tracheo-esophageal fistula 

(30). 

The development of isolated lung transplantation, coupled with the early high 

perioperative mortality rates reported for heart–lung transplantation (HLT), led 

to a reduction in the yearly rate of HLT from a plateau of about 220 procedures 

per annum in 1988–1995 to only 71 procedures in 2002 (31). For the 2973 

patients in the International Society for Heart and Lung Transplantation 

(ISHLT) Registry database up to 2002, 1-yr survival was 62% and 5-yr survival 

was 41%. However, while the overall T 1/2 was only 2.8 yr, the conditional T 1/2 

(i.e., for 1-yr survivors) was 8.3 yr. In contrast, 1-yr survival for HLT at St 

Vincent’s (Sydney, Australia) has been 81% overall and 93% during the last 

decade (n = 42). For experienced units with higher-than-average 1-yr survival, 

this is still an excellent operation with a substantial number of patients now in 

the 15- to 20-yr survival group (32). Predominant indications remain congenital 

heart disease (CHD) (32%), PPH (24%), cystic fibrosis (CF) (15%), chronic


obstructive pulmonary disease (COPD) (6%), AATD (2%), and idiopathic pulmonary 

fibrosis (IPF) (3%). Retransplantation accounts for 2%. Arguments still 

exist regarding the equity of performing this triple organ transplant where separation 

of the donor bloc might service two or even three individuals, but in 

truth, few surgeons have achieved substantive experience with the nuances of 

this procedure, and this alone biases toward the performance of separate heartand 

lung-only transplants. Moreover, where the heart transplant team is involved 

with the discussion regarding organ allocation, there are often cardiac patients 

who seem to have a more pressing need than the potential HLT recipient. As a 

result, the majority of units now routinely service all indications other than 

CHD with the lung-only procedures (5). 

For lung-only transplants, an activity plateau of about 1650 procedures per 

annum was reached during 1996–2002. The numbers of bilateral sequential 

single lung transplants (BSSLT) have slowly risen during this time to account 

for just over half of the procedures performed per year. It is of interest that 

although the 1-yr survival figures for single lung transplant (SLT) (n = 8581) 

and BSSLT (n = 6686) are superior to HLT at 73 and 75% with T 1/2 of 3.9 and 

5.3 yr, respectively, the 5-yr figures are equivalent for SLT but superior for 

BSSLT at 43% and 51%, with conditional T 1/2 (conditional on 1-yr survival) of 

6.2 and 8.3 yr, respectively. St Vincent’s has a 90% survival at 1 yr for BSSLT 

(n = 275) and 80% for SLT (n = 140), with 5-yr survivals of 65 and 57%, 

respectively. 

Indications for SLT remain COPD (53%), IPF (24%), and AATD (9%). In 

comparison, CF (31%) comprises the largest group for BSSLT, followed by 

COPD (23%), AATD (10%), IPF (10%), and PPH (8%). Differences in organallocation 

systems throughout the world are associated with regional differences 

in mortality rates on the waiting list. The equity of duration of time 

waiting versus medical urgency as a criterion for priority of transplantation 

remains questionable. IPF and CF have the highest mortality rates on the waiting 

list (33). Late referral compounds this problem, particularly for patients 

with IPF (34). 

Some 46% of all lung transplant recipients are in the age range of 50–64 yr, 

with 50% of procedures during 1997–2003 performed in this age group. Similarly, 

the mean donor age rose from 24 yr in 1989 to 34 yr in 2002. The number 

of pediatric recipients (

108 Glanville 

2. Long-Term Outcomes 

2.1. Survival 

The causes of death after lung transplantation vary with the time posttransplant; 

to provide ease of grouping of like causes it is useful to divide the time 

after lung transplantation into operative, perioperative (within 30 d of transplant), 

early (defined as within the first postoperative year), medium term (1– 

3yr), and late (beyond 3 yr). To add some complexity to this analysis, it is 

important to acknowledge that causes of death are still evolving, representing 

the dynamic nature of developments in the field over the last 10 yr. Although 

some units have reached maturation, many have become defunct. Only a few 

have taken up the challenge anew. In fact only 44 of 126 centers that have 

performed HLT are still active compared with 91 of 161 SLT centers and 91 of 

148 bilateral lung transplant centers (35). 

Thirty-day mortality, not surprisingly, is predominantly dependent on surgical 

factors, factors related to donors, organ harvesting, ex vivo preservation, 

and early high-dose immunosuppression. In order of prevalence, causes of death 

include nonspecific graft failure (NSGF) (31%), noncytomegalovirus (non- 

CMV) infection (24%), technical factors (8%), cardiac causes (12%), acute 

rejection (5%), OB (0.5%), and CMV infection (0.1%). Primary graft failure 

carried a mortality rate of 63% in one series (36). 

1. Early deaths (31 d to 1 yr) are largely the result of non-CMV infections (39%), 

and NSGF (18%), followed by OB (6%), cardiac (4%), posttransplant lymphoproliferative 

disease (PTLD) (3%), CMV (4%), technical (3%), malignancy (2%), 

and acute rejection (2%). 

2. Medium term (1–3 yr), the pendulum has swung toward OB, which accounts for 

29% of deaths. Other major causes include non-CMV infections (39%) and NSGF 

(16%). Minor causes include malignancy (5%), cardiac (3%), PTLD (2%), acute 

rejection (2%), CMV (2%), and technical (1%). 

3. Late deaths (beyond 3 yr) are dominated by OB (32%), non-CMV infection 

(20%), and NSGF (17%). Malignancy accounts for 7%, with other minor causes 

including cardiac (4%), PTLD (2%), acute rejection (1%), and CMV (1%). 

It is perhaps disappointing that NSGF accounts for so many deaths, as it 

suggests that an in-depth analysis of etiology has not been made, nor has postmortem 

information been available. It is likely the effects of ischemiareperfusion 

injury account for the majority of cases (37). Few centers have 

routinely reported postmortem data, but this final assessment is strongly recommended 

(38). One center that has analyzed postmortem data found an especially 

high rate of pulmonary thromboembolism in ventilated patients (39). 

Although acute rejection does not account for a significant proportion of deaths, 

these data do not include an assessment of the relationship between therapy for


rejection and resulting infection. This potential relationship is perhaps even 

more important in the nexus between OB and infectious death. The major trend, 

however, is the dominance of OB as the cause of death for long-term survivors, 

with an increasing frequency of malignancy as a late cause of death. It is important 

to emphasize that the cause of death is not confirmed by postmortem 

examination in the majority of these, and therefore the diagnosis of OB as the 

cause is usually based on the presence of BOS (13). This can only result in an 

overestimate of the real incidence of OB as a factor. Significant OB is always 

associated with a loss of lung function. 

Data from 1995 to 2002 identify the major risks for 1-yr survival as retransplantation 

with an odds ratio (OR) of 2.42, diagnosis of sarcoidosis (OR 2.2), 

use of intravenous inotropes (OR 2.26), diagnosis of PPH (OR 2.24), transplantation 

from a ventilator (OR 2.21), donor diagnosis of diabetes mellitus 

(DM) (OR 1.95), diagnosis of AATD (OR 1.67), recipient diagnosis of malignancy 

(OR 1.61), diagnosis of IPF (OR 1.60), and CMV mismatch of donor 

(seropositive) and recipient (seronegative) (OR 1.32). 

Both linear and quadratic analysis identify risk factors as increasing age 

(OR 1.0 at 51) (p < 0.0001), reduced center volume (OR 1.0 at 20 transplants/ 

yr) (p < 0.0001), and increasing pulmonary vascular resistance (OR 1.0 at 3) 

(p < 0.02), as well as a combination of increasing donor age with increasing 

ischemic time (p = 0.03). Factors not associated with an increased risk of 1-yr 

survival include recipient factors such as pCO 2, chronic steroid use, transfusions, 

and recent infection requiring intravenous drug therapy; donor factors 

such as clinical infection, history of hypertension, and history of cancer; and 

transplant factors such as procedure type, ABO compatibility, human leukocyte 

antigen (HLA) mismatch, year of transplant, and height ratio of donor 

and recipient. 

Recipient age (30–50 yr OR 1.0 with 65 yr OR 2.0) and donor age (55 yr OR 

1.5) remain important factors for 5-yr survival, as do transplantation from a 

ventilator (OR 2.24), retransplantation (OR 1.98), donor infection within 2 wk 

of transplant needing intravenous therapy (OR 1.36), diagnosis of IPF (OR 

1.07), and HLA mismatch (OR 1.07/mismatch). Of interest, donor weight of 

less than 70 kg is protective (p = 0.02), as is recipient pulmonary vascular 

resistance less than 3 wood units (p = 0.002). 

Factors not associated with increased risk of 5-yr survival include recipient 

factors such as hospitalized status, chronic steroid use, transfusions, history of 

malignancy, panel reactive antibody positivity, gender, forced vital capacity 

(FVC), forced expiratory volume in 1 s (FEV 1), height, and weight, whereas 

donor factors not associated include gender, clinical infection, history of hypertension, 

history of cancer, history of diabetes, and height. Transplant factors 

include procedure type and ABO compatibility.

110 Glanville 

2.2. Morbidity 

2.2.1. Overview 

Given the depressing list of potential complications that have been recorded 

after lung transplantation, it is encouraging that most are infrequent or, at least, 

well-known and predictable sequelae of immunosuppression for which there 

are now preventative strategies. Hypertension is the most prevalent serious complication, 

occurring in 50% of recipients at 1 yr and 86.4% at 5 yr; renal dysfunction 

occurs in 25.8 and 38.4%, respectively, with 1.9 and 3.4% requiring 

dialysis. Hyperlipidemia occurs in 16.3 and 45.5% and diabetes mellitus in 20.1 

and 29.4%. These four complications are all predominantly related to immunosuppressive 

therapy with calcineurin inhibitors and corticosteroids superimposed 

on pretransplant risk factors related to underlying disease states. Recent 

data suggest that changes in monitoring techniques hold promise in ameliorating 

renal dysfunction (40–42), but these techniques have not yet been embraced 

by the broader lung transplant community, although an international trial is 

about to commence. 

2.2.2. Surgical Complications 

Despite recent improvements in perioperative mortality rates, morbidity related 

to wound dehiscence remains an important cause of prolonged impatient stay. 

Common causes include wound infection with common bacterial pathogens, 

particularly multiresistant Staphylococcus aureus (MRSA), but even fastidious 

organisms such as Mycoplasma hominis are reported to cause wound breakdown 

and should be considered where wound swabs show pus cells but no 

organisms on Gram stain (43). Culture takes 5–8 d, so plates should not be 

discarded early in this situation. Preliminary evidence also implicates Chlamydia 

pneumoniae as a potential contributor to early postoperative mortality from 

airway dehiscence and inflammatory airway disease, but confirmation of diagnosis 

requires more sophisticated tools such as polymerase chain reaction 

(PCR) of bronchoalveolar fluid because most laboratories are not able to culture 

wild strains (44). Empiric prophylactic antibiotic therapy with macrolides 

with or without a tetracycline may eradicate this organism if treatment is sufficiently 

prolonged (>6 wk). 

An inevitable consequence of bilateral thoracosternotomy performed for bilateral 

lung transplantation is cutaneous paresthesia and commonly dysesthesia 

related to surgical section of cutaneous nerves. Return of sensation is variable, 

and it is prudent to warn patients of the likely alterations in chest wall and 

nipple sensation at the time of acquiring informed consent. Postoperative 

arrhythmias are predominantly atrial in origin and probably no more frequent 

than with other forms of thoracic surgery (45). Most patients cope well with


the rate disturbance, but the risk of embolic phenomena makes it worth considering 

prophylaxis and/or early electroconversion. Pharmacological therapy 

with amiodarone is often effective, but the potential risks of acute and chronic 

pulmonary toxicity should be kept in mind, particularly if pulmonary infiltrates 

develop (46). Fungal anatomical infection may present with exsaguinating 

hemoptysis due to erosion into a pulmonary artery. Preventative strategies 

include the use of prophylactic inhaled amphotericin in the perioperative 

period (47). Inherent in the risk profile of thoracic surgery is the risk of operative 

ischemic events, perhaps related to inadvertent hypotension and 

hypoperfusion secondary to uncontrolled bleeding. Pulmonary vein thrombosis 

has been reported with an increased frequency in lung transplantation but 

may be successfully managed by early intervention (48, 49). The use of cardiopulmonary 

bypass, however, does not necessarily prevent these events and 

adds a significant risk of cognitive dysfunction, which may persist in the long 

term (50). Atrial anastomotic thrombus, which may be detected by transeosophageal 

echocardiography, adds another potential embolic risk of neurological 

deficit. 

One surgical complication that may respond to medical therapy is the development 

of significant gastroparesis with secondary gastroesophageal reflux disease 

(GERD) resulting from either section, traction, or thermal trauma to vagal 

efferents (51). Therapy with dietary advice, elevation of the head of the bed, 

prokinetic agents, acid suppression, and newer anti-reflux therapies such as 

proton pump inhibitors may ameliorate symptoms. It is often the passage of 

time, however, that affords resolution of simple traction or thermal injuries. 

Abdominal weight loss is important in this group to further reduce the risk of 

aspiration. Silent nocturnal aspiration of gastric contents is now recognized as 

a potential risk factor for the development of BOS (52–54). The mechanism 

may be complex, involving the interaction of a competent immune response to 

epithelial injury followed by the development of an autonomous propagation 

of the response to alloepithelial antigens (55). Surgical attempts at cure using 

fundoplication should be undertaken before permanent airway damage ensues 

(56–58). Phrenic nerve palsy, whether by inadvertent intraoperative section, 

thermal trauma, or traction may delay weaning from assisted ventilation and 

pose ongoing problems with breathing while recumbent, particularly at the time 

of bronchoscopy. 

2.2.3. Iatrogenic Complications 

Bronchoscopy with transbronchial biopsy (TBBx) carries an appreciable 

iatrogenic risk for patients undergoing lung transplantation. In services where a 

policy of allograft surveillance with TBBx is followed, the majority of patients 

will undergo at least six procedures in the first postoperative year. The total

112 Glanville 

risk for an individual patient, therefore, is the unit risk per procedure multiplied 

by the number of procedures. Complications of TBBx in lung transplant 

recipients include pneumothorax (1–3%), pulmonary hemorrhage (10– 

15%), postprocedure fever (5–7%), need for assisted ventilation (0.1–0.5%), 

arrhythmia (2%), upper airway obstruction requiring intervention (10%). and 

cardiorespiratory arrest and death (~0.01%) (59). The putative benefit rests 

in the hope that early therapeutic intervention resulting from the diagnostic 

procedure might prevent development of permanent allograft dysfunction. 

Interventional bronchoscopy for the management of airway anastomotic 

breakdown or stricture by its very nature has a much higher risk profile. Torrential 

bleeding from granulation tissue, airway rupture, creation of a false passage, 

misplacement of a stent, migration of a stent, and late stent occlusion 

from granulation tissue or inspissated secretions are all recognized complications. 

Nevertheless, excellent individual results can be obtained with long-term 

good-quality survival, but group results are inferior to those seen in patients 

who do not need airway intervention (28). 

Other common but potentially risky procedures include insertion of central 

venous access devices, particularly Swan-Ganz catheters (60–62) and largebore 

indwelling vascular catheters for dialysis, pleural drainage tubes, and 

urinary catheters. Death from perforation of the jugular vein leading to hemothorax 

and hypotension, air embolism (63), undiagnosed tension pneumothorax, 

lacerations of intercostals arteries, splenic puncture, and direct myocardial 

transfixion have all been recorded (64, 65). 

In addition to morbidity related to immunosuppressive agents, three relatively 

common idiosyncratic adverse drug reactions seem to have a predilection 

for transplant patients. Ciprofloxacin-associated Achilles tendon disease 

is characterized by pain, gait disturbance, swelling, and occasionally rupture 

and is reported to occur frequently in lung transplant recipients (66). It does 

not appear to be a dose-related phenomenon. Nor is it related to postoperative 

steroid dose, age, or underlying disease process. Aminoglycoside ototoxicity 

is a potential complication worth considering in addition to renal toxicity and 

may occur even with inhaled therapy. Risks are even more difficult to assess 

in the ventilated patient. Formal audiological testing at the time of transplant 

assessment is particularly useful in patients with CF to identify patients at high 

risk. Statin-related acute and chronic rhabdomyolysis may be a devastating 

complication with profound global weakness, myoglobinuria, and renal failure 

or may present simply with subtle fatiguability (67). Triazole antifungal agents 

alter calcineurin metabolism so that catastrophic levels of muscle breakdown 

may ensue in patients taking statins. Pravastatin is reported to have the lowest 

rate of this effect at low and intermediate dosages.


2.2.4. Generic Complications of Immunosuppression 

Opportunistic infections are perhaps the most frequent cause of morbidity 

and direct mortality following lung transplantation. Common agents include 

CMV (68, 69), MRSA, other herpesviruses, including Epstein–Barr virus 

(EBV), varicella-zoster, and human herpesvirus 8 (70), typical and atypical 

mycobacteria (71), Pneumocystis carinii, Aspergillus fumigatus, Nocardia 

species, Burkholderia cepacia (72), and Pseudomonas aeruginosa. Concerns 

regarding multiresistant agents such as vancomycin-resistant Enterococcus 

(VRE) affect all who work in this area. 

PTLD is found more commonly after lung transplantation than other forms 

of solid organ transplantation, which may reflect the bulk of lymphoid tissue 

transplanted with the pulmonary allograft, the tendency for young lung transplant 

recipients to be EBV-naïve, or simply use of a higher level of immunosuppression 

after lung transplantation (73, 74). EBV mismatch, where an 

EBV-naïve recipient receives an EBV-positive graft is reported to carry such 

a high incidence (30–50%) (75) of PTLD that serious questions have been 

raised regarding the utility of transplant for EBV-naïve recipients because 

PTLD is often fatal. Not all units have found this association, however, or 

such a high mortality rate (76). One recent report outlines a strategy to reduce 

the incidence of PTLD to an acceptable, almost negligible level by avoiding 

cytolytic therapy using low-level immunosuppression and lifelong antiviral 

therapy in the high-risk group of EBV-mismatched recipients (77). The specific 

role of antiviral therapy is debatable. However, once PTLD is diagnosed, 

most units advise reduction of the ambient level of immune 

suppression guided by serial monitoring of EBV viral load kinetics. Indeed, 

this latter strategy can be used prospectively to determine a threshold for 

preemptive therapy akin to strategies used for CMV (78–81). PTLD represents 

53% of posttransplant malignancy occurring in the first postoperative 

year but only 17% by the fifth year posttransplant. Conversely, cutaneous 

malignancy assumes a more important role as time passes posttransplant. At 

1 yr it causes 15% of malignancy, but by 5 yr 56% of cases (35). In particular, 

cutaneous squamous cell carcinoma (SCC) in the immunosuppressed lung 

transplant recipient has a predilection for metastatic spread, thereby causing 

significant morbidity in this group. While exhortations to practice sun-safe 

behavior are frequently made to this group, it is more likely that the rate of 

SCC reflects solar damage that occurred 10–20 yr previously. Regular and 

frequent dermatological review is nevertheless important to detect early SCC 

at a stage where interventional management may be efficacious to avoid disfiguring 

surgery and fatal metastatic spread. The issues of female genital 

health and especially the risk of genital tract neoplasm related to human papillomavirus 

infection have received scant attention in the literature to date.

114 Glanville 

Our recent review records a higher rate of cervical intraepithelial neoplasia 

(CIN; grades 1–3) after lung transplantation (82). Frequent surveillance PAP 

smears are needed to detect early recurrence after therapeutic endeavors. 

Extensive surgery may be required for vulval intraepithelial neoplasia (VIN). 

Routine surveillance mammography or indeed self-examination for the early 

detection of breast carcinoma after lung transplantation has not been proven 

to have advantageous cost–benefit ratio, but logic dictates that benefits might 

accrue to individual patients who have higher risk profiles. 

Lung cancer may occur in the transplanted lung, but more reports have dealt 

with the problem of lung cancer in either the explanted lung or the remaining 

native lung (83, 84). Depending on the underlying disease process, it may be 

very difficult to detect a small primary neoplasm, and where patients spend a 

protracted time on the waiting list, it is wise to perform review thoracic computed 

tomography scans on a 6-mo basis to detect early lesions. The cost efficiency 

of this strategy is such that only 1 case per 100 lung transplants needs to 

be detected to provide a favorable cost-utility ratio. There are no prospective 

data on the potential role or cost-efficiency ratio for the use of positron emission 

tomography (PET) scans in this group. Careful review of chest radiography 

performed on the night of the transplant is of course invaluable to detect 

larger lesions (>1 cm), but chest x-ray is neither sensitive nor specific, and the 

decision to defer lung transplantation is difficult in this situation. The risk of 

proceeding needs to be weighed against the likelihood that a particular lesion 

is malignant and will not be cured by resection. 

2.2.5. Multifactorial Complications 

Coronary artery disease (CAD) rarely causes death after lung transplantation, 

but transplant-related CAD after HLT occurs frequently in conjunction 

with OB, suggesting that both may be forms of chronic allograft rejection. 

Transplant-related CAD is often difficult to appreciate on standard coronary 

angiography, which underestimates the severity and extent of pathology due 

to the diffuse and concentric nature of intimal changes (85). Intravascular 

ultrasound is the procedure of choice. Hypertension (HT) is the most frequent 

complication after lung transplantation. Therapy with calcineurin inhibitors, 

corticosteroids, renal dysfunction, obesity, and underlying disease states combine 

to produce an incidence of HT of 50% at 1 yr and 86.4% at 5 yr. HT 

is often refractory to therapy with conventional agents but may respond to 

angiotensin-converting enzyme (ACE) receptor antagonists, which fortunately 

have a lower rate of troublesome cough and angioedema than ACE inhibitors 

per se. 

Oral health is not always appreciated as a sine qua non of optimum success 

after lung transplantation, but recent studies demonstrate improvements in qual-


ity of life and outcome measures with attention to oral health issues. Severe 

gingival hyperplasia related to cyclosporine therapy may require conversion to 

alternative agents. 

Libido may be depressed or enhanced after lung transplantation. Alterations 

in body image, postoperative chest pain, side effects of medications— 

especially corticosteroids—and changes in the dynamics of longstanding 

relationships related to shifts in the need for care/caregiving may all impact 

negatively on the desire to maintain a sexual relationship. Conversely, the 

freedoms that accrue with the liberation from the shackles of oxygen therapy, 

improvements in exercise tolerance, and a general feeling of health all conspire 

in the opposite direction. It may be commented that the desire to procreate 

often transcends common sense in healthy young transplant recipients. 

A considered individualized approach is advised as the preferred method for 

discussing these issues, after which optimum perinatal care is required for 

both mother and child (86). Fortunately, outcomes are often more positive 

than anticipated. 

2.2.6. Corticosteroids 

Although the ramifications of corticosteroid therapy are legion and well 

known, it is puzzling that more attempts to individualize therapy based on 

solid pharmacokinetic data are not made. It is as if the oldest and most frequently 

prescribed immunosuppressive in the pharmacopeia is somehow 

blighted by the curse of familiarity, and hence our patients pay a heavy penalty 

of unwanted and largely preventable side effects. A move towards routine 

performance of area under the curve (AUC) monitoring for prednisolone 

therapy may assist in the rational utilization of this most dangerous medication 

(87). 

Subtle alterations in bone mineral density occur promptly after lung transplantation, 

and the greatest damage is done during the first 6 mo (88,89). Steroids 

combine with calcineurin inhibitors to promote rapid bone loss during 

this time and preemptive strategies to prevent this trend should be part of routine 

management (90, 91). The risk of osteoporosis (OP) after lung transplantation 

should not be underestimated. OP is a mortality risk factor in some series, 

and the reduction of quality of life and rehabilitation potential associated with 

pathological fracture resulting from OP is well recognized (92). 

Proximal myopathy related to steroid therapy seriously hinders rehabilitation 

as well and may be so severe as to prevent independent walking and 

resumption of activities of daily living. Relative inactivity due to proximal 

myopathy forms part of a vicious cycle leading to further deconditioning and 

loss of function (93, 94). In addition to the direct effects of steroid therapy, 

posttransplant myopathy is a complex end result of pretransplant decondi-

116 Glanville 

tioning (95), the preexisting disease state (96), and cyclosporine effects (97, 

98). The success or failure of lung transplantation as a discipline ultimately 

depends on the functionality of the survivors, so it behooves all working in 

the area to act aggressively in the interests of optimum patient care to minimize 

the incidence of these catastrophic complications. In one sense, lung transplantation 

is perhaps the key for true pulmonary rehabilitation for selected 

patients (99). 

Cutaneous fragility remains problematic even on low-dose steroid therapy 

and is a great source of concern to many older patients. Seemingly minor 

trauma often results in significant skin tears requiring surgery, with or without 

skin grafting to repair the defect. The risk of secondary infection further compounds 

the impact of this all-too-frequent complication. In the younger age 

group, by comparison, acne is the usual problem, and while it may be controlled 

by topical therapies, it is the passage of time that more often provides 

resolution. Again, the distress of what we see as a relatively minor complication 

cannot be underestimated. Quality of life may be significantly impaired 

because of alterations in personal image. Acne may therefore require more 

aggressive systemic therapy in selected patients. 

DM occurs de novo posttransplant in 15–20% of patients. Patients with CF 

and patients on tacrolimus are at the highest risk, but onset is often related to 

augmented immunosuppression, with high-dose corticosteroids given for 

rejection. In addition to the usual risks of ketoacidosis and therapy-related hypoglycemia, 

DM may be associated with accelerated microvascular disease and 

thereby contribute to overall vasculopathy in the transplant recipient. Dietary 

management is important to help maintain optimal body mass index (BMI) and a 

balanced nutritional intake (100–102). Many transplant recipients blame their 

overeating on their steroid therapy, and for this reason alone, attempts to minimize 

steroid dosage are justifiable. Hyperlipidemia is, of course, exacerbated by 

dietary indiscretion, poor diabetic control, and excessive alcohol intake. 

Calcineurin inhibitors and rapamycin, in particular, all contribute to the difficulty 

of normalizing lipids after transplant. 

Posterior subcapsular cataract formation is the ocular hallmark of steroid 

therapy after lung transplantation and is so frequent that it is good policy to 

incorporate a yearly eye examination schedule (103). Fortunately, lens extraction 

is now performed as a minor procedure, and thus, the burden of diminished 

visual activity in this group may be reduced. The accelerated nature of 

cataract formation in this group mandates expediting ophthalmic surgery to 

maximize quality of life. Avascular necrosis of the femoral head presents with 

pain and a limp. Bone scan findings are typical, and treatment of choice is total 

hip replacement for severe cases. Perhaps 5% of patients are so afflicted, but 

age and previous treatment are cofactors in assessing relative risk.


Obstructive sleep apnea syndrome (OSAS) is an important but little appreciated 

cause of morbidity after lung transplantation (104). Whereas lung transplantation 

cures OSAS in the immediate postoperative period, a number of 

subjects develop OSAS rapidly thereafter. Lung transplantation behaves as an 

accelerated model for development of OSAS. Pulmonary denervation per se 

does not cause sleep disturbance (105, 106). Potential mechanisms include 

localized fat deposition in and around the upper airway and steroid-induced 

myopathy of the genioglossus. Weight gain is both a cause and consequence 

of OSAS in this group. Other sequelae include sleep fragmentation, hypertension, 

cardiac dysfunction, and a tendency to desaturate during fiberoptic bronchoscopy. 

The latter may be managed by therapeutic or, indeed, prophylactic 

insertion of a nasopharyngeal tube (107). 

2.2.7. Calcineurin Inhibitors 

The relative roles of the principal calcineurin inhibitors, cyclosporine and 

tacrolimus, in the generation of HT, hyperlipidemia, DM, and oral health issues 

have already been discussed. HT, particularly in the younger patient, is implicated 

in the potentially fatal complication of cerebral neurotoxicity manifest by 

major motor epilepsy and, on occasion, status epilepticus (108). Blood pressure 

control is essential for satisfactory short-term management. Other forms of neurotoxicity 

include tremor, an exaggerated physiological tremor that may be ameliorated 

by the use of a small dose of β-blocker, and peripheral neuropathy, 

which may respond to dose reduction if detected early. Delirium may be seen as 

an idiosyncratic response in new transplant recipients with initial drug exposure. 

Hypomagnesemia and hypokalemia are thought to be contributory factors 

(108). High-dose steroids alone may cause a similar response. 

Hirsutism may seem a small price to pay for adequate immunosuppression, 

but insofar as it impacts negatively on self-esteem and thereby limits social 

interaction, it can defeat the aim of lung transplantation to return functional 

patients to real-world situations (109). Therefore, a proactive strategy is needed 

to provide patients so afflicted access to optimal therapies to manage this problem. 

Nephrotoxicity was and is the major complication that requires ongoing 

consideration (110). Some 38.4% of lung transplant recipients have significant 

renal dysfunction by 5 yr posttransplant (35). This rate alone calls for an urgent 

reappraisal of current immunosuppressive strategies. The technology and pharmacological 

knowledge already exist to allow more sophisticated use of current 

drugs, and for the sake of renal preservation we must forgo outmoded 

approaches and embrace a new strategy (111). Every nephron is important, and 

the minor inconvenience of performing AUC monitoring or a limited sampling 

strategy is eminently worth the investment of time and cost if superior outcomes 

can be achieved.

118 Glanville 

3. Bronchiolitis Obliterans Syndrome 

Other authors will discuss the issues regarding BOS, but it would be remiss 

in this summary of the status of lung transplantation not to provide some further 

commentary. It is important when discussing BOS to clearly differentiate 

it from the diagnosis of OB, which is a pathological description (112–114). 

The two conditions are not mutually exclusive, however, and most but not all 

patients with OB will have BOS and vice versa. A distinct number with BOS 

will have other diagnoses, such as undetected invasive fungal infection, necrotizing 

bronchiolitis, chondromalacia, native lung volume hyperinflation syndrome, 

mycobacterial infection, Chlamydia infection, or PTLD. The value of 

postmortem studies as a teaching tool in this regard should not be discounted. 

The logical corollaries are (1) that all attempts to achieve a firm tissue diagnosis 

should reasonably be made within a suitable risk–benefit framework and 

(2) that empiric augmented immunosuppression carries a mortality risk for a 

percentage of patients with BOS (115). One year after lung transplantation the 

rate of BOS is 9.4%. By 5 yr it rises to 34.4%. These are conservative estimates 

in that they are based on self-reporting of rates determined from 1- and 5-yr 

survivors, not all of whom will have had regular lung function testing assessed 

for this complication. Furthermore, there is a well-recognized trend for units to 

underreport complications. Does BOS always connote OB? Certainly, the recognition 

of “reversible” BOS and the recently reported impact of therapy with 

azithromycin (116) as well as surgical therapy for GERD (52) point to an 

alloindependent mechanism associated with airflow limitation in the absence 

of bronchiolar obliteration. The paucity of careful postmortem studies correlating 

physiological with pathological findings limits observations in this area; 

nevertheless, it is likely significant OB is associated with severe airflow limitation, 

and once a terminal bronchiole is lost, the effect is permanent no matter 

the etiology. Hence, recurrent injury leads irrevocably to a cumulative situation 

of airway loss, which may be conceptualized as the progressive loss of the 

cross-sectional area of all the terminal bronchioles summed together. Notwithstanding 

the damage done to the whole respiratory epithelium, as posttransplant 

allograft epithelial injury is widespread, it is the impact on the terminal 

bronchioles that is so devastating from a functional perspective. It is these 

guardians of the acinus that stand as the last barrier in and out of the gasexchange 

unit. Indeed, there is no effective collateral ventilation beyond this 

level that can be accessed breath by breath. 

The paradigm of graft injury and defective repair with an exuberant 

fibroproliferative response has been the basis of much research in this area. 

Recent careful pathological work from the Cambridge group has identified a 

reduction in the number and patency of the tiny vessels that comprise the microvasculature 

surrounding the terminal bronchioles in patients who developed


OB (117). Perhaps rejection-associated microvasculitis is the root cause of most 

OB and the resultant ischemic injury the reason that repair is so inefficient. 

Bronchial vessels strangely have been ignored in the focus of rejection determined 

by TBBx, largely because the pulmonary vessels are so accessible to 

biopsy and so visible in the section. Most centers that report according to the 

ISHLT grading of pulmonary vasculature (A grade) and bronchial mucosa (B 

grade) will have detected the close correlation of A and B grades, so it is not 

difficult to assume that the missing link in the equation is the direct 

allodependent damage of the bronchial microvasculature, which would lead to 

mucosal loss. Whether epithelial injury occurs independent of microvascular 

injury is a moot point in true rejection but may explain the ability of alloindependent 

epithelial injury (such as GERD) to heal effectively. Microvascular 

ischemia may well be the true limiting factor after all. Ischemia itself likely 

leads to amplification of the inflammatory response by cytokine release with 

activation of resident dendritic cells, and upregulation of epithelial HLA expression 

to augmented airway epithelial damage. 

Several studies have linked the finding of acute pulmonary allograft rejection 

with the subsequent development of BOS, but none has then analyzed the 

positive predictive value of the diagnosis of BOS for the confirmation of OB 

postmortem in sufficient numbers to allow meaningful analysis (118–122). The 

possibility that treatment of BOS confounds the natural history should not be 

excluded from any proper discussion in this area. Perhaps a more useful signal 

for the development of (possibly) BOS or (certainly) OB will be the severity 

and persistence of lymphocytic bronchiolitis on transbronchial lung biopsy 

(28). It seems strange that the focus for so long in this area has been on the 

parenchyma rather than the airway. 

Approaches to the management of BOS have been described in this volume 

and elsewhere (123, 124). Early-recognition signals (125) are needed to allow 

institution of therapies at a stage where maximum preservation of lung function 

can be achieved. Every terminal bronchiole is important and, once lost to 

fibrosis, will never be recovered. A suitable metaphor for the effect of OB is to 

consider the total cross-sectional area of the 30,000 terminal bronchioles 

summed together as the area of a clock face. As the area of a single terminal 

bronchiole is lost to fibrosis, just over a second passes. Initially, there is no 

clinical evidence of disease because the lung has such a great functional 

reserve. By 6 o’clock the loss of 50% of the cross-sectional area is now appreciable, 

physiologically and symptomatically. Much irreversible damage has 

already been done, and it is here that the majority of interventional studies 

have usually commenced management! It is no wonder that the rate of effectiveness 

is so small. Proven effective treatments can only be established by 

properly powered multicenter trials that are not biased to a negative result by

120 Glanville 

the time of entry to the study. We need the best evidence as soon as it can 

collected to guide management in this area, which is so critical to the longterm 

viability of individual patients and to lung transplantation per se. Similarly, 

in the scientific domain, research should focus on vascular and epithelial 

injury patterns (126) and the fibroproliferative response of the human lung 

fibroblast (127, 128) with or without epithelial interactions (129). This information 

will then allow a rational choice of therapies for individual patients. 

Ultimately, the goal remains prevention, which hopefully will make early 

detection and therapy redundant. 

4. Future Trends 

The future of lung transplantation looks secure as a vigorous and determined 

global scientific approach is now being taken to identify and solve the 

major problems that bedevil the chance of an optimum outcome for the individual 

patient. Positive trends to guide forward planning and development 

include the development of consensus documents from the international community 

in the areas of listing of candidates, donor selection and management, 

primary graft dysfunction, the diagnosis and grading of acute and chronic pulmonary 

allograft rejection, and the description and grading of pulmonary allograft 

dysfunction (8, 13, 113, 114, 130). The revised grading of the pulmonary 

allograft dysfunction document includes a more sensitive descriptor of small 

airway dysfunction with the aim of identifying BOS at an earlier stage, which 

may be more amenable to reversal with interventional therapy, or at least to 

allow stabilization with maximal preservation of pulmonary functional reserve 

(131). Publication of the results of trials designed to prevent and manage BOS 

is awaited with great interest. Whether positive or not, the proper template now 

exists to examine these questions in a scientifically rigorous manner. The 

recognition of the precious nature of donor resources has led rightly to the 

reevaluation of evidence describing acceptable criteria for pulmonary organ 

utilization (130). Recommendations from the ISHLT position paper are yet to 

be tested widely in the crucible of clinical practice, but a patent willingness 

exists to implement them based on the experiences of a handful of avant garde 

units (132, 133). Knowledge gained from the study of patients with orphan 

diseases referred for transplantation has led to the development of therapeutic 

alternatives for pulmonary hypertension and emphysema with further refinements 

of listing criteria ensuing. It is likely that organ-allocation strategies 

will continue to reflect the dynamics of the local transplant community, with 

major differences existing between countries and indeed within some larger 

countries. It is to be hoped that inequities of organ allocation thus accruing 

can be solved ultimately by a system that takes cognizance of differing rates 

of urgency between disease states and rates of decline. Only thus can we, as a


global community, hope to minimize the phenomenon of death on the waiting 

list (33). 

5. Summary and Conclusions 

1. Alternatives to lung transplantation: The focus on lung failure generated by the 

transplant community has led to new initiatives and understandings of alternative 

therapies for specific conditions. Lung transplantation remains the optimal 

therapy for selected patients. 

2. Expanding the donor envelope: Traditional conservative concepts of the optimal 

donor are being superceded by a reasoned, outcome-based approach, with 

acceptable results taking into account the opportunity cost of not using a suboptimal 

donor for a potential recipient. 

3. Expanding the recipient envelope: The concept of whom to exclude from transplant 

has been superceded by the approach of whom to include within an acceptable 

risk–benefit ratio individualized to a specific patient. 

4. Sophisticated drug monitoring: High rates of renal dysfunction mandate the 

use of more sophisticated techniques such as AUC monitoring and limited sampling 

strategies targeted to reflect this. 

5. Individualized immunosuppressive therapy: The availability of techniques to 

examine in vitro the response of individual patient’s tissues to immunosuppressive 

agents lends itself to high level information regarding likely response 

in vivo. 

6. Multicenter trials: The template now exists to help answer the important questions. 

Initial studies are underway. 

7. Risk factor management: This remains essential for optimal outcomes. 

8. Side effect prophylaxis: The price of freedom is eternal vigilance. 

9. OB: the last challenge: As in Arthurian legend, OB is the once and future challenge 

and its conquest the holy grail of lung transplantation. 

Acknowledgment 

The author continues to acknowledge with much gratitude the privilege of 

being involved with the lung transplant community over the last 21 yr and in 

particular the experiences and lessons learned from exposure to this remarkable 

patient group. 

References 

1. Reitz, B. A., Wallwork, J. L., Hunt, S. A., et al. (1982) Heart-lung transplantation: 

successful therapy for patients with pulmonary vascular disease. N. Engl. J. Med. 

306, 557–564. 

2. Harringer, W. and Haverich, A. (2002) Heart and heart-lung transplantation: standards 

and improvements. World J. Surg. 26, 218–225. 

3. Spratt, P., Glanville, A. R., MacDonald, P., Farnsworth, A., Bryant, D., Keogh, 

A., and Chang, V. P. (1990) Heart/lung transplantation in Australia: early results 

of the St Vincent’s program. Transplant. Proc. 22, 2142–2142.

122 Glanville 

4. Whyte, R. I., Robbins, R. C., Altinger, J., et al. (1999) Heart-lung transplantation 

for primary pulmonary hypertension. Ann. Thorac. Surg. 67, 937–942. 

5. Barlow, C. W., Robbins, R. C., Moon, M. R., Akindipe, O., Theodore, J., and 

Reitz, B. A. (2000) Heart-lung versus double-lung transplantation for suppurative 

lung disease. J. Thorac. Cardiovasc. Surg. 119, 466–476. 

6. Cohen, R. G. S. (2001) Living donor lung transplantation. World J. Surg. 25, 

244–250. 

7. Starnes, V. A., Bowdish, M. E., Woo, M. S., et al. (2004) A decade of living 

lobar lung transplantation: recipient outcomes. J. Thorac. Cardiovasc. Surg. 

127, 114–122. 

8. Maurer, J. R., Frost, A. E., Estenne, M., Higenbottam, T., and Glanville, A. R. 

(1998) International guidelines for the selection of lung transplant candidates. 

The International Society for Heart and Lung Transplantation, the American Thoracic 

Society, the American Society of Transplant Physicians, the European Respiratory 

Society. Transplantation 66, 951–956. 

9. Glanville, A. R. and Estenne, M. (2003) Indications, patient selection and timing 

of referral for lung transplantation. Eur. Respir. J. 22, 845–852. 

10. Griffith, B., Bando, K., Hardesty, R., et al. (1994) A prospective randomized trial 

of FK506 versus cyclosporine after human pulmonary transplantation. Transplantation 

57, 848–851. 

11. Corris, P., Glanville, A., McNeil, K., et al. (2001) One year analysis of an ongoing 

international radomised study of mycophenolate mofetil (MMF) vs azathioprine 

(AZA) in lung transplantation. J. Heart Lung Transplant. 20, 208. 

12. Estenne, M. and Hertz, M. I. (2002) Bronchiolitis obliterans after human lung 

transplantation. Am. J. Respir. Crit. Care Med. 166, 440–444. 

13. Estenne, M., Maurer, J. R., Boehler, A., et al. (2002) Bronchiolitis obliterans syndrome 

2001: an update of the diagnostic criteria. J. Heart Lung Transplant. 21, 

297–310. 

14. Rubin, L. J. (1997) Primary pulmonary hypertension. N. Engl. J. Med. 336, 111–117. 

15. Fouty, B. and Rodman, D. M. (1999) Pulmonary vascular gene transfer: Prospects 

for successful therapy of pulmonary hypertension. Am. J. Respir. Cell Mol. Biol. 

21, 555–557. 

16. D’Alonzo, G. E., Barst, R. J., Ayres, S. M., et al. (1991) Survival in patients with 

primary pulmonary hypertension. Results from a national prospective registry. 

Ann. Intern. Med. 115, 343–349. 

17. Glanville, A. R., Burke, C. M., Theodore, J., and Robin, E. D. (1987) Primary 

pulmonary hypertension. Length of survival in patients referred for heart-lung 

transplantation. Chest 91, 675–681. 

18. Janus, E. B. J. (1990) Alpha-1-antitrypsin deficiency and emphysema: new horizons 

in treatment. Aust. NZ J. Med. 20, 755–757. 

19. Taylor, J., Ryu, J., Colby, T., and Raffin, T. (1990) Lymphangioleiomatosis. N. 

Engl. J. Med. 323, 1254–1260. 

20. Conte, J. V., Gaine, S. P., Orens, J. B., Harris, T., and Rubin, L. J. (1998) The 

influence of continuous intravenous prostcyclin therapy for primary pulmonary


hypertension on the timing and outcome of transplantation. J. Heart Lung Transplant. 

17, 679–685. 

21. Archibald, C. J., Auger, W. R., Fedullo, P. F., et al. (1999) Long-term outcome 

after pulmonary thromboendarterectomy. Am. J. Respir. Crit. Care Med. 160, 

523–528. 

22. Meyers, B. F. and Patterson, G. A. (2001) Lung transplantation versus lung volume 

reduction as surgical therapy for emphysema. World J. Surg. 255, 238–243. 

23. Higenbottam, T., Stewart, S., Penketh, A., and Wallwork, J. (1988) Transbronchial 

lung biopsy for the diagnosis of rejection in heart-lung transplant patients. Transplantation 

46, 532–539. 

24. Hertz, M. I., Harmon, K. R., Knighton, D. R., et al. (1991) Combined laser phototherapy 

and growth factor treatment of bronchial obstruction after lung transplantation. 

Chest 100, 1717–1719. 

25. Sibley, R. K., Berry, G. J., Tazelaar, H. D., et al. (1993) The role of transbronchial 

biopsies in the management of lung transplant recipients. J. Heart Lung Transplant. 

12, 308–324. 

26. Chhajed, P. N. M., Malouf, M., Tamm, M., Spratt, P., and Glanville, A. R. (2001) 

Interventional bronchoscopy for the management of airway complications following 

lung transplantation. Chest 120, 1894–1899. 

27. Chhajed, P. N. M., Tamm, M., and Glanville, A. R. (2001) Early experience with 

nitinol (ultraflex) stents for the management of benign airway lesions. Am. J. 

Respir. Crit. Care Med. 163, A700. 

28. Aboyoun, C. L., Tamm, M., M. Chhajed, P. N., et al. (2001) Diagnostic value of 

follow-up transbronchial lung biopsy after lung rejection. Am. J. Respir. Crit. Care 

Med. 164, 460–463. 

29. Schafers, H- J., Haydock, D. A., and Cooper, J. D. (1991) The prevalence and 

management of bronchial anamostic complications in lung transplantation. J. 

Thorac. Cardiovasc. Surg. 101, 1044–1052. 

30. Chhajed, P. N., Malouf, M., and Glanville, A. R. (2001) Bronchoscopic dilation 

in the management of benign (non-transplant) tracheobronchial stenosis. Intern. 

Med. J. 31, 512–516. 

31. Trulock, E. P., Edwards, L. B., Taylor, D. O., et al. (2004) The Registry of the 

International Society for Heart and Lung Transplantation: twenty-first official 

adult heart transplant report—2004. J. Heart Lung Transplant. 23, 804–815. 

32. Stoica, S. C., McNeil, K. D., Perreas, K., et al. (2001) Heart-lung transplantation 

for Eisenmenger syndrome: early and long-term results. Ann. Thorac. Surg. 72, 

1887–1891. 

33. De Meester, J., Smits, J. M., Persijn, G. G., and Haverich, A. (2001) Listing for 

lung transplantation: life expectancy and transplant effect, stratified by type of 

end-stage lung disease, the Eurotransplant experience. J. Heart Lung Transplant. 

20, 518–524. 

34. Lok, S. (1999) Interstitial lung disease clinics for the management of idiopathic 

pulmonary fibrosis: a potential advantage to patients. J. Heart Lung Transplant. 

18, 884–890.

124 Glanville 

35. Hosenpud, J. D., Bennet, L. E., Keck, B. M., Boucek, M. M., and Novick, R. J. 

(2001) The registry of the International Society for Heart and Lung Transplantation: 

eighteenth official report—2001. J. Heart Lung Transplant. 20, 805–815. 

36. Christie, J. D., Sager, J. S., Kimmel, S. E., et al. (2005) Impact of primary graft 

failure on outcomes following lung transplantation. Chest 127, 161–165. 

37. de Perrot, M., Liu, M., Waddell, T. K., and Keshavjee, S. (2003) Ischemiareperfusion-induced 

lung injury. Am. J. Respir. Crit. Care Med. 167, 490–511. 

38. Husain, A. N., Siddiqui, M. T., Reddy, V. B., Yeldandi, V., Montoya, A., and 

Garrity, E. R. (1996) Post-mortem findings in lung transplant recipients. Mod. 

Pathol. 9, 752–761. 

39. Burns, K. E. and Iacono, A. T. (2004) Pulmonary embolism on post-mortem 

examination: an under-recognized complication in lung-transplant recipients? 


40. Henry, M. (1999) Cyclosporine and tacrolimus (FK506): a comparison of efficacy 

and safety profiles. Clin. Transplant. 13, 209–220. 

41. Glanville, A. R., Morton, J. M., Aboyoun, C. L., Plit, M. L., and Malouf, M. A. 

(2004) Cyclosporine C2 monitoring improves renal dysfunction after lung transplantation. 

J. Heart Lung Transplant. 23, 1170–1174. 

42. Modry, D. L., Oyer, P. E., Jamieson, S. W., et al. (1985) Cyclosporine in heart and 

heart-lung transplantation. Can. J. Surg. 28, 274–280, 282. 

43. Hopkins, P. M., Winlaw, D. S., Chhajed, P. N., et al. (2002) Mycoplasma hominis 

infection in heart and lung transplantation. J. Heart Lung Transplant. 21, 1225– 

1229. 

44. Glanville, A. G., Gencay, M., Tamm, M., et al. (2005) Chlamydia pneumoniae 

infection after lung transplantation. J. Heart Lung Transplant. 24, 131–136. 

45. Hoffman, T. M., Rhodes, L. A., Wieand, T. S., Spray, T. L., and Bridges, N. D. 

(2001) Arrhythmias after pediatric lung transplantation. Pediatr. Transplant. 5, 

349–352. 

46. Ashrafian, H. and Davey, P. (2001) Is amiodarone an underrecognized cause of 

acute respiratory failure in the ICU? Chest 120, 275–282. 

47. Reichenspurner, H., Gamberg, P., Nitschke, M., et al. (1997) Significant reduction 

in the number of fungal infections after lung-, heart-lung, and heart transplantation 

using aerosolized amphotericin B prophylaxis. Transplant. Proc. 29, 

627–628. 

48. Nagahiro, I., Horton, M., Wilson, M., Bennetts, J., Spratt, P., and Glanville, A. R. 

(2003) Pulmonary vein thrombosis treated successfully by thrombectomy after 

bilateral sequential lung transplantation: report of a case. Surg. Today 33, 282– 

284. 

49. Leibowitz, D. W., Smith, C. R., Michler, R. E., et al. (1994) Incidence of pulmonary 

vein complications after lung transplantation: a prospective transesophageal 

echocardiographic study. J. Am. Coll. Cardiol. 24, 671–675. 

50. van Dijk, D., Keizer, A. M., Diephuis, J. C., Durand, C., Vos, L. J., and Hijman, 

R. (2000) Neurocognitive dysfunction after coronary artery bypass surgery: a systematic 

review [see comments]. J. Thorac. Cardiovasc. Surg. 120, 632–639.


51. Reid, K. R., McKenzie, F. N., Menkis, A. H., et al. (1990) Importance of chronic 

aspiration in recipients of heart-lung transplants. Lancet 336, 206–208. 

52. Hadjiliadis, D., Duane Davis, R., Steele, M. P., et al. (2003) Gastroesophageal 

reflux disease in lung transplant recipients. Clin. Transplant. 17, 363–368. 

53. Hoeskstra, H. J., Hawkins, K., de Boer, W. J., Rottier, K., and van der Bij, W. 

(2001) Gastrointestinal complications in lung transplant survivors that require 

surgical intervention. Br. J. Surg. 88, 433–438. 

54. Yiannopoulos, A., Shafazand, S., Ziedalski, T. et al. (2004) Gastric pacing for 

severe gastroparesis in a heart-lung transplant recipient. J. Heart Lung Transplant. 

23, 371–374. 

55. Palmer, S. M., Burch, L. H., Trindade, A. J., et al. (2005) Innate immunity influences 

long-term outcomes after human lung transplant. Am. J. Respir. Crit. Care 

Med. 171, 780–785. 

56. Hadjiliadis, D., Davis, R. D., and Palmer, S. M. (2002) Is transplant operation 

important in determining post transplant risk of brochiolitis obliterans syndrome 

in lung transplant recipients? Chest 122, 1168–1175. 

57. Lau, C. L., Palmer, S. M., Howell, D. N., et al. (2002) Laparoscopic antireflux 

surgery in the lung transplant population. Surg. Endosc. 16, 1674–1678. 

58. O’Halloran, E. K., Reynolds, J. D., Lau, C. L., et al. (2004) Laparoscopic Nissen 

fundoplication for treating reflux in lung transplant recipients. J. Gastrointest. 

Surg. 8, 132–137. 

59. Chhajed, P. N., Aboyoun, C. L., Malouf, M. A., Hopkins, P.M., Plit, M. L., and 

Glanville, A. R. (2003) Risk factors and management of bleeding associated with 

transbronchial lung biopsy in lung transplant recipients. J. Heart Lung Transplant. 

22, 195–197. 

60. Robin, E. D. (1985) The cult of the Swan-Granz catheter. Overuse and abuse of 

pulmonary flow catheters. Ann. Intern. Med. 103, 445–449. 

61. Robin, E. D. (1987) Death by pulmonary artery flow-directed catheter: time for a 

moratorium? Chest 92, 727–731. 

62. Robin, E. D. (1988) Defenders of the pulmonary artery catheter. Chest 93, 1059– 

1066. 

63. Muth, C. S. (2000) Gas embolism. N. Engl. J. Med. 342, 476–482. 

64. Kleinfeld, G. (1980) Iatrogenic splenic trauma. JAMA 244, 1784. 

65. Hesselink, D. A., Van Der Klooster, J. M., Bac, E. H., Scheffer, M. G., and 

Brouwers J. W. (2001) Cardiac tamponade secondary to chest tube placement. 

Eur. J. Emerg. Med. 8, 237–239. 

66. Chhajed, P. N., Plit, M., Hopkins, P., Malouf, M., and Glanville, A. R. (2002) 

Achilles tendon disease in lung transplant recipients: association with 

ciproflaxcin. Eur. Respir. J. 19, 469–471. 

67. Malouf, M. A., Bicknell, M., and Glanville, A. R. (1997) Rhabdomyolysis after 

lung transplantation. Aust. NZ J. Med. 27, 186. 

68. Duncan, A. J., Dummer, J. S., Paradis, I., et al. (1991) Cytomegalovirus infection 

and survival in lung transplant recipients. J. Heart Lung Transplant. 10, 638– 

646.

126 Glanville 

69. Burke, C. M., Glanville, A. R., Macoviak, J. A., et al. (1986) The spectrum of 

cytomegalovirus infection following human heart-lung transplantation. J. Heart 


70. Ho, M. (1998) Human herpesvirus 8—let the transplantation physician beware. 

N. Engl. J. Med. 339, 1391–1392. 

71. Malouf, M. A. and Glanville, A. R. (1999) The spectrum of mycobacterial infection 

after lung transplantation. Am. J. Respir. Crit. Care Med. 160, 1611–1616. 

72. Aris, R. M., Gillingan, P. H., Neuringer, I. P., Gott, K. K., Rea, J., and Yankaskas, 

J. R. (1997) The effects of panresistant bacteria in cystic fibrosis patients on lung 

transplant outcome. Am. J. Respir. Crit. Care Med. 155, 1699–1704. 

73. Yousem, S. A., Randhawa, P., Locker, J., et al. (1989) Posttransplant lymphoproliferative 

disorders in heart-lung transplant recipients. Hum. Pathol. 20, 361– 

369. 

74. Swerdlow, A. J., Higgins, C. D., Hunt, B. J., et al. (2000) Risk of lymphoid neoplasia 

after cardiothoracic transplantation. Transplantation 69, 897–904. 

75. Aris, R. M., Maia, D. M., Neuringer, I. P., et al. (1996) Post-transplantation 

lymphoproliferative disorder in the Epstein-Barr virus-naïve lung transplant recipient. 

Am. J. Respir. Crit. Care Med. 154, 1712–1717. 

76. Reams, B. D., McAdams, H. P., Howell, D. N., Steele, M. P., Davis, R. D., and 

Palmer, S. M. (2003) Post transplant lymphoproliferative disorder: incidence, presentation, 

and response to treatment in lung transplant recipients. Chest 124, 1242– 

1249. 

77. Malouf, M. A., Chhajed, P. N., Hopkins, P., Plit, M., Turner, J., and Glanville, A. 

R. (2002) Antiviral prophylaxis reduces the incidence of lymphoproliferative disease 

in lung transplant recipients. J. Heart Lung Transplant. 21, 547–554. 

78. Verschuuren, E. A., Stevens, S., Pronk, I., et al. (2001) Frequent monitoring of 

Epstein-Barr virus DNA load in unfractionised whole blood is essential for early 

detection of post-transplant lymphoproliferative disease in lung transplant patients. 


79. Verschuuren, E., van der Bij, W., de Boer, W., Timens, W., Middeldorp, J., and 

The, T. H. (2003) Quantitive Epstein-Barr virus (EBV) serology in lung transplant 

recipients with primary EBV infection and/or post-transplant 

lymphoproliferative disease. J. Med. Virol. 69, 258–266. 

80. Guiver, M., Fox, A. J., Mutton, K., Mogulkoc, N., and Egan, J. (2001) Evaluation 

of CMV viral load using TaqMan CMV quantitive PCR and comparison with 

CMV antigenemia in heart and lung transplant recipients. Transplantation 71, 

1609–1615. 

81. Michaelides, A., Facey, D., Spelman, D., Wesselingh, S., and Kostimbos, T. 

(2003) HCMV DNA detection and quantitation in the plasma and PBL of lung 

transplant recipients: COBAS Amplicor HCMV monitor test versus in-house 

quantitative HCMV PCR. J. Clin. Virol. 28, 111–120. 

82. Malouf, M. A., Hopkins, P. M., Singleton, L., Chhajed, P. N., Plit, M. L., and 

Glanville, A. R. (2002) Female sexual health issues after lung transplantation:the 

importance of screening. Am. J. Respir. Crit. Care Med. 165, A391.


83. Abrahams, N. A., Meziane, M., Ramalingam, P., Mehta, A., DeCamp, M., and 

Farver, C. F. (2004) Incidence of primary neoplasms in explanted lungs: longterm 

follow-up from 214 lung transplant patients. Transplant. Proc. 36, 2808– 

2811. 

84. Stagner, L. D., Allenspach, L. L., Hogan, K. K., Willcock, L. C., Higgins, R. S., 

and Chan, K. M. (2001) Bronchogenic carcinoma in lung transplant recipients. J. 

Heart Lung Transplant. 20, 908–911. 

85. Glanville, A. R., Baldwin, J. C., Hunt, S. A., and Theodore, J. (1990) Long-term 

cardiopulmonary function after human heart-lung transplantation. Aust. NZ J. 

Med. 20, 208–214. 

86. Armenti, V. T., Radomski, J. S., Moritz, M. J., Philips, L. Z., McGrory, C. H., and 

Coscia, L. A. (2000) Report from the National Transplantation Pregnancy Registry 

(NTPR): outcomes of pregnancy after transplantation. Clin. Transplant. 123– 

134. 

87. Morton, J. M., Mcwhinney, B., Hickman, P. E., and Potter, J. M. (2001) Therapeutic 

drug monitoring (TDM) of predinsolone in lung transplantation. J. Heart 

Lung Transplant. 20, 192. 

88. Henderson, K., Eisman, J., Keogh, A., et al. (2001) Protective effect of short-term 

calcitriol or cyclical etidronate on bone loss after cardiac or lung transplantation. 

J. Bone Miner. Res .16, 565–571. 

89. Sambrook, P., Henderson, N. K., Keogh, A., et al. (2000) Effect of calcitriol on 

bone loss after cardiac or lung transplantation. J. Bone Miner. Res. 15, 1818–1824. 

90. Aris, R. M., Lester, G. E., Renner, J. B., et al. (2000) Efficacy of pamidronate for 

osteoporosis in patients with cystic fibrosis following lung transplantation. Am. J. 

Respir. Crit. Care Med. 162, 941–946. 

91. Spira, A., Gutierrez, C., Chaparro, C., Hutcheon, M. A., and Chan, C. K. (2000) 

Osteoporosis and lung transplantation: a prospective study. Chest 117, 476–481. 

92. Shane, E., Papadopoulos, A., Staron, R., et al. (1999) Bone loss and fracture after 

lung transplantation. Transplantation 68, 220–227. 

93. Epstein, F. H. (2000) Exercise limitation in health and disease. N. Engl. J. Med. 

343, 632–641. 

94. Morrison, W. L. Gibson, J. N., Scrimgeour, C., and Rennie, M. J. (1988) Muscle 

wasting in emphysema. Clin. Sci. (Colch.) 75, 415–420. 

95. Williams, T. J., Patterson, G. A., McClean, P. A., Zamel, N., and Maurer, J. R. 

(1992) Maximal exercise testing in single and double lung transplant recipients. 

Am. Rev. Respir. Dis. 145, 101–105. 

96. Otulana, B., Higenbottam, T. and Wallwork, J. (1992) Causes of exercise limitation 

after heart-lung transplantation. J. Heart Lung Transplant. 11, S244–251. 

97. Evans, A., Al-Himyary, A., Hrovat, M., et al. (1997) Abnormal skeletal muscle 

oxidative capacity after lung transplantation by 31 P-MRS. Am. J. Respir. Crit. Care 

Med. 155, 615–621. 

98. Wang, X. N., Williams, T. J., McKenna, M. J., et al. (1999) Skeletal muscle oxidative 

capacity, fiber type, and metabolites after lung transplantation. Am. J. 

Respir. Crit. Care Med. 160, 57–63.

128 Glanville 

99. Resnikoff, P. M. and Ries, A. L. (1998) Pulmonary rehabilitation for chronic 

lung disease. J. Heart Lung Transplant. 17, 643–650. 

100. Schwebel, C., Pin, I., Barnoud, D., et al. (2000) Prevalence and consequences of 

nutritional depletion in lung transplant candidates. Eur. Respir. J. 16, 1050–1055. 

101. Snell, G. I., Bennetts, K., Bartolo, J., et al. (1998) Body mass index as a predictor 

of survival in adults with cystic fibrosis referred for lung transplant candidates. 


102. Madill, J., Maurer, J. R., and de Hoyos, A. (1993) A comparison of preoperative 

and postoperative nutritional states of lung transplant recipients. Transplantation 

56, 347–350. 

103. Ng, P., McCluskey, P., McCaughan, G., et al. (1998) Ocular complications of 

heart, lung, and liver transplantation. Br. J. Ophthalmol. 82, 423–428. 

104. Malouf, M. A., Chhajed, P. N., Jankelson, D., Aboyoun, C., Grunstein, R., and 

Glanville, A. R. (2001) Prevalence of sleep disordered breathing after lung transplantation. 

J. Heart Lung Transplant. 20, 225. 

105. Shea, S. A., Horner, R. L., Banner, N. R., et al. (1988) The effect of human 

heart-lung transplantation upon breathing at rest and during sleep. Respir. 

Physiol. 72, 131–149. 

106. Sanders, M. H., Costantino, J. P., Owens, G. R., et al. (1989) Breathing during 

wakefulness and sleep after human heart-lung transplantation. Am. Rev. Respir. 

Dis. 140, 45–51. 

107. Chhajed, P. N., Aboyoun, C., Malouf, M., et al. (2002) Management of acute 

hypoxaemia during flexible bronchoscopy with insertion of a nasopharyngeal 

tube in lung transplant recipients. Chest 121, 1350–1354. 

108. Goldstein, L. S., Haug, M. T., 3rd, Perl, J., 2,et al. (1998) Central nervous system 

complications after lung transplantation. J. Heart Lung Transplant. 17, 185–191. 

109. Cohen, L., Littlefield, C., Kelly, P., Maurer, J., and Abbey, S. (1998) Predictors 

of quality of life and adjustment after lung transplantation. Chest 113, 633–644. 

110. Imoto, E. M., Glanville, A. R., Baldwin, J. C., and Theodore, J. (1987) Kidney 

function in heart-lung transplant recipients: the effect of low-dosage cyclosporine 

therapy. J. Heart Transplant. 6, 204–213. 

111. Dumont, R. J., Partovi, N., Levy, R. D., Fradet, G., and Ensom, M. H. (2001) A 

limited sampling strategy for cyclosporine area under the curve monitoring in 

lung transplant recipients. J. Heart Lung Transplant. 20, 897–900. 

112. Burke, C. M., Theodore, J., Dawkins, K. D., et al. (1984) Post-transplant obliterative 

broncholitis and other late lung sequelae in human heart-lung transplantation. 

Chest 86, 824–829. 

113. Berry, G. J., Brunt, E. M., Chamberlain, D., et al. (1990) A working formulation 

for the standardization of nomenclature in the diagnosis of heart and lung rejection: 

Lung Rejection Study Group. The International Society for Heart Transplantation. 

J. Heart Transplant. 9, 593–601. 

114. Yousem, S. A., Berry, G. J., Cagle, P. T., et al. (1996) Revision of the 1990 

working formulation for the classification of pulmonary allograft rejection: Lung 

Rejection Study Group. J. Heart Lung Transplant. 15, 1–15.


115. Glanville, A. R., Baldwin, J. C., Burke, C. M., Theodore, J., and Robin, E. D. 

(1987) Obliterative bronchiolitis after heart-lung transplantation: apparent arrest 

by augmented immunosuppression. Ann. Intern. Med. 107, 300–304. 

116. Gerhadt, S. G., McDyer, J. F., Girgis, R. E., Conte, J. V., Yang, S. C.,and Orens, 

J. B, (2003) Maintenance azithromycin therapy for broncholitis obliterans syndrome: 

results of a pilot study. Am. J. Respir. Crit. Care Med. 168, 121–125. 

117. Luckraz, H., Goddard, M., McNeil, K., et al. (2004) Microvascular changes in 

small airways predispose to obliterative bronchiolitis after lung transplantation. 


118. Keller, C. A., Cagle, P. T., Brown, R. W., Noon, G., and Frost, A. E. (1995) 

Bronchiolitis obliterans in recipients of single, double, and heart-lung transplantation. 

Chest 107, 973–980. 

119. Girgis, R. E., Tu, I., Berry, G. J., et al. (1996) Risk factors for the development 

of obliterative bronchiolitis after lung transplantation. J. Heart Lung Transplant. 

15, 1200–1208. 

120. Heng, D., Sharples, L. D., McNeil, K., Stewart, S., Wreghitt, T., and Wallwork, 

J. (1998) Bronchiolitis obliterans syndrome: incidence, natural history, prognosis, 

and risk factors. J. Heart Lung Transplant. 17, 1255–1263. 

121. Sharples, L. D., Tamm, M., McNeil, K., Higenbottam, T. W., Stewart, S., and 

Wallwork, J. (1996) Development of bronchiolitis obliterans syndrome in recipients 

of heart-lung transplantation—early risk factors. Transplantation 61, 560– 

566. 

122. Husain, A. N., Siddiqui, M. T., Holmes, E. W., et al. (1999) Analysis of risk 

factors for the development of bronchiolitis obliterans syndrome. Am. J. Respir. 

Crit. Care Med. 159, 829–833. 

123. Trulock, E. P. (1997) Lung transplantation. Am. J. Respir. Crit. Care Med. 155, 

789–818. 

124. Glanville, A. R. (2000) Current and prospective treatments of obliterative bronchiolitis. 

Curr. Opin. Organ Transplant. 5, 396–401. 

125. Reynaud-Gaubert, M., Thomas, P., Badier, M., Cau, P., Giudicelli, R., and 

Fuentes, P. (2000) Early detection of airway involvement in obliterative bronchiolitis 

after lung transplantation. Functional and bronchoalveolar lavage cell 

findings. Am. J. Respir. Crit. Care Med. 161, 1924–1929. 

126. Zheng, L., Orsida, B. E., Ward, C., et al. (1999) Airway vascular changes in lung 

allograft recipients. J. Heart Lung Transplant. 18, 231–238. 

127. Jonosono, M., Fang, K., Keith, F., et al. (1999) Measurement of fibroblast proliferative 

activity in bronchoalveolar lavage fluid in the analysis of obliterative 

bronchiolitis among lung transplant recipients. J. Heart Lung Transplant. 18, 

972–985. 

128. Tamm, M., Roth, M., Malouf, M., et al. (2001) Primary fibroblast cell cultures 

from transbronchial biopsies of lung transplant recipients. Transplantation 71, 

337–339. 

129. Hostettler, K. E., Roth, M., Burgess, J. K., et al. (2004) Cyclosporine A mediates 

fibroproliferation through epithelial cells. Transplantation 77, 1886–1893.

130 Glanville 

130. Orens, J. B., Boehler, A., de Perrot, M., et al. (2003) A review of lung transplant 

donor acceptability criteria. J. Heart Lung Transplant. 22, 1183–1200. 

131. Estenne, M. Maurer, J. R., Boehler, A., et al. (2001) Bronchiolitis obliterans 

syndrome 2001: an update of the diagnostic criteria. J. Heart Lung Transplant., 

21, 297–310. 

132. Gabbay, E., Williams, T. J., Griffiths, A. P., et al. (1999) Maximising the utilization 

of donor organs offered for lung transplantation. Am. J. Respir. Crit. Care 

Med. 160, 265–271. 

133. Bhorade, S. M., Vigneswaran, W., McCabe, M. A., and Garrity, E. R. (2000) 

Liberalization of donor criteria may expand the donor pool without adverse consequence 

in lung transplantation. J. Heart Lung Transplant. 19, 1199–1204.

Chronic Rejection in the Heart 131 

5 

Chronic Rejection in the Heart 

Philip Hornick and Marlene Rose 

Summary 

The dramatic improvements in 1-yr survival following cardiac transplantation have 

not been matched by similar improvements in long-term graft survival. Long-term survival 

of allografted hearts is limited by a progressive fibroproliferative disease, resulting 

in intimal thickening and occlusion of the grafted coronary vessels. This disease, 

variously known as accelerated transplant coronary artery disease or cardiac graft 

vasculopathy, is also known as chronic rejection. The histology and clinical sequelae 

are briefly described. The disease can be thought of as a model for nontransplant atherosclerosis, 

postangioplasty restenosis, and vein graft atherosclerosis. There is compelling 

evidence that it is driven by alloantigen-dependent mechanisms. The evolution 

of the disease consists of three phases, an antibody-mediated phase, a cell-mediated 

phase, and a phase of tissue remodeling that is dependent on cytokines and growth 

factors. Experimental studies show that adoptive transfer of immunglobulin can transfer 

features of intimal hyperplasia to transplanted arteries in immunodeficient recipients. 

Damage to donor endothelium is likely to be an important initiating factor in this 

disease because it exposes a thrombogenic subendothelial matrix. Whether T cells of 

antibody are most important in damaging the endothelium is currently the subject of 

much research. Although T cells are sometimes present in atherosclerotic lesions, an 

association with acute rejection has never been consistently shown. 

Key Words: Rejection; graft vasculopathy; intimal hyperplasia; smooth muscle cells; 

endothelium; antibodies. 


Despite improvements in the short-term success rate of clinical organ transplantation 

during recent years, the rate of long-term graft attrition has remained 

constant (1–3). The progressive improvement in short-term patient and graft 

survival since the inception of organ transplantation is principally because of 

better immunosuppressive management of acute rejection episodes, improved 



131

132 Hornick and Rose 

diagnosis and treatment of infectious complications, more effective organ preservation, 

and improved donor selection. However, the acquisition of increasingly 

detailed knowledge of the immunobiology of rejection and more effective 

methods of immunosuppression have both failed to prolong the long-term functional 

survival of organ allografts as a result of chronic rejection. In this regard 

transplantation has not yet lived up to its potential as a long-term treatment for 

a lifetime disease. 

Chronic rejection may be defined as the progressive functional deterioration 

of transplanted tissue occurring months or years after engraftment. It is associated 

with vascular obliteration and other structural changes that lead gradually 

to organ fibrosis (2,4–6). The half-life of cadaveric renal transplants after the 

first year has elapsed has remained constant at 6–7 yr (1–3,7,8). 

Cardiac transplants exhibit graft arteriosclerosis, which produces a progressive 

luminal narrowing and obstruction in 40–45% of recipients at 5 yr following 

transplantation (9–12) and remains the leading cause of death after the first 

year has elapsed. The incidence of this vasculopathy has been cited as between 

15 and 20% of patients per year (9,11). 

Chronic rejection of the cardiac allograft is manifest by the development of 

transplant-associated coronary artery disease (TxCAD) and was first described 

in humans by Bieber et al. (13). It is similar to the type of proliferative vascular 

lesions observed in renal allografts with chronic vascular rejection (14,15). Its 

morphological characteristics differ from conventional coronary artery disease, 

although in its most advanced form it may resemble conventional non-transplant-associated 

atheroma (11). It can therefore act as a model for atherosclerosis 

in nontransplanted hearts, postangioplasty restenosis, and vein graft 

atherosclerosis. In recipients with TxCAD in the implanted donor allograft, the 

epicardial vessels can be palpated as firm and cord-like, often bulging onto the 

epicardial surface. Grossly, the cut surface of an epicardial vessel affected with 

TxCAD will contain orange or yellow gummous material (16). Although the 

term TxCAD invokes similarities with nontransplant atherosclerosis, conventional 

atherosclerotic lesions are focal, involve proximal bifurcations of the 

coronary vasculature, and are eccentric in their distribution (17). The lesions 

frequently contain calcium and disrupt the internal elastic lamina (17). Finally, 

even in patients with familial hyperlipidemia, the conventional atherosclerotic 

lesions develop over many years (18). TxCAD, however, tends to affect the 

epicardial arteries as well as the proximal parts of the intramyocardial arteries 

in a diffuse fashion, and less extensive changes have been described in coronary 

veins (19). The process involves the great arteries and venous structures 

up to but not beyond the transplant suture line (the division between donor and 

native tissue). In the early stages of the disease there is a diffuse, concentric 

intimal proliferation with preservation of the internal elastic lamina. The main


components of the intimal thickening are smooth muscle cells and endothelial 

cells (ECs), as well as cellular infiltrates consisting predominantly of fibroblasts, 

dendritic cells (DCs), macrophages, and T lymphocytes (CD4 and CD8) 

(16,20,21). Lipid-containing foam cells and later cholesterol clefts appear in a 

segmental fashion with eventual replacement of lesions very similar to those 

encountered in atherosclerotic plaques with occasional necrosis and secondary 

thrombosis. These late atheromatous lesions tend to be segmental, the internal 

elastic lamina is intact until only very late in the disease process, when it can 

be disrupted, and calcium deposition is occasional (11,16). Such lesions are 

almost always superimposed on the diffuse type of the disease and possibly 

represent a later stage or a different form of the disease (22). Some authors 

have described this as a superimposed “naturally occurring atherosclerosis”(23). 

The media of the affected arteries is usually normal or thin. Some 

patients develop extensive necrotising arteritis with destruction of all layers 

including the media and internal elastic lamina (20). TxCAD is exclusively 

limited to the allograft, and its progression is more rapid in comparison to conventional 

atheroma (9,11,24–26). Distal vessels are the earliest to occlude, presumably 

because of their smaller luminal area (19). TxCAD has been observed 

as early as 3 mo posttransplantation (16). 

The clinical manifestations of TxCAD result from perfusion failure and 

ischemia and include myocardial infarcts, arrhythmias, mitral regurgitation 

secondary to ischemia, heart failure, and sudden death (27). Angina pectoris, 

the classical sign of myocardial ischemia, is usually absent in the denervated 

cardiac allograft (28,29). 

The primary method by which TxCAD is diagnosed is by surveillance coronary 

angiography, with many centers performing this on at least an annual 

basis, with some performing routine postdischarge angiography in order to 

obtain baseline comparative information. It is also pertinent to note that current 

financial constraints have impinged on this practice, with some UK centers 

abandoning routine angiography altogether. Although coronary angiography 

is quite specific for nontransplant coronary atheromatous disease, it appears 

that it underestimates the presence of TxCAD due to its circumferential and 

diffuse nature, as well as the involvement of intramyocardial branches (30). 

The advent of intravascular ultrasound and its application to the assessment of 

TxCAD can show intimal thickening developing in the epicardial coronary 

arteries of cardiac allografts even in the face of a normal-appearing angiogram 

(31–35). 

The difficulty in the accurate assessment of TxCAD is further compounded 

the absence of effective therapy. Prevention remains the primary goal, which 

continues to be elusive despite advances in immunosuppression. The incidence 

of TxCAD does not appear to have been affected since the introduction of


cyclosporine alone or in combination with or without azathioprine and/or steroids 

(10,30,36–39), nor is TxCAD generally responsive to antilymphocyte 

antibody treatment (40), and in an animal model of transplantation FK506 has 

not been shown to affect the development of TxCAD (41). 

Invasive therapeutic options for focal nontransplant coronary atherosclerosis 

include coronary artery bypass grafting (CABG) and coronary angioplasty 

and ultimately heart retransplantation. Apart from anecdotal reports, CABG is 

generally not attempted due to the diffuse nature of TxCAD. Angioplasty is 

attempted more frequently because of the less invasive nature of this therapeutic 

modality and is reserved for the small numbers with higher-grade lesions 

superimposed on the generalized process (42). Ultimate improvement in prognosis 

is likely to be hampered by the rapidity of this diffuse and progressive 

process. The only definitive therapy for TxCAD is retransplantation (27). This 

raises obvious philosophical issues as well as concern as to whether patients 

who receive retransplants actually have an overall worse prognosis compared 

to first-time recipients (43). 

2. Mechanisms of Chronic Allograft Rejection, Antigenand 

Non-Antigen-Dependent Events in Chronic Rejection 

Although the designation of rejection implies a central role for immunological 

mechanisms in the histopathological changes responsible for TxCAD, 

the protracted time course allows the additional influence of other factors that 

are nonimmune in origin. Chronic rejection is undoubtedly a multifactorial 

disease. The vascular tissue bears characteristic changes of diffuse concentric 

intimal hyperplasia leading to progressive and obliterative vasculopathy. 

These changes may thus be regarded as the end result of immune and nonimmune 

interactions with the coronary vasculature, which also include responsive 

adaptations including tissue remodeling as part of a response to injury 

and tissue repair mechanisms in much the way Ross described in the context 

of conventional atheroma (50). 

3. Non-Antigen-Dependent Events 

in Chronic Cardiac Allograft Rejection 

Non-antigen-dependent factors thought to be important in the development 

of TxCAD are (1) those pertinent to the recipient, including the conventional 

risk factors for atherogenesis, namely, age, sex, obesity, hyperlipidemia, hypertension, 

smoking, and diabetes, as well as (2) pretransplant diagnosis, (3) donor 

age and sex, (4) immunosuppressive agents and protocols, (5) nonimmune endothelial 

injury (donor ischemic time and reperfusion injury), and (6) cytomegalovirus 

(CMV) infection (reviewed in ref. 51). In the main, the available data 

from major transplant centres are variable and somewhat conflicting (e.g., refs.


27,30,37,38,52–57; reviewed in ref. 51). The variability of such data is most 

likely the result of the limitations of the studies concerned as well as the fact that 

these studies are retrospective, include small patient numbers, and utilize coronary 

angiography for the detection of TxCAD. The most consistently described 

relationship is that between hyperlipidemia and TxCAD. The observation of a 

posttransplant lipid disorder is in part related to the fact that a high proportion of 

recipients suffer from this condition pretransplant and it was responsible for their 

preoperative diagnosis of ischemic cardiomyopathy. However, it appears most 

likely that obesity and the immunosuppressive agents prednisone and cyclosporine 

play a significant predisposing role in the development of posttransplant 

hyperlipidemia. 

4. Alloantigen-Dependent Events in Chronic Rejection 

Despite the foregoing, a consensus exists that TxCAD is primarily immune 

or alloantigen mediated. Any explanation for the pathogenesis of TxCAD must 

explain the preferential involvement of the engrafted vessels with sparing of 

the host’s native arteries. This suggests that some factors pertaining selectively 

to the allograft vasculature rather than some nonspecific consequence of the 

transplanted state must underlie the pathogenesis of TxCAD. An acquired dyslipidemia 

or acquired CMV infection alone would not account for selective 

involvement of the grafted vessels. Immunological mechanisms could explain 

arteriosclerosis in the engrafted arteries and veins with sparing of the native 

vessels as well as the rapid progression of TxCAD in comparison to conventional 

atherogenesis. The histopathological distinction with conventional 

atheroma suggests a different pathogenesis until at least late in the disease process. 

Non-antigen-dependent processes, e.g., dyslipidemias, may exacerbate 

the early immune-mediated injury and may play a more important role with 

prolonged allograft residence. In this regard, antigen-independent processes 

such as ischemia or other types of injury to the endothelium around the time of 

transplantation may also contribute to this process. 

5. Experimental Evidence for an Immune Basis for TxCAD 

Lurie et al. showed in a deliberately mismatched rat heart transplant model 

that almost all of the animals developed a proliferative vascular lesion within 

20 d (58). In a rabbit heterotopic heart transplant model, animals receiving 

high-cholesterol diets and those receiving a normal diet developed proliferative 

vascular lesions in the allograft to the same degree; however, fatty proliferative 

lesions developed only in the cholesterol-treated animals (59). These 

data would suggest that the proliferative lesion itself is independent of the lipid 

milieu, but when hyperlipidemia is present, this appears to affect the makeup 

of the vascular lesion.


A number of experimental approaches have provided more tangible evidence 

for the involvement of alloantigen-specific immune mechanisms in chronic 

rejection. Pretransplant immunization with donor splenocytes accelerated the 

rate of development and progression of TxCAD compared with nonimmunized 

recipients in a rat cardiac transplant model (60). Manipulations aimed at induction 

of donor-antigen unresponsiveness, such as pretransplant intrathymic 

inoculation of donor cells in combination with recipient lymphocyte ablation, 

resulted in a significant decrease in the extent and degree of TxCAD (61). The 

receptor-ligand pairs CD28-B7 and CD40-gp39 are essential for the initiation 

and amplification of T-cell-dependent immune responses (62,63). Larsen et al. 

(64) have shown that by blocking CD40 and CD28 costimulatory pathways, 

T-cell clonal expansion in vitro and in vivo promotes long-term survival of 

fully allogeneic skin grafts and inhibits the development of TxCAD. 

The evolution of chronic rejection in general and of the vascular lesions in 

particular has been conceptualized as consisting of three phases, an antibodymediated 

phase, a cell-mediated phase, and a phase of tissue remodeling that is 

largely dependent on cytokines and growth factors (65,66). 

Chronic rejection has long been considered an antibody-mediated phenomenon 

because anti-human leukocyte antigen (HLA) immunoglobulins, complement, 

and antiendothelial antibodies have been found in areas of vessel wall 

necrosis and intimal thickening (67), although it has also been suggested that 

this may be the result of altered vascular permeability (68). Recent studies in 

severe combined immune-deficient mice have shown that passive transfer of 

antidonor antibody causes TxCAD in long-standing cardiac allografts (69). The 

best established example of a contribution of humoral immunity to vascular 

complications of transplantation is hyperacute rejection, where preformed natural 

antibodies directed against determinants on the surface of the allogeneic 

ECs elicit an immediate complement-mediated injury that leads to acute thrombosis 

and immediate failure of the allograft (70). The generation of major histocompatibility 

complex (MHC)-derived or EC antibodies following engraftment 

might lead to a similar but less dramatic process on an ongoing basis. Sublytic 

injury of vascular cells by complement might promote the release of growth 

factors that could contribute to a fibroproliferative rather than a desquamative 

or necrotic process (71). In the 1970s Minick and Murphy demonstrated that 

antigen–antibody complexes can potentiate atherosclerosis as well as its development 

in cholesterol-fed rabbits (72). Shed alloantigen combining with host 

antibodies could furnish one source of antigen–antibody complexes. In the 

human the importance of anti-HLA and antiendothelial antibodies in the development 

of chronic rejection has been suggested by a number of groups (73– 

76). The precise significance of the initial wave of antibody deposition remains 

unknown, especially as such alloantibody formation is often associated with


cell-mediated rejection. In small-animal models of transplantation, the progression 

of vascular lesions is often associated with a decline or disappearance of 

detectable antidonor antibody titers. 

A clearer perspective on the relative contribution of the cells involved in 

alloantigen-mediated damage was shown by Shi et al. (77). In a mouse model 

of TxCAD in which carotid arteries were transplanted across multiple histocompatibility 

barriers into seven mutant strains with immunological defects, 

an acquired immune response with the participation of CD4 + (helper) T cells, 

antibody, and macrophages was essential to the development of the concentric 

neointimal proliferation and luminal narrowing characteristic of TxCAD. CD8 + 

(cytotoxic) T cells and natural killer cells were not involved in the process. 

Arteries allografted into mice deficient in both T-cell receptors and antibody 

showed almost no neointimal proliferation, whereas those grafted into mice 

deficient only in helper T cells, antibody, or macrophages developed small 

neointimas. These small neointimas and the large neointimas of control animals 

contained a similar number of inflammatory cells; however, smooth 

muscle cell number and collagen deposition were diminished in the small neointimas. 

The reduction in neointimal size in arteries allografted into mice deficient 

in helper T cells, antibody, or macrophages may be accounted for by a 

decrease in smooth muscle cell migration or proliferation. 

Despite the differences between TxCAD and conventional atherosclerosis, 

hypotheses regarding the pathogenesis of atherosclerosis may be qualitatively 

applicable to the transplantation scenario, with the differences being more 

quantitative. In this regard, Ross’s response-to-injury model is particularly 

attractive (50,78,79). This hypothesis states that the primary process is injury 

to ECs, which then leads to subsequent vascular damage. If the injury produces 

EC death and denudation, then the loss of local prostacyclin (PGI 2) 

production combined with the exposure of the thrombogenic subendothelial 

collagen matrix would lead to platelet aggregation and release of platelet factors 

such as platelet-derived growth factor (PDGF), which is a potent smooth 

muscle cell mitogen (17). Replacement of individually detached ECs by 

neighbouring ECs can result in a more subtle nondenuding form of injury 

(80,81). Although this type of injury may not have any morphological manifestations, 

it may result in increased permeability of the endothelial barrier, 

allowing constituents of plasma access to the subendothelial layers and 

increased uptake of plasma constituents (e.g., immunoglobulin) by the endothelium 

itself, or stimulate EC production of growth factors such as PDGF 

(17). Modifications to the endothelium such as those mentioned may occur 

when ECs are injured in a sublethal manner that does not result in replacement 

or morphological changes. In the case of TxCAD, it could be that one 

or more of the various forms of endothelial injury described results from an


immune response directed against allogeneic vascular endothelium, resulting 

in an atherosclerotic vascular response. 

6. Acute Rejection and TxCAD 

Because acute rejection episodes constitute one of the most frequent causes 

of profound tissue damage in the early posttransplant period, it is likely that 

they are among the most powerful events to initiate chronic rejection. Alloantigen-independent 

events factors such as prolonged ischemia, surgical manipulation, 

reperfusion injury, and lipid-mediated tissue injury may enhance 

antigen-dependent events either through upregulation of alloantigens and cell 

adhesion molecules or at the level of increased production of mediators common 

to various pathways of tissue injury. As indicated previously, there is 

compelling experimental evidence suggesting that chronic rejection is primarily 

allo-antigen driven and that immune mechanisms resulting in acute cardiac 

allograft rejection also contribute to the pathogenesis of TxCAD. 

However, in clinical cardiac transplantation the association between acute 

rejection and TxCAD remains controversial. Studies that have attempted to 

clarify the relationship between acute rejection and TxCAD have produced 

conflicting results. Whereas a positive correlation was found in some studies 

(27,55,82–84), others have been unable to confirm a direct correlation of 

TxCAD with biopsy-diagnosed rejection, incidence, or severity (30,35,55,85– 

87). Limitations to these studies include the fact that they are all retrospective 

and include small patient numbers, the use of varying grades of severity of 

biopsy-proven clinical rejection, and, in most cases, angiographic detection of 

coronary arterial abnormalities. Furthermore, prophylactic and maintenance 

immunosuppressive regimes vary among patients within each study and between 

studies. Acute rejection that merits treatment varies according to the immunosuppressive 

policy of the particular transplant center, and accordingly some 

series focus on International Society for Heart and Lung Transplantation 

(ISHLT) grade 3A (88) or above as being clinically significant. The policy at 

Harefield Hospital (United Kingdom) of minimizing the long-term use of steroids 

in maintenance immunosuppression has led to the view that mild diffuse 

disease (ISHLT 1B) should be treated with a brief course of intravenous steroids. 

This center and others (87) therefore regard grade 1B as clinically significant, 

particularly because recurrent mild episodes may insidiously damage 

vascular endothelium. In a study by Winters et al. (38), the number of previous 

clinically treated (moderate or severe) rejection episodes only weakly correlated 

with percent luminal narrowing demonstrated by digitized video-image 

analysis. However, if the total number of rejection episodes was analyzed 

(including even minimal rejection that normally would not be treated), the difference 

in percent luminal narrowing between patients having fewer versus


those having more rejection episodes became highly significant. As acute cellular 

rejection diminishes dramatically over time (19), the practice of most 

centers is to reduce the dose of all immunosuppressive agents over the first 

year after transplantation in order to reduce toxic side effects. Although this 

may be quite reasonable for the prevention of acute cellular rejection, it may 

not be the correct approach for TxCAD. Moreover, mild subclinical cellular 

rejection episodes may still substantially contribute to TxCAD development 

and/or progression. Finally, TxCAD in all of these studies is considered as 

being either present or absent. However, stratification on the basis of time when 

TxCAD developed may help to apportion both immunological and nonimmunological 

risk factors more appropriately. 

References 

1. Paul, L. and Benediktsson, H. (1993) Chronic transplant rejection, magnitude of 

the problem and pathogenetic mechanisms. Transplant Rev. 7, 96–113. 

2. Hayry, P., Isoniemi, H., Yilmaz, S., Mennander, A., Lemstrom, K., Raisanen- 

Sokolowski, A., et al. (1993) Chronic allograft rejection. Immunol. Rev. 134, 33– 

81. 

3. Tilney, N., Schmid, C., Azuma, H., and Heemann, U. (1994) Transplantation 

immunology: an introduction. Transplant. Immunol. 2, 99–102. 

4. Azuma, H., and Tilney, N. (1994) Chronic graft rejection. Curr. Opin. Immunol. 

6, 770–776. 

5. Adams, H., Russell, M., Hancock, W., Sayegh, M., Wyner, L., and Karnovsky, 

M. (1993) Chronic rejection in experimental cardiac transplantation: studies in 

the Lewis-F344 model. Immunol. Rev. 143, 5–19. 

6. Ewel, C. and Foegh, M. (1993) Chronic graft rejection: accelerated transplant 

arteriosclerosis. Immunol. Rev. 134, 21–31. 

7. Schweitzer, E., Matas, A., Gillingham, K., et al. (1991) Causes of renal allograft 

loss. Ann. Surg. 214, 679–688. 

8. Cook, D. (1987) Long term survival of kidney allografts, in (Terasaki, P., ed.) 

Clinical Transplants, Los Angeles, UCLA Tissue Typing Laboratory. 

9. Uretsky, B., Murali, S., Reddy, P., Rabin, B., Lee, A., Bartley, P., et al. (1987) 

Development of coronary artery disease in cardiac transplant patients receiving 

immunosuppressive therapy with cyclosporin and prednisolone. Circulation 76, 

827–833. 

10. Gao, S., Schroeder, J., Alderman, E., Hunt, S., Valantine, H., Wiederhold, V., et 

al. (1989) Prevalence of accelerated coronary artery disease in heart transplant 

survivors, comparison of cyclosporin and azathioprine regimens. Circulation 80 

(Suppl. III), 100–105. 

11. Billingham, M. (1987) Cardiac transplant atherosclerosis. Transplant. Proc. 19 

(Suppl. 5),19–25. 

12. Billingham, M. (1989) Graft coronary disease: the lesions and the patients. Transplant. 

Proc. 21, 3665–3666.


13. Bieber, C., Stinson, E., Shumway, N., Payne, R., and Kosek, J. (1970) Cardiac transplantation 

in man, VII, Cardiac allograft pathology. Circulation 41, 753–779. 

14. Porter, K., Thomson, W., Owen, K., Kenyon, J., Mowbray, J., and Peart, W. 

(1963) Obliterative vascular changes in four human kidney homotransplants. Br. 

Med. J. II, 639–645. 

15. Busch G, Galvanek E, and Reynolds E. (1971) Human renal allografts. Hum 

Pathol 2, 253–298. 

16. Billingham, M. (1997) Graft coronary disease: old and new dimensions. Cardiovasc. 

Pathol. 6, 95–101. 

17. Ross, R. (1986) Factors influencing atherogenesis, in (Hurst, J., ed.) The Heart 

New York, McGraw-Hill, pp. 801–815. 

18. Gotto, A. and Farmer, J. (1988) Risk factors for coronary artery disease, in 

(Braunwald, E., ed.) Heart Disease Philadelphia, WB Saunders Inc., pp. 1153–1190. 

19. Hosenpud, J., Shipley, J., and Wagner, C. (1992) Cardiac allograft vasculopathy, 

Current concepts, recent developments and future directions. J Heart Lung Transplant. 

11, 9–23. 

20. Hruban, R., Beschorner, W., Baumgartner, W., Austine, S., Ren, H., and Reitz, B. 

(1990) Accelerated arteriosclerosis in heart transplant recipients is associated with 

a T-lymphocyte-mediated endothelialitis. Am. J. Pathol. 137, 871. 

21. Usy, C. and Rose, A. (1983) Cardiac transplantation, aspects of the pathology. 

Pathol. Annu. 17, 147. 

22. Yacoub, M. and Rose, M. (1993) Accelerated coronary sclerosis, in (Rose, M. 

and Yacoub, M., eds.) Immunology of Heart and Lung Transplantation, London, 

Edward Arnold, pp. 289–299. 

23. Pucci, A., Forbes, C., and Billingham, M. (1990) Pathologic features in long term 

cardiac allografts. J. Heart Transplant. 9, 339–345. 

24. Gao, A., Alderman, E., Schroeder, J., Silverman, .J, and Hunt, S. (1988) Accelerated 

coronary vascular disease in the heart transplant patient, coronary 

arteriographic findings. J. Am. Coll. Cardiol. 12, 334–340. 

25. Hess, J., Hastillo, A., Mohanakumar, T., Cowley, M., Vetrovac, G., Szentpetery, 

S., et al. (1983) Accelerated atherosclerosis in cardiac transplantation, role of 

cytotoxic B-cell antibodies and hyperlipidaemia. Circulation 68(Suppl. 2), 94– 

101. 

26. Zerbe, T., Uretsky, B., Kormos, R., Armitage, J., Wolyn, T., Groffith, B., et al. 

(1992) Graft atherosclerosis: effects of cellular rejection and human lymphocyte 

antigen. J. Heart Lung Transplant. 11, S104–110. 

27. Gao, S., Schroeder, J., Hunt, S., and Stinson, E. (1988) Retransplantation for 

severe accelerated coronary artery disease in heart transplant recipients. Am. J. 

Cardiol. 62,.876. 

28. Stark, R., McGinn, A., and Wilson, R. (1991) Chest pain in cardiac transplant 

recipients, evidence of sensory reinnervation after cardiac transplantation. N. Engl. 

J. Med. 234, 1791–1794. 

29. Vora, K., Hosenpud, J., Ray, J., et al. (1991) Angina pectoris in a cardiac allograft 

recipient. Clin. Transplant. 5, 20–22.


30. Gao, S., Schroeder, J., Alderman, E., Hunt, S., Siverman, J., Wiederhold, V., et al. 

(1987) Clinical and laboratory correlates of accelerated coronary artery disease in 

the cardiac transplant patient. Circulation 76, 56–61. 

31. Schroeder, J., Gao, S., Hunt, S., and Stinson, E. (1992) Accelerated graft coronary 

artery disease: diagnosis and prevention. J. Heart Lung Transplant. 11(Suppl.), 

258–265. 

32. St. Goar, F., Pinto, F., Alderman, E., et al. (1992) Intracoronary ultrasound in 

cardiac transplant recipients. In vivo evidence of “angiographically silent” intimal 

thickening. Circulation 85, 979–987. 

33. Ventura, H., Ramee, S., Jain, A., et al. (1992) Coronary artery imaging with intravascular 

ultrasound in patients following cardiac transplantation. Transplantation 

53, 216–219. 

34. Rickenbacher, P., Pinto, F., Chenzbraun, A., et al. (1992) Incidence and severity 

of transplant artery disease early and up to 15 years after transplantation as 

detected by intravascular ultrasound. J. Am. Coll. Cardiol. 25, 171–177. 

35. Rickenbacher, P., Kemna, M., Pinto, F., Hunt, S., Alderman, E., Schroeder, J., et 

al. (1996) Coronary artery intimal thickening in the transplanted heart. Transplantation 

61, 46–53. 

36. Kirkman, R., Strom, T., Weir, M., and Tilney, N. (1982) Late mortality and morbidity 

in recipients of long-term allografts. Transplantation 34, 347–351. 

37. Olivari, M., Homans, D., Wilson, R., Kubo, S., and Ring, W. (1989) Coronary 

artery disease in cardiac transplant patients receiving triple-drug immunosuppressive 

therapy. Circulation 80(Suppl.), 111–115. 

38. Winters, G., Kendall, T., and Radio, S. (1990) Post-transplant obesity and 

hyperlipidaemia, major predictors of severity of coronary arteriopathy in failed 

human allografts. J. Heart Transplant. 9, 364. 

39. Hess, M., Hastillo, A., Thompson, J., et al. (1987) Lipid mediators in organ transplantation: 

does cyclosporin accelerate coronary atherosclerosis? Transplant 

Proc. 19(Suppl. 5), 71–73. 

40. Paul, L. and Fellstrom, B. (1992) Chronic vascular rejection of the heart and the 

kidney, have rational treatment options emerged? Transplantation 53, 1169–1179. 

41. Arai, S., Okada, M., Morimoto, T., Hisamochi, K., Senoo, Y., and Teramoto, S. 

(1991) The impact of FK506 on graft coronary disease and graft infiltrating lymphocyte 

subsets following rat heart transplantation, comparison with cyclosporin 

A [abstract]. J. Heart Lung Transplant. 10, 175. 

42. Vetrovec, G., Cowley, M., Newton, C., et al. (1988) Applications of percutaneous 

transluminal angioplasty in cardiac transplantation. Preliminary results in five 

patients. Circulation 78(Suppl. III), 83–86. 

43. Karwande, S., Ensley, R., and Renlund, D. (1992) Cardiac retransplantation: a 

viable option? Ann. Thorac. Surg. 54, 840–844. 

44. Jamieson, S., Oyer, P., and Baldwin, J. (1984) Heart transplantation for end-stage 

ischemic heart disease, The Stanford experience. Heart Transplant 3, 224–227. 

45. Kaye, M. (1993) The registry of the international society for heart and lung transplantation, 

Tenth official report—1993. J. Heart Lung Transplant. 12, 541–548.


46. Sarris, G., Moore, K., and Schroeder, J. (1994) Cardiac transplantation: the Stanford 

experience in the cyclosporin era. J. Thorac. Cardiovasc. Surg. 108, 240. 

47. Hosenpud, J. (1996) The Registry of the International Society for Heart and Lung 

Transplantation: Thirteenth Official Report. J. Heart Lung Transplant. 15, 655. 

48. Evans, R., Orians, C., and Ascher, N. (1992) The potential supply of organ donors: 

an assessment of the efficacy of organ procurement efforts in the United States. 

JAMA 267, 239. 

49. Baumgartner, W., Augustine, S., and Borkon, A. (1987) Present experience in 

cardiac transplantation. Ann. Thorac. Surg. 6, 585. 

50. Ross, R. (1993) The pathogenesis of atherosclerosis, a perspective for the 1990s. 

Nature 362, 801–809. 

51. Johnson, M. (1993) Transplant coronary disease, non-immunologic risk factors. 

J. Heart Lung Transplant. 11(Suppl.), 124–132. 

52. Pahl, E., Fricker, F., Armitage, J., et al. (1990) Coronary arteriosclerosis in pediatric 

heart transplant survivors, limitation of long-term survival. J. Pediatr. 116, 

177–183. 

53. Eich, D., Thompson, J., Daijin, K., et al. (1991) Hypercholesterolaemia in longterm 

survivors of heart transplantation, an early marker of accelerated coronary 

artery disease. J. Heart Lung Transplant. 10, 45–49. 

54. Sharples, L., Caine, N., Mullins, P., et al. (1991) Risk factor analysis for the major 

hazards following heart transplantation—rejection, infection, and coronary occlusive 

disease. Transplantation 52, 244. 

55. Gao, S., Schroeder, J., Hunt, S., Valantine, H., Hill, I,, and Stinson, E. (1993) 

Influence of graft rejection on incidence of accelerated graft coronary artery disease: 

a new approach to analysis. J. Heart Lung Transplant. 12, 1029. 

56. McDonald, K., Rector, T., Braulin, E., Kubo, S., and Olivari, M. (1989) Association 

of coronary artery disease in cardiac transplant recipients with cytomegalovirus 

infection. Am. J. Cardiol. 64, 359. 

57. Barbir, M., Kushwaha, S., Hunt, B., Macken, A., Thomson, G., Mitchell, A., et al. 

(1992) Lipoprotein (a) and accelerated coronary artery disease in cardiac transplant 

patients. Lancet 340, 1500–1502. 

58. Lurie, K., Billingham, M., Jamieson, S., Harrison, D., and Reitz, B. (1981) Pathogenesis 

and prevention of graft arteriosclerosis in an experimental heart transplant 

model. Transplantation 31, 41–47. 

59. Alonso, D., Starek, P., and Minick, C. (1977) Studies on the pathogenesis of 

atheroarteriosclerosis induced in rabbit cardiac allografts by synergy of graft rejection 

and hypercholesterolaemia. Am. J. Pathol. 87, 265–292. 

60. Cramer, D., Chapman, F., Wu, G., Harnaha, J., Quian, S., and Makowka, L. (1990) 

Cardiac transplantation in the rat. II. Alteration of the severity of donor graft arteriosclerosis 

by modulation of the host immune response. Transplantation 50, 554– 

558. 

61. Shin, Y., Adams, D., Wyner, L., Akalin, E., Sayegh, M., and Karnovsky, M. 

(1995) Intrathymic tolerance in the Lewis-to-F344 chronic cardiac allograft rejection 

model. Transplantation 59, 1647–1653.


62. Bluestone, J. (1995) New perspectives of CD28-B7-mediated costimulation. Immunity 

2, 555–559. 

63. Banchereau, J., et al. (1994) The CD40 antigen and its ligand. Ann. Rev. Immunol. 

12, 881–922. 

64. Larsen, C., Elwood, E., Alexander, D., Ritchie, S., Hendrix, R., Tucker-Burden, 

C., et al. (1996) Long-term acceptance of skin and cardiac allografts after blocking 

CD40 and CD28 pathways. Nature 381, 434–438. 

65. Fellstom, B., Larsson, E., and Tufveson, G. (1989) Strategies in chronic rejection 

of transplanted organs: a current view on pathogenesis, diagnosis and treatment. 

Transplant Proc. 21, 1435–1439. 

66. Foegh, M. (1990) Chronic rejection-graft arteriosclerosis. Transplant. Proc. 22, 

119–122. 

67. Taylor, D., Ibrahim, H., Tolman, D., and Hess, M. (1991) Accelerated coronary 

arteriosclerosis in cardiac transplantation. Transplant. Rev. 5, 165–174. 

68. Higgy, N., Davidoff, A., Grothman, G., Hollenberg, M., Benediktsson, H., and 

Paul, L. (1991) Platelet derived growth factor–receptor expression in rat heart 

allografts. J. Heart Lung Transplant. 10, 5135–5141. 

69. Russell, P., Chase, C., Winn, H., and Colvin, R. (1994) Coronary atherosclerosis 

in transplanted rat heart. II. The importance of humoral immunity. J. Immunol. 

152, 389–398. 

70. Dalmasso, A., Vercellotti, G., Fischel, R., Bolman, R., Bach, F., and Platt, J. 

(1992) Mechanisms of complement activation in the hyperacute rejection of 

porcine organs transplanted into primate recipients. Am. J. Pathol. 140, 1157– 

1166. 

71. Benzaquen, L., Nicholson-Weller, A., and Halperin, J. (1994) Terminal complement 

proteins C5b-9 release fibroblast growth factor and platelet derived growth 

factor from endothelial cells. J. Exp. Med. 179, 985–992. 

72. Minick, C. and Murphy, G. (1973) Experimental induction of arteriosclerosis by 

the synergy of allergic injury to arteries and lipid-rich diet. II. Effect of repeatedly 

injected foreign protein in rabbits fed a lipid-rich cholesterol-poor diet. Am. J. 

Pathol. 73, 265–300. 

73. Dunn, M., Crisp, S., Rose, M., Taylor, P., and Yacoub, M. (1992) Anti-endothelial 

antibodies and coronary artery disease after cardiac transplantation. Lancet 

339, 1566–1570. 

74. Crisp, S., Dunn, M., Rose, M., Taylor, P., and Yacoub, M. (1994) Anti-endothelial 

antibodies after heart transplantation, The accelerating factor in transplant 

associated coronary artery disease. J. Heart Lung Transplant. 13, 81–92. 

75. Suciu-Foca, N., Reed, E., Marboe, C., Harris, P., Yu, P., Sun, Y., et al. (1991) 

The role of anti-HLA antibodies in heart transplantation. Transplantation 51, 

716–724. 

76. Reed, E., Hong, B., Ho, E., Harris, P., Weinberger, J., and Suciu-Foca ,N. (1996) 

Monitoring of soluble HLA alloantigens and anti-HLA antibodies identifies heart 

allograft recipients at risk of transplant-associated coronary artery disease. Transplantation 

61, 566–572.


77. Shi, C., Lee, W., He, Q., Zhang, D., Fletcher, Jr., D., Newell, J., et al. (1996) 

Immunologic basis of transplant-associated arteriosclerosis. Proc. Natl. Acad. Sci. 

USA 93(9), 4051–4056. 

78. Ross, R. and Glomset, J. (1976) The pathogenesis of atherosclerosis. N. Engl. J. 

Med. 295, 369–420. 

79. Ross, R. (1986) The pathogenesis of atherosclerosis, an update. N. Engl. J. Med. 

314, 488–500. 

80. Reidy, M. and Schwartz, S. (1981) Endothelial injury and regeneration. III. Time 

course of intimal changes after small defined injury to rat aortic endothelium. 

Lab. Invest. 44, 301–308. 

81. Reidy, M. and Schwartz, S. (1983) Endothelial injury and regeneration. IV. Endotoxin, 

a non-denuding injury to aortic endothelium. Lab. Invest. 48, 24–34. 

82. Narrod, J., Kormos, R., Armitage, J., Hardesty, R., Ladowski, J., and Griffith B. 

(1989) Acute rejection and coronary artery disease in long-term survivors of heart 

transplantation. J. Heart Transplant. 5, 418–421. 

83. Radnovancevic, B, Poindexter, S, Birovljev, S, et al. (1990) Risk factors for development 

of accelerated coronary artery disease in cardiac transplant patients. Eur. J. 

Cardiothorac. Surg. 4, 309. 

84. Schutz, A., Kemkes, B., Kugler, C., et al. (1990) The influence of rejection episodes 

on the development of accelerated coronary artery disease after heart transplantation. 

Eur. J. Cardiothorac. Surg. 4, 309. 

85. Ratkovec, R., Wray, R., Renlund, D., et al. (1990) Influence of corticosteroid-free 

maintenance immunosuppression on allograft coronary disease: a new approach 

to analysis. J. Thora.c Cardiovasc. Surg. 100, 6. 

86. Stovin, P., Sharples, P., Hutter, J., Wallwork, J., and English, T. (1991) Some 

prognostic factors of the development of transplant-related coronary artery disease 

in human cardiac allografts. J. Heart Lung Transplant. 1, 38–44. 

87. Stovin, P., Sharples, L., Schofield, P., Cary, N., Mullins, P., English, T., et al. 

(1993) Lack of association between endomyocardial evidence of rejection in the 

first six months and the later development of transplant coronary artery disease. J. 

Heart Lung Transplant. 12, 110–116.

Direct and Indirect Allorecognition 145 

6 

Direct and Indirect Allorecognition 


Summary 

The design and effectiveness of strategies to promote long-term graft acceptance 

requires a fundamental understanding of the mechanisms underlying acute and chronic 

rejection. This chapter discusses the two pathways of allorecognition—direct and 

indirect—and suggests that the direct pathway plays a major role in the early weeks 

after transplantation and that the indirect pathway may contribute to the process of 

chronic rejection. The results of in vitro and in vivo experimental models are discussed, 

together with clinical data. 

Key Words: Direct allorecognition; indirect allorecognition; chronic rejection; acute 

rejection. 


One of the most striking features of the T-cell response provoked by major 

histocompatibility complex (MHC)-incompatible cells is its vigor. This is 

reflected by the mixed leukocyte reaction (MLR) in vitro (1) and in vivo by 

the rejection of solid organ transplants and graft-vs-host disease in recipients 

of allogeneic bone marrow transplants. Indeed, it was the very strength of the 

alloresponse that led to the discovery of MHC molecules and their products, 

which were first designated “transplantation antigens.” The strength of this 

response is accounted for by the uniquely high precursor frequency of T cells 

with specificity for allogeneic MHC molecules. This feature of the alloresponse 

was first detected by Skinner and Marbrook (2) and Fischer-Lindahl 

and Wilson (3) for class I-reactive T cells. 

Direct allorecognition is defined as the recognition by recipient T cells of 

the intact MHC alloantigens displayed at the surface of donor (dendritic) cells 

carried within the graft. No other cells intervene in this initial step of the direct 

pathway. 



145

146 Hornick 

Any discussion pertaining to the direct recognition of allogeneic cells needs 

initially to focus on two fundamental issues: (1) the high precursor frequency 

of alloreactive T cells that recognize allogeneic MHC molecules and (2) the 

fact that the rules of self-MHC restriction are apparently disregarded in the 

direct binding of the T-cell receptor (TCR) to the allogeneic MHC molecules. 

T-cell precursor frequencies of 1:10 3 –10 4 have frequently been recorded 

against foreign MHC molecules compared with 1:10 5 or less for nominal, antigen-specific, 

self-MHC restricted T cells. It appears that recognition of nominal 

antigen in the context of self-MHC molecules and the recognition of 

alloantigen is not by two distinct T-cell populations, but rather by an overlapping 

population. T-cell clones have been generated that recognize nominal 

antigen in a self-MHC restricted fashion and cross-react on allogeneic cells 

(4,5). It has further been shown that approximately half of the cells involved in 

generating an alloresponse have been primed previously to nominal antigen 

(6). The precise nature of the ligand recognized by the alloreactive T cells still 

remains unclear. There are two main hypotheses, which make very different 

assumptions about the nature of the ligand bound by the alloreactive T cells. 

The multiple binary complex hypothesis was proposed by Matzinger and 

Bevan in 1977 (7). This hypothesis proposes that the antigen-binding grooves 

of the MHC molecules expressed on normal cells are occupied with an extreme 

diversity of peptides derived from the processing of serum and cellular proteins, 

presented with class I or class II MHC molecules. Alloreactive T cells 

are specific for individual complexes of MHC and peptide, as are nominal 

antigen-specific T cells. As a consequence, a single allogeneic MHC molecule 

will be able to stimulate a large number of different T-cell clones, each with a 

distinct peptide, MHC specificity, and hence account for the high precursor 

frequency. 

The second hypothesis, proposed by Bevan, is referred to as the high-determinant-density 

hypothesis (8). It proposes that the attention of the alloreactive 

T cell’s receptor is focused on the exposed residues of the allogeneic MHC 

molecule that differ from the responder, whether the antigen-binding site of 

the molecule is occupied or not. If the specificity of the alloreactive T cell is 

for the allogeneic MHC molecule itself, then in theory all foreign MHC molecules 

of any given isotype (e.g., human leukocyte antigen [HLA]-DR) displayed 

by the allogeneic stimulator cell could act as ligands for the alloreactive 

responder T cell. The implication of this hypothesis becomes obvious when 

the total number of MHC molecules, i.e., ligand density, is compared to the 

ligand density available to an antigen-specific T cell. This issue has been 

addressed by Harding and Unanue (9). Following the internalization, processing, 

and presentation of an antigen by a class II-expressing antigen-expressing 

cell (APC), it is probable that only a small fraction, probably


class II molecules will be occupied with the particular peptide for which the T 

cell is specific. It follows that there may be a 100-fold higher number of 

ligands or determinant density per cell available for the alloreactive T cell 

than is available to an antigen-specific T cell. The corollary of this is that cells 

of lower affinity than is required for an antigen-specific response may be 

called into the alloreactive repertoire such that T cells with low and medium 

as well as high affinity for the allo-MHC molecule could lead to the generation 

of a high precursor frequency. 

In order to understand fully the phenomenon of direct allorecognition, this 

now needs to be accommodated within the framework of a T-cell repertoire 

that has been positively selected to recognize peptide in the context of self- 

MHC. 

At face value the foregoing discussion appears to break the rules of self- 

MHC restriction, but the two hypotheses to account for the high precursor frequency 

of alloreactive T cells can be accommodated within the context of 

self-MHC restriction. This is easiest to envisage where responder and stimulator 

MHC molecules are similar, sharing conserved sequences in the exposed 

TCR-contacting surface of the molecule. Differences in the peptide-binding 

groove allow binding and display of different sets of peptides (10). The alloresponse 

is thus directed to the multiplicity of different peptides bound by the 

MHC molecule. When the exposed surfaces of the responder and stimulator 

MHC molecules are substantially different, the alternative, high-determinantdensity 

hypothesis may provide a better explanation for the observed strength 

of the alloresponse. In order to reconcile this with self-MHC restriction, it only 

needs to be suggested that a small fraction of T cells whose receptors were 

selected for self-MHC recognition cross-react, by chance, with a foreign MHC 

structure. Given the bias that appears to exist in TCR genes for MHC recognition 

(11), this is likely to occur in structurally dissimilar responder, stimulator 

combinations with sufficient frequency to account for the numbers of 

alloreactive T cells identified by limiting dilution analysis. 

It has long been assumed that the in vitro MLR correlates with acute transplant 

rejection. Until recently it had not been shown that T cells with exclusive 

direct allospecificity can effect acute rejection. Pietra et al. (12) reconstituted 

severe combined immunodeficiency mice (SCID) with syngeneic CD4 + T cells. 

This led to rejection of MHC class II-expressing heart grafts, but not MHC 

class II-deficient grafts. Moreover, they were also able to show that SCID mice, 

also MHC class II deficient, rejected allogeneic grafts when reconstituted with 

CD4 + T cells. Because these mice had no CD8 + cells and no MHC class IIexpressing 

APCs, direct cytotoxic and indirect allorecognition would not have 

occurred. Thus, CD4 + cells were both necessary and sufficient to mediate allograft 

rejection.

148 Hornick 

2. Observations of Direct Pathway Hyporesponsiveness 

In vitro primed donor-specific direct pathway alloreactive T-helper (Th) cells 

have been found to induce acute graft rejection when adoptively transferred 

into irradiated recipients that had been transplanted with an allogeneic kidney. 

Rejection occurred only in the presence of donor genotype dendritic cells (DCs) 

(13). However, in animals bearing an established graft, the renal parenchymal 

cells were unable to reactivate the alloreactive T cells. These results indicate 

that while direct alloreactive T cells play a dominant role in acute rejection, in 

the absence of donor DCs, T-cell hyporesponsiveness can occur. 

Direct alloreactive T cells are primed in the spleen and draining lymph nodes 

following the migration and maturation of donor DCs (14). Effector functions 

are carried out by CD8 + cytotoxic T lymphocytes (CTLs) within the graft without 

necessarily further input from Th or DCs. While cytokines secreted by Th 

cells will facilitate the initial stages of clonal expansion of the CD8 + compartment, 

thus amplifying the rejection response, thereafter CD8 + cells are likely to 

be autonomous in their activity (15). Th cells can initiate antibody production at 

sites distant from the allograft by allospecific B cells. Delayed-type hypersensitivity 

(DTH) responses may be orchestrated by Th cells that have infiltrated the 

graft having left the recipient lymphoid tissue. Here, primed or memory antigenspecific 

CD4 + cells may be activated by immature donor DCs that still persist 

within the graft. Such activation has been demonstrated in vitro (16), and memory 

T-cell activation by antigen-loaded, immature tissue DCs may be one mechanism 

by which secondary antigen-specific responses are initiated very quickly 

(17). It would thus appear that for the allograft, MHC-expressing, immature DCs 

within the graft may play an important role as immunogenic targets for activated 

CD4 + cells. The eventual replacement of donor DCs by recipient interstitial DCs 

(18) and the apparent paucity of cells capable of stimulating direct allorecognition 

left within the graft and their potential for inducing anergy is likely to account for 

the hyporesponsiveness of direct pathway T cells in the experimental systems 

thus far examined. 

3. Clinical Correlates of Donor-Specific Hyporesponsiveness 

In recipients receiving immunosuppression, episodes of acute rejection become 

less frequent and less destructive with the passage of time following transplantation, 

while the progression of chronic rejection remains unaffected (19). 

Limiting dilution techniques specific for the direct pathway have been utilized 

to estimate recipient, antidonor Th and CTL frequencies in patients who 

have chronic rejection. Following preliminary investigations by Deacock and 

Lechler (20), Mason et al., utilizing a range of B-lymphoblastoid cell lines 

expressing donor DR antigens have been able to show donor-specific hyporesponsiveness 

in some patients with chronic renal failure (21). Such findings


are important because they indicate that for humans as for rodents, the prolonged 

residence of an allograft can induce donor-specific hyporesponsiveness 

in T cells with direct allospecificity. These findings also suggest that chronic 

rejection can progress despite such hyporesponsiveness. 

Chronic rejection is under the influence of alloantigen-dependent and nonalloantigen-dependent 

factors. The importance of HLA matching, acute graft 

rejection, rapid progression in allogeneic as compared to syngeneic grafts, as 

well as more tangible experimental evidence (22–24), points to a determining 

role for alloantigen-dependent processes. Direct allorecognition is likely to be 

an important event in the initiation of chronic rejection in that the clinical 

picture in the early posttransplant period is dominated by tissue damage caused 

by episodes of acute rejection. However, chronic rejection may occur in the 

absence of previous episodes of acute rejection (25), and the observation of 

direct pathway hyporesponsiveness following graft residence and depletion 

of donor DCs mitigates against this pathway being a driving force in the progression 

of chronic rejection. 

4. Indirect Allorecognition 

Tangible evidence for a second route of allorecognition was provided by 

retransplantation experiments in a rat model. Lechler and Batchelor observed 

that MHC-incompatible kidney allografts depleted of indigenous passenger leukocytes 

(by “parking” kidneys in enhanced hosts) were permanently accepted 

without immunosuppression in certain donor/recipient combinations, but in others 

suffered rejection (26). This second route for the recognition of allogeneic 

MHC is known as the indirect pathway, whereby allogeneic MHC molecules 

and/or other donor alloantigens are processed and presented by recipient APCs. 

This is the normal mechanism of T-cell stimulation by nominal antigens, i.e., as 

processed peptides associated with self (recipient)-MHC class II molecules. 

Alloantigens shed from a graft will in general be treated as exogenous antigens 

by recipient APCs, leading to a dominance of Th cells recognizing allopeptides 

bound to MHC self class II molecules. The observations made thus far indicate 

that T cells sensitized by the direct pathway might initially dominate the rejection 

process occurring in nonimmune recipients, but that T cells sensitized by 

indirect allorecognition might contribute substantially to continuing long-term 

or chronic graft damage after the allograft has lost its DC population (26) and 

direct alloreactive T cells have been rendered hyporesponsive. 

5. Evidence for Indirect Allorecognition in Small Mammalian Models 

In a murine system, Benichou et al. (27) showed that T cells collected from 

mice that had been sensitized by allogeneic splenocyte infusion or skin grafting 

proliferated to synthetic peptides derived from the polymorphic regions of

150 

150 Hornick


the α and β chains of the allogeneic class II MHC molecule presented by host 

APCs. 

Peptide immunization of allogeneic MHC antigens has been shown to hasten 

the rate of graft rejection for skin and kidney allografts (28, 29). Perhaps the 

most compelling evidence showing that an indirect response could initiate allograft 

rejection was generated once MHC class II-deficient knockout mice were 

generated by targeted gene disruption (30). Since grafts from these mice were 

unable to stimulate a direct CD4 + T-cell response, rapid rejection of their graft 

in a CD4 + -dependent manner suggested that indirect T-cell stimulation could 

lead to graft rejection (31). Further importance of indirect alloresponses is suggested 

by the downregulation of T-cell responses following thymic administration 

of allogeneic MHC-derived peptides leading to prolonged survival of 

subsequent renal allografts. Such peptides could not have affected the direct 

pathway, which suggests that indirect presentation is critical to the rejection 

process (32). These data also imply dominance over the direct pathway. 

6. Evidence for Indirect Allorecognition In Vitro 

Evidence that processing and presentation of MHC-derived peptides occurs 

physiologically has been provided by Chicz et al. (33), who eluted peptides 

from HLA-DR1 molecules derived from naturally processed self MHC polypeptides 

from either the invariant chain or HLA-A2. This suggests that processing 

and presentation of such peptides is a common event in vivo. 

Both MHC class I (34) and class II (35) allogeneic peptides may be presented 

in the context of self-MHC class II. It is probable that the precise cellular 

origins of donor antigens will be of little significance, as donor antigens are 

processed and presented by recipient APCs, the important factor being the quantity 

of donor antigen available. Class I MHC antigens are likely to be of greater 

importance than class II antigens, being more common in the long-term life 

span of the allograft (36), at least in the absence of acute rejection episodes 

(37). With the knowledge that crosstalk between the endogenous and exogenous 

pathways can take place, presentation of exogenous antigens by self- 

MHC class I molecules may also occur. The actual physiological significance 

Fig. 1. (opposite page) Direct allorecognition involves the recognition by T cells of 

the polymorphism of the C alloantigens displayed at the surface of donor dendritic 

cells. No other cells intervene in this initial step of the direct pathway. Indirect 

allorecognition involves the recognition of donor alloantigens (primarily allogeneic 

MHC molecules) in the same way as for any nominal protein antigen, i.e., as processed 

peptides associated with self (recipient)-MHC class II molecules. Following 

activation of indirect T-helper cells, allospecific effector cells may be stimulated in 

the same localized environment.

152 Hornick 

of this in graft rejection is questionable. One view is that CD8+ cells sensitized 

by peptides presented in the context of recipient MHC class I molecules will 

not find such a determinant expressed by donor cells except in cases where 

donor and recipient MHC class I molecules are matched (38). IL-2 secreting 

CTL (39) may, however, potentially react with such self-restricted peptides and 

thus provide the cytokines necessary (in addition to cytokines generated from 

indirect HTL) for driving directly sensitized CTL, B-cell, and DTH responses 

against the graft and not by their own actual interaction with the donor and 

hence lysis of donor cells. 

7. Evidence of the Indirect Pathway in Humans 

The frequency of T cells engaged in the indirect recognition of synthetic 

DR1 peptides in an in vitro culture system was found to be about 100-fold lower 

than that of T cells participating in direct recognition of native HLA-DR antigen 

(40). Such data, however, do not necessarily imply dominance of direct 

pathway mechanisms, as there is the potential for the generation of a multiplicity 

of epitopes derived from MHC molecules. The strength of the indirect 

response would therefore be the sum total of all indirect frequencies estimated 

for each epitope. It thus becomes clear that a failure to demonstrate an indirect 

alloreactive frequency might reflect the sensitivity of the assay system and the 

methodology utilized (41). This conceptually challenges the precept that direct 

allorecognition dominates the rejection process in its early stages just because 

high precursor frequencies are produced in vitro. 

Recent data derived in the context of acute rejection in recipients of heart 

grafts and utilizing synthetic peptides corresponding to the hypervariable regions 

of the mismatched donor HLA-DR antigens have indicated an association 

between acute rejection and activation of the indirect pathway (42). Frasca et al. 

raised T-cell clones from an HLA-A2-negative patient whose A2-positive kidney 

failed as a result of chronic rejection. The clones responded in a selfrestricted 

manner to a single peptide of HLA-A2 (43). 

The relative contribution of alloantibody in the rejection process is not well 

understood. In the context of chronic rejection, humoral mechanisms have long 

been thought to make important contributions. Taylor et al. (44) and Russell et 

al. (45) indicate in the rat the importance of humoral immune mechanisms in 

the development of chronic rejection. In humans, recent evidence indicates their 

potential importance in chronic rejection (46,47). Because the alloantibodies 

formed during chronic rejection react with donor cells and often exhibit 

antidonor specificity, this process is likely to be mediated by Th cells recognizing 

donor MHC-derived peptides and bound to host MHC molecules. Donor 

alloantigens released from the injured graft may provide soluble MHC molecules, 

which produce antigens for indirect allorecognition. Such processes may


expose the graft to the continuous attack of allopeptide-reactive Th cells, which 

can mediate rejection long after the donor APCs have migrated from the graft 

and provide help to B cells to produce antidonor HLA antibodies (48). Anti- 

HLA antibodies can bind soluble HLA antigens, forming immune complexes 

that are internalized by APCs via Fc receptors. This again would result in efficient 

processing of alloantigens and stimulation of allopeptide reactive Th cells 

(49,50). It is possible that sublytic injury of vascular cells by complement may 

promote the release of growth factors that could contribute to a fibroproliferative 

rather than a desquamative or frankly necrotic process (51). B-cell antibody 

production thus must involve T cells with indirect allospecificity. 

References 

1. Bach, F., Bach, M., and Sondel, P. (1976) Differential function of major histocompatibility 

complex antigens in T lymphocyte activation. Nature 259, 273–281. 

2. Skinner, M. and Marbrook J. (1976) An estimation of the frequency of frequency 

of precursor cells which generate cytotoxic lymphocytes. J. Exp. Med. 143, 1562– 

1567. 

3. Fischer-Lindahl, K. and Wilson, D. (1976) J. Exp. Med. 145, 500–507. 

4. Hunig, T. and Bevan, M. (1980) Self-H2 antigens influence the specificity of 

alloreactive cells. J. Exp. Med. 151, 1288–1298. 

5. Lombardi, G., Sidhu, S., Batchelor, J., and Lechler, R. (1989) Allorecognition of 

DR1 by T cells from a DR/Dw13 responder mimics self-restricted recognition of 

endogenous peptides. Proc. Natl. Acad. Sci. 86, 4190–4194. 

6. Lombardi, G., Sidhu, S., Daly, M., Batchelor, J., Makgoba, W., and Lechler, R. 

(1990) Are primary alloresponses truly primary? Int. Immunol. 2, 9–13. 

7. Matzinger, P. and Bevan, M. (1977) Why do so many lymphocytes respond to 

major histocompatibility antigens? Cell. Immunol. 29, 1–5. 

8. Bevan, M. (1984) High determinant density may explain the phenomenon of 

alloreactivity. Immunol. Today 5, 128-–130. 

9. Harding, C. and Unanue, E. (1990) Quantitation of antigen-presenting cell MHC 

class II/peptide complexes necessary for T cell stimulation. Nature 346, 574. 

10. Lechler, R., Lombardi, G., Batchelor, J., Reinsmoen, N., and Bach, F. (1990) The 

molecular basis of alloreactivity. Immunol. Today 11, 83–88. 

11. Merkenschlager, M., Graf, D., Lovatt, M., Bommhardt, U., Zamoyska, R., and 

Fisher, A. (1997) How many thymocytes audition for selection? J. Exp. Med. 186, 

1149–1158. 

12. Pietra, B., Wiseman, A., Bolwerk, A., Rizeq, M., and Gill, R. (2000) CD4 T cellmediated 

cardiac allograft rejection requires donor but not host MHC class II. J. 

Clin. Invest. 106, 1003–1010. 

13. Braun, M., McCormack, A., Webb, G., and Batchelor, J. (1993) Mediation of 

acute but not chronic rejection of the MHC incompatible rat kidney grafts by 

alloreactive CD4 T cells activated by the direct pathway of sensitisation. Transplantation 

55, 177–182.

154 Hornick 

14. Austyn, J. and Larsen, C. (1990) Migration patterns of dendritic leucocytes. Implications 

for transplantation. Transplantation 49, 1–7. 

15. Harding, F. and Allison, J. (1993) CD28-B7 interactions allow the induction of 

CD8+ cytotoxic T lymphocytes in the absence of exogenous help. J. Exp. Med. 

176, 519–529. 

16. Dai, R., Grammar, S., and Streilein, J. (1993) Fresh and cultured Langerhans cells 

display differential capacities to activate hapten-specific T cells. J. Immunol. 150, 

59–66. 

17. Streilein, J., Grammar, S., Yoshikawa, T., Demidem, A., and Vermeer, M. (1990) 

Functional dichotomy between Langerhans cells that present antigen to naive and 

to memory/effector T lymphocytes. Immunol. Rev. 117, 159–183. 

18. Milton, A., Spencer, S., and Fabre, J. (1986) The effects of cyclosporin A on the 

induction of donor class I and class II MHC antigens in heart and kidney allografts 

in the rat. Transplantation 42, 337. 

19. Hosenpud, J., Shipley, J., and Wagner, C. (1992) Cardiac allograft vasculopathy, 

Current concepts, recent developments and future directions. J. Heart Lung Transplant. 

11, 9–23. 

20. Deacock, S. J. and Lechler, R. L. (1992) Positive correlation of T cell sensitization 

with frequencies of alloreactive T helper cells in chronic renal failure patients. 


21. Mason, P., Robinson, C., and Lechler, R. (1996) Detection of donor-specific 

hyporesponsiveness following late failure of human renal allografts. Kidney Int. 

50, 1019–1025. 

22. Cramer, D., Chapman, F., Wu, G., Harnaha, J., Quian, S., and Makowka, L. (1990) 

Cardiac transplantation in the rat. II. Alteration of the severity of donor graft arteriosclerosis 

by modulation of the host immune response. Transplantation 50, 554– 

558. 

23. Shin, Y., Adams, D., Wyner, L., Akalin, E., Sayegh, M., and Karnovsky, M. 

(1995) Intrathymic tolerance in the Lewis-to-F344 chronic cardiac allograft rejection 

model. Transplantation 59, 1647–1653. 

24. Cramer, D., Qian, S., Harnaha, J., et al. (1989) Cardiac transplantation in the rat, 

I. The effect of histocompatibility differences on graft atherosclerosis. Transplantation 

47, 414–419. 

25. Isoniemi, H., Nurminen, M., Tikkanen, M., et al. (1994) Risk factors predicting 

chronic rejection of renal allografts. Transplantation 57, 68–72. 

26. Lechler, R. and Batchelor, J. (1982) Restoration of immunogenicity to passenger 

cell- depleted kidney allografts by the addition of donor strain dendritic cells. J. 

Exp. Med. 155, 31–41. 

27. Benichou, G., Takizawa, A., Olson, A., McMillan, M., and Sercarz, E. (1992) Donor 

major histocompatibility complex (MHC) peptides are presented by recipient MHC 

molecules during graft rejection. J. Exp. Med. 175, 305–308. 

28. Fangmann, J., Dalchau, R., and Fabre, J. (1992) Rejection of skin allografts by 

indirect allorecognition of donor class I major histocompatibility complex peptides. 

J. Exp. Med. 175, 1521–1529.


29. Benham, A., Sawyer, G., and Fabre, J. (1995) Indirect T cell recognition of donor 

antigens contributes to the rejection of vascularized kidney allografts. Transplantation 

59, 1028–1032. 

30. Grusby, M., Johnson, R., Papaioannou, V., and Glimcher, L. (1991) Depletion of 

CD4 T cells in major histocompatibility complex class II-deficient mice. Science 

253, 1417–1420. 

31. Auchinloss, H. J., Lee, R., Shea, S., Markowitz, J., Grusby, M., and Glimcher, L. 

(1993) The role of ‘indirect’ recognition in initiating rejection of skin grafts from 

major histocompatibility complex class II-deficient mice. Proc. Natl. Acad. Sci. 

USA 90, 3373–3377. 

32. Sayegh, M., Perico, N., Gallon, L., Imberti, O., Hancock, W., Remuzzi, G., et al. 

(1994) Mechanisms of acquired thymic unresponsiveness to renal allografts. Transplantation 

58, 125–132. 

33. Chicz, R., Urban, R., Lane, W., Gorga, S., Stern, L., Vignali, D., et al. (1992) 

Predominant naturally processed peptides bound to HLA-DR1 are derived from 

MHC relayed molecules and are heterogeneous in size. Nature 358, 764–768. 

34. Essaket, S. and Fabron, J. (1990) Co-recognition of HLA-A1 and HLA DPw3 by 

a human CD4+ alloreactive T cell clone. J. Exp. Med. 172, 387–390. 

35. de Koster, H., Anderson, D., Termijtelen, A. (1990) T cells sensitized to synthetic 

HLA-DR3 peptide give evidence of continuous presentation of denatured HLA- 

DR3 molecoles by HLA-DP. J. Exp. Med. 169, 1191–1196. 

36. Hart, D. and Fabre, J. (1979) Quantitative studies on the tissue distribution of Ia 

and SD antigens in the DA and Lewis rat strains. Transplantation 27, 110. 

37. Milton, A., Spencer, S., and Fabre, J. (1986) Massive induction of donor type 

class I and class II MHC antigens in rejecting cardiac allografts in the rat. J. Exp. 

Med. 161, 98. 

38. Auchinloss, H. J. and Sutan, H. (1996) Antigen processing and presentation in 

transplantation. Curr. Opin. Immunol. 8, 681–687. 

39. Joos, J., Zanker, B., Wagnar, H., and Kabelitz, D. (1988) Quantitative assessment 

of interleukin-2-producing alloreactive human T cells by limiting dilution analysis. 

J. Immunol. Methods 112, 85. 

40. Liu, Z., Sun, Y., Xi, Y., Maffai, A., Reed, E., Harri,s P., et al. (1993) Contribution 

of direct and indirect allorecognition pathways to T cell alloreactivity. J. Exp. 

Med. 177, 1643–1650. 

41. Van Besouw, N., Vaessen, L., Daane, C., Jutte, N., Balk, A., Claas, F., et al. (1996) 

Peripheral monitoring of direct and indirect alloantigen presentation pathways in 

clinical heart transplant recipients. Transplantation 61, 165–167. 

42. Liu, Z., Coloval, A., Tugulea, S., Reed, E., Fisher, P., Mancini, D., et al. (1996) 

Indirect recognition of donor HLA-DR peptides in organ allograft rejection. J. 

Clin. Invest. 98, 1150–1157. 

43. Frasca, L., Amendola, A., Hornick, P., Uren, J., Marelliberg, F., Lechler, R., et 

al. (1998) The role of donor and recipient antigen presenting cells in priming 

and maintaining T cells with indirect specificity. Transplantation 66, 1238– 

1243.

156 Hornick 

44. Taylor, D., Ibrahim, H., Tolman, D., and Hess, M. (1991) Accelerated coronary 

arteriosclerosis in cardiac transplantation. Transplant. Rev. 5, 165–174. 

45. Russell, P., Chase, C., Winn, H., and Colvin, R. (1994) Coronary atherosclerosis 

in transplanted rat heart. II. The importance of humoral immunity. J. Immunol. 

152, 389–398. 

46. Dunn, M. J., Crisp, S. J., Rose, M. L., Taylor, P. M., Yacoub, M. H. (1992) Antiendothelial 

antibodies and coronary artery disease after cardiac transplantation. 

Lancet. 339, 1566–1570. 

47. Reed, E. F., Hong, B., Ho, E., Harris, P. E., Weinberger, J., Suciu-Foca, N. (1996) 

Monitoring of soluble HLA alloantigens and anti-HLA antibodies identifies heart 

allograft recipients at risk of transplant-associated coronary artery disease. Transplantation. 

61, 566–572. 

48. Bradley, J., Mowat, A. M., and Bolton, E. (1992) Processed MHC class I alloantigen 

as the stimulus for CD4+ T-cell dependent antibody-mediated graft rejection. 

Immunol. Today 13(11), 434–438. 

49. Simitsek, P., Campbell, D., Lanzavecchia, A., Fairweather, N., and Watts, C. 

(1995) Modulation of antigen processing by bound antibodies can boost or suppress 

class II major histocompatibility complex presentation of different T cell 

determinants. J. Exp. Med. 181, 1957. 

50. Sallusto, F. and Lanzavecchia, A. (1994) Efficient presentation of soluble antigen 

by cultured human dendritic cells is maintained by granulocyte/macrophage 

colony-stimulating factor plus interleukin 4 and down regulated by tumour necrosis 

factor alpha. J. Exp. Med. 179, 1109. 

51. Benzaquen, L., Nicholson-Weller, A., and Halperin, J. (1994) Terminal complement 

proteins C5b-9 release fibroblast growth factor and platelet derived growth 

factor from endothelial cells. J. Exp. Med. 179, 985–992.

HLA Typing and Organ Transplantation 157 

7 

HLA Typing and Its Influence on Organ Transplantation 

Stephen Sheldon and Kay Poulton 

Summary 

Human leukocyte antigen (HLA) molecules are expressed on almost all nucleated 

cells, and they are the major molecules that initiate graft rejection. There are three classical 

loci at HLA class I: HLA-A, -B, and -Cw, and five loci at class II: HLA-DR, -DQ, 

-DP, -DM, and -DO. The system is highly polymorphic, there being many alleles at 

each individual locus. Three methods for HLA typing are described in this chapter, 

including serological methods and the molecular techniques of sequence-specific priming 

(SSP) and sequence-specific oligonucleotide probing (SSOP). The influence of HLA 

matching on solid organ and bone marrow transplantation is also described. HLA matching 

has had the greatest clinical impact in kidney and bone marrow transplantation, 

where efforts are made to match at the HLA-A, -B, and -DR loci. In heart and lung 

transplantation, although studies have shown it would be an advantage to match especially 

at the DR locus, practical considerations (ischemic times, availability of donors, 

clinical need of recipients) make this less of a consideration. Corneal grafts are not 

usually influenced by HLA matching, unless being transplanted into a vascularized (or 

inflamed) bed. 

Key Words: HLA molecules; crossmatching; tissue-typing; serology. 


Human leukocyte antigen (HLA) molecules are expressed on the surface of 

virtually all nucleated cells and play a pivotal role in the fundamental necessity 

of the immune system to distinguish self from non-self. HLA antigens are the 

vehicles used to present peptides on the cell surface. Non-self determinants 

presented by HLA can instigate an appropriate immune response through HLA/ 

T-cell-receptor interaction. In humans, the genes that code for the HLA antigens 

are located on the short arm of chromosome 6 (6p21.3) within a region 

termed the major histocompatibility complex (MHC). 



157

158 Sheldon and Poulton 

The evolution of this complex of HLA genes within the MHC has been 

driven by the need of the immune system to effectively identify and respond to 

pathogens. The HLA system has responded to the evolutionary pressure generated 

by the ability of pathogens to constantly mutate, by itself becoming highly 

polymorphic within populations. This strategy increases the chances of at least 

a portion of a population being capable of effectively presenting and responding 

to new pathogens as they appear. If HLA polymorphisms are lacking within 

a population, a new pathogen has a greater potential to wipe that population 

out. The high level of polymorphism found within the HLA gene pool may 

well be central to the efficiency of the immune system in dealing with infection, 

but this has proved to be a major problem within the field of transplantation. 

In the artificial situation of transplantation, HLA molecules function as 

histocompatibility antigens. 

Because each individual inherits sets of several highly polymorphic HLA 

genes from both father and mother, the chance of two nonsibling individuals 

having an identical HLA phenotype is small. Because HLA antigens act as the 

markers that serve to communicate the identity of self or non-self within the 

immune system, any transplanted HLA disparity may act as the stimulus for an 

immune response. In the case of an HLA-mismatched allograft, the response is 

to initiate a cellular- and/or antibody-mediated rejection of the graft. Such a 

response can be instigated by passenger antigen-presenting cells (APCs) of 

donor origin, which can persist for some time posttransplant. This pathway is 

referred to as direct allorecognition and is unique to transplantation. If recipient 

APCs activate a rejection process, this is referred to as indirect allorecognition, 

this mechanism being comparable to the host’s natural response to an infection. 

The field of histocompatibility and immunogenetics has therefore evolved 

mainly through the need to identify and catalog the genetic polymorphisms 

within the HLA system in order to quantify the levels of disparity between 

donors and recipients. 

2. Early History 

The origins of HLA typing as we know it today stem from observations 

made by hematologists in the 1930s, who observed leukoagglutinating antibodies 

in patients with leukopenia. In the late 1950s, workers including Jean 

Dausset, Rose Payne, and Jon van Rood observed leukoagglutinins in serum, 

which were attributed to the patients having been exposed to alloantigens 

through transfusions or pregnancy (1–3). The reaction patterns displayed by 

the different antibodies identified against random cell panels revealed clusters 

of antisera with similar specificities. Individual research groups were therefore 

able to use these antibodies as reagents to phenotype individuals for the different 

specificities identified. The analogy with the genetically determined mice


histocompatibility antigens described by Snell at the Jackson Laboratories and 

Gorer in England in the 1950s (4,5) was soon recognized, as was the impact 

that the study of these gene products could have in understanding the processes 

of allograft rejection. 

As the number of investigators increased, collaboration was needed to develop 

a standardized nomenclature and typing methods. In 1964, the first International 

Workshop was convened in Durham, North Carolina. HLA antigens were categorized 

according to their structural and functional similarities into class I and 

class II. Since 1964, there have been 14 International Workshops, during which 

time three HLA class I (HLA-A, -B, and -Cw) and five HLA class II (HLA-DR, 

-DQ, -DP, -DM, and -DO) loci have been identified and comprehensively studied. 

More than 1800 polymorphisms have now been defined, with more continuing 

to be identified (6). 

3. Typing Methods 

3.1. Serology 

The earliest methods used to define HLA polymorphisms were entirely based 

on serological techniques. The complement-dependent lymphocytotoxicity 

(CDC) assay was developed in the 1964 by Terasaki and McClelland to dramatically 

reduce the volume of precious typing reagents required to define an 

individual phenotype (7). The CDC assay requires only 1 mL of typing reagent 

per test and 1 mL of target cells at a concentration of 2–4 × 10 6 /mL. Cells and 

sera are mixed under oil to avoid evaporation in sloping-sided wells of a Terasaki 

tray. After 30 min, rabbit serum is added as a source of complement (4–5 mL) 

and the assay is incubated for a further 60 min. If a well contains an antibody 

with specificity to HLA molecules expressed on the cells’ surface, the binding 

of that antibody will activate the rabbit complement. The lytic action of the 

activated complement results in cell death. The reactions are then fixed, stained, 

and read through the underside of the Terasaki tray using an inverted microscope. 

Cell death is recorded as a positive reaction, and the pattern of these 

reactions is interpreted to assign an HLA phenotype. 

Screening individuals who have been previously exposed to non-self HLA 

antigens can identify HLA-typing reagents. The most productive source of 

high-titer monospecific HLA-typing reagents is multiparous women. During 

pregnancy, women may produce HLA-specific antibodies after immunological 

exposure to non-self paternal HLA antigens expressed by the fetus (3). 

Serum from these women can be screened against a panel of cells of previously 

defined phenotype. The pattern of positive reactions can therefore be analyzed 

to determine the specificity or specificities of any detected antibodies. These 

well-characterized sera can subsequently be used as typing reagents. Patients 

who have had transfusions or a previous transplant with some degree of HLA


mismatch may also develop HLA-specific antibodies, although these patients 

are more likely to develop antibodies directed against multiple HLA antigens. 

If this is the case, a serum becomes less useful as a typing reagent. 

The target cells used in the CDC assay are usually peripheral blood lymphocytes 

(PBLs), which can be isolated from anticoagulated whole blood by density 

gradient centrifugation. As an alternative source, lymphocytes can also be 

flushed from the spleen or lymph nodes of cadaveric donors. Other cell-preparation 

techniques available include negative selection of PBLs by lysis of red 

cells and nonlymphocyte leukocytes with monoclonal antibodies (MAbs; e.g., 

LymphoKwik, One Lambda Inc). Antibody-coated magnetizable microbeads 

can also be used (e.g., Dynabeads, Dynal Ltd, or Fluorobeads, One Lambda 

Inc). These bind to specific cell populations and are then isolated using a strong 

magnet. These later methods allow class II-expressing B cells to be isolated 

independently as a target cell for class II (HLA-DR and -DQ) typing (8). 

The costs with respect to time and human resources required to screen, identify, 

and control the quality of alloantisera for use as CDC typing reagents has 

driven most HLA-typing laboratories to use class I and class II monoclonal 

antibody typing trays, which are now commercially available. Because the supply 

of MAbs provided is in theory unlimited and the avidity of the antibodies 

can be adjusted, this CDC method provides an added advantage in that the 

target cell can be added to both the MAb and complement in a one-step assay 

without reducing sensitivity. This simplifies the protocol and reduces the total 

incubation time required to just 1 h. 

Although serology-based techniques allowed scientists to first identify the 

polymorphic nature of the HLA system, the advent of molecular biology has 

allowed us to radically improve the level of polymorphic definition that can be 

achieved. 

3.2. HLA Typing by Molecular Methods 

Our understanding of the HLA system was dramatically improved when it 

became possible to define HLA specificities by genetic analysis. The very earliest 

techniques involved probing Southern blots of genomic DNA digested 

using restriction enzymes, yielding a variety of banding patterns, which were 

crudely related to HLA class II alleles. As more sequence data became available 

and DNA-based technologies progressed, it became possible to identify 

HLA alleles present by testing specifically for individual alleles. 

By the early 1990s, two diverse DNA-based HLA-typing systems were established 

and embraced by the HLA community. Both of these methods utilize the 

polymerase chain reaction (PCR) to produce multiple copies of the HLA genes, 

focusing predominantly on exons 2, 3, and 4. These exons encode the peptidebinding 

grooves of the HLA molecules, where most of the base changes are


located, giving each allele its unique sequence. One of these methods involved 

specific amplification of HLA alleles using PCR-sequence-specific priming 

(SSP) (9). The second technique involved locus-specific amplification of HLA 

genes and resolution of specific alleles present by probing the PCR-amplified 

DNA using PCR-sequence-specific oligonucleotide probes (SSOP) (10,11). 

These methods have proved so efficient and adaptable that they are still widely 

used today in some form. 

3.2.1. PCR-SSP 

When HLA typing using SSP, multiple simultaneous tests are performed on 

a single sample. Each test looks for the presence or absence of one polymorphism 

using PCR primers specific only for that sequence. The system relies on 

the lack of 5' to 3' exonuclease activity of Taq DNA polymerase, used in the 

PCR reaction. Using this enzyme, PCR amplification only occurs if alleles 

with sequences identical to those of the PCR primers used are present in the 

sample to be tested. Specificity of the PCR amplification is conferred by the 

base at the 3' end of each primer, where an exact match is required in order to 

allow the synthesis of a new strand of DNA. 

It is necessary to run multiple simultaneous SSP reactions in order to obtain 

an HLA typing. Typically, at least 96 reactions are required to define HLA-A, 

-B, and -DRB1 alleles present at the lowest resolution. As a control against 

amplification failure, which could give a false-negative result, primers that 

amplify a highly conserved gene (often human growth hormone) are included in 

each reaction. These internal control primers amplify a band that is easily distinguished 

from specific amplification by size, using conventional agarose gel 

electrophoresis stained with ethidium bromide under ultraviolet light (Fig. 1). 

In some cases, primers do not amplify specific alleles but amplify allele groups, 

and specificity is defined by looking at combinations of positive and negative 

results. Results are interpreted by comparing these reaction patterns either manually 

or with the aid of a computerized software package designed specifically 

for each test. 

The major advantage of this system is that it is the quickest method of obtaining 

a full HLA typing using molecular methods widely available at the moment. 

From receipt of sample to interpretation of the gel image, a complete HLA typing 

by DNA-based methods takes approx 3.5 h. It is possible that this technology 

may be replaced in future by real-time PCR methodologies (e.g., TaqMan, 

Applied Biosystems Inc.), which will remove the need to analyze PCR product 

using gel electrophoresis, but at the time of going to press these technologies 

were not readily available in most laboratories. As the most rapid of the DNAbased 

technologies available, PCR-SSP is still the technology of choice for most 

centers performing HLA typing of cadaveric donors for transplantation. As a


Fig. 1. HLA-DRB1 typing by PCR-SSP (low resolution).The presence of specific 

amplification bands in lanes 5, 6, and 17 indicates the presence of HLA-DRB1*03, 

and a positive reaction in lane 8 indicates the presence of DRB1*04. The specific 

amplification in lane 22 indicates the presence of DRB3* alleles, which are in linkage 

with DRB1*03 alleles. Lane 23 shows the presence of DRB4* alleles, in linkage with 

DRB1*04. M = size marker to identify size of amplified products (bp) 

result, this technique has been heavily exploited commercially, and a number of 

manufacturers now market comprehensive PCR-SSP HLA-typing reagents 

(Dynal Biotech, One Lambda, Protrans, and Biotest, among others) 

One disadvantage of PCR-SSP is that it remains a comparatively expensive 

technique, consuming relatively large quantities of primers and DNA polymerase 

and using relatively large amounts of DNA. For HLA typing of multiple 

samples, it could also be regarded as a rather time-consuming procedure. 

The 3.5 h it takes to process a sample is not reduced dramatically by processing 

multiple samples, and the ability to process samples simultaneously is limited 

by resources such as the number of thermal cyclers available at any one time. 

A far more suitable system for HLA typing of multiple samples is based on the 

alternative technology established again in the early 1990s: SSOP. 

3.2.2. SSOP 

This is also a PCR-based system, relying on amplification not of specific 

alleles as in PCR-SSP, but of exons in the HLA genes containing the hypervariable 

regions that confer allele specificity. Multiple Southern blots of the 

amplified PCR product are prepared on nylon membranes, which are then hybri-


dized against a series of labeled SSO probes directed against specific base 

changes that bind to regions of complementarity. Excess or nonspecifically 

bound probes are removed after hybridization using stringent washing procedures 

with either tetramethylammonium chloride or sodium saline citrate. SSO 

probes remain bound after stringent washing procedures only when the sequence 

of the probes is an exact match to that of an HLA allele present in the sample. 

Bound probe is detected, usually using enhanced chemiluminescence-based 

techniques, and the HLA type of the individual is interpreted by comparing 

patterns of positive and negative reactions (12). 

One obvious advantage of PCR-SSOP is that this system is best suited for 

typing large numbers of samples simultaneously. When compared with HLA 

typing by PCR-SSP, little additional expenditure is required to process 96 

samples compared with processing a single sample in terms of thermal cyclers, 

technician time, and reagents. This approach to HLA typing is also the most 

economical in terms of the amount of DNA required because only one PCR 

amplification is required per sample. This makes PCR-SSOP the method of 

choice for research studies, where it is essential to conserve sample whenever 

possible. 

Over the years, the PCR-SSOP system has been subject to various technological 

modifications used to improve the efficiency or the safety of the methodology 

used in routine practice. For example, the most efficient labeling of the 

oligonucleotide probes was originally achieved using radioactive labels ( 32 P). 

In time, this was superceded by substituting biotin-labeled probes, followed by 

an enhanced chemiluminescence detection system. Robotic workstations and 

automated (real-time) development systems have replaced laborious manual 

pipetting and interpretation of autoradiographs, reducing the potential for introducing 

human error into the system. A modification of the SSOP is used successfully 

in the form of reverse slot blot assays produced commercially for 

HLA typing (13). An overview of this method is summarized in Fig. 2. 

4. HLA Nomenclature 

As would be expected in this fast-growing field, nomenclature for both existing 

and novel alleles is strictly regulated by the WHO Nomenclature Committee 

for factors of the HLA system. Regular updates documenting the details of 

newly identified HLA alleles are published in Tissue Antigens, but the official 

repository for HLA sequences is the IMGT/HLA sequence database, which 

can be accessed at www.ebi.ac.uk/imgt/hla. In July 2005 this database contained 

sequences for 1325 class I alleles and 763 class II alleles. The database 

is updated at 3-mo intervals. 

Over time, major revisions of HLA nomenclature have been necessary to 

accommodate the increasing number of HLA alleles identified. The most recent


Fig. 2. The principle of sequence-specific oligonucleotide probing (SSOP) has been 

used in the manufacture of reverse slot blot strips for HLA typing. PCR, polymerase 

chain reaction; HLA, human leukocyte antigen. 

major revision was published in July 2002 (6). A guide to the current nomenclature 

for HLA antigens and alleles is summarized in Table 1. HLA alleles 

described in publications printed before July 2002 may have changed their 

nomenclature, and it is advisable to refer to ref. 6 for clarity. 

5. Influence of HLA Matching 

5.1. Solid Organ Transplantation 

We shall see that the influence of HLA matching in solid organ transplants 

depends on which organ is being considered for transplant. The degree of HLA 

matching deemed suitable or necessary by individual transplant communities is 

very much country- and center-specific. In general, the degree of HLA mismatch 

for a particular transplant is the number of broad antigen specificities (as 

defined by serological nomenclature) mismatched at the HLA-A, -B, and -DR 

loci, in that order. A totally HLA-mismatched transplant is therefore referred to 

as a 2:2:2, whereas a 0:0:0 transplant would indicate that no broad antigens 

were mismatched at any of the three loci.


Table 1 

Reference Guide to HLA Nomenclature 

Nomenclature Interpretation 

HLA-A Indentification of HLA locus 

HLA-A24 Serologically defined HLA antigen 

HLA-A* Asterisk denotes HLA alleles defined by analysis of DNA 

HLA-A*24 2-digit resolution Denotes the allele group 

(corresponds where possible to the 

serological group; often termed 

“low resolution” 

HLA-A*2402 4-digit resolution Sequence variation between alleles 

results in amino acid substitutions 

(Coding variation, or nonsynonymous 

changes) 

HLA-A*240201 6-digit resolution Noncoding variation; sequence 

changes are synonymous, do not 

result in amino acid substitution 

HLA-A*24020102 8-digit resolution Sequence variation occurs within 

introns, or 5'/3' extremities of the gene 

HLA-A*24020102L Alphabetical suffice Letters (see below) may be used as a 

suffix to describe the biological 

expression of the encoded molecule 

A Aberrant expression 

C Molecule present in the 

cytoplasm only 

L Low levels of expression 

N Null allele (not expressed) 

S Secreted molecule present only 

as soluble form 

HLA, human leukocyte antigen. 

5.1.1. Kidney Transplantation 

The surgical event of kidney transplantation has been developed to the point 

of becoming a relatively routine procedure. As a result, technical failure rates 

are very low, and the major barrier to successful transplantation is preventing 

and/or managing graft-rejection processes. 

The immediate concern is the risk of early antibody-mediated rejection, often 

referred to as hyperacute rejection. This can be prevented by ensuring that both 

donor and recipient are ABO blood group compatible, which eliminates the 

potential thrombotic effect of naturally occurring anti-ABO isoagglutinins.


Early antibody-mediated rejection owing to preformed HLA-specific antibodies 

is also a risk factor (14). Recipients need to be screened pretransplant for 

the presence or development of HLA-specific antibodies. If sensitization to 

any HLA specificities is identified, these can be highlighted as “unacceptable 

antigens” and avoided as mismatches with any potential donor. A prospective 

CDC crossmatch is also used to identify transplants with potential for hyperacute 

rejection. More recently protocols involving flow cytometry have been 

introduced to provide a more sensitive method of crossmatching if required. 

In kidney transplantation it is widely accepted that the avoidance of HLA 

mismatches improves actuarial graft survival and reduces the incidence of acute 

rejection and sensitization to mismatched specificities. Evidence-based singleand 

multicenter studies can demonstrate an incremental increase in actuarial 

graft survival over time as the number of HLA mismatches is reduced (15–18). 

Opelz et al. (15) showed that graft survival was 17% lower for 2:2:2 mismatched 

transplants than 0:0:0 10 yr after transplant. The strongest impact is accepted as 

being due to HLA-DR mismatching, followed by HLA-B and finally HLA-A. 

Beyond 10 yr, the influence on graft survival of the three loci was found to be 

equivalent and additive. 

The sharing of kidneys between centers can dramatically minimize HLA 

mismatches within transplant programs. The benefit of allocation of kidneys on 

the basis of HLA specificity matching is still debated, however (19), given that 

multidrug, high-dose immunosuppressive regimens can minimize the influence 

of poorly HLA-matched transplants. The counterargument for shipping organs 

to improve matching, however, arises from the inevitable extension of cold 

ischemia times incurred in doing so (20), which is itself a well-documented risk 

factor. The potential for longer waiting times for patients with less common 

HLA phenotypes (such as those belonging to ethnic minorities) also exists. 

There is a balance, therefore, between making efforts to minimize HLA mismatches 

or to rely on more aggressive immunosuppressive regimens to counteract 

the influence of increased HLA disparity. The payback for the latter 

protocol is increased susceptibility to posttransplant complications including 

infection and cancers. 

The policies used in different parts of the world for the allocation of kidneys 

tend to be influenced to a great extent by the geographic constraints of organ 

sharing. Where localized alliances can be used to exchange organs to improve 

the degree of matching, it has been demonstrated that the cold ischemic time 

need not be significantly increased (21). The time implications generated by shipping 

organs over vast distances across the United States, however, has resulted in 

legislation requiring kidneys to be shared only when there are no HLA-A, -B, or 

-DR (0:0:0) mismatches. Beyond this, kidneys are transplanted locally using 

other criteria. In Eurotransplant, kidneys are shared whenever possible to mini-


mize HLA mismatches. The United Kingdom has developed a system whereby 

sharing of kidneys occurs for 0:0:0, 1:0:0, 0:1:0, and 1:1:0 mismatched transplants. 

If only poorer HLA matches can be identified, kidneys are transplanted 

locally, with priority recommended to recipients with minimum mismatch at 

HLA-DR. Where a tie exists, other factors are considered. The factors used highlight 

the transplantability of an individual as predicted by the commonality of 

their HLA type in combination with their level of preexisting sensitization to 

other HLA specificities. In addition, factors such as donor–recipient age disparity 

and transport times where excessive cold ischemia time is predicted are also 

weighted into the allocation decision (www.uktrans plant.org.uk). 

In the long run, one further advantage of minimizing HLA mismatches that is 

often overlooked is the effect that this has of limiting the potential for a recipient 

to become sensitized to multiple non-self HLA epitopes. Following a poorly 

matched kidney transplant, a patient can become highly sensitized, developing 

antibodies reactive with more than 50% of the donor population. In this situation 

it becomes much more difficult to find a cross-match-negative donor should these 

patients subsequently require a second transplant. Highly sensitized patients may 

remain relisted for many years before a suitable donor can be found, if at all. 

Opelz et al. (15), using multicenter analysis, also demonstrated that the influence 

of HLA mismatches when transplanting sensitized patients was even stronger. 

The difference between graft survival at 5 yr for these patients is 30% less for 

recipients with six mismatches when compared to those with no mismatches. 

Such evidence-based practice should be recognized by transplant centers and 

used to develop allocation policies to make the best use of the precious but limited 

supply of donor kidneys. 

5.1.2. Heart Transplantation 

Alternatives to heart transplantation such as the use of angiotensin-converting 

enzyme inhibitors (22) are noticeably reducing the number of patients being 

listed for heart transplantation. This may be compounded in the future by the 

use of implantable ventricular assist devices, which are currently under development. 

Heart transplant activity is currently on the decline and may well continue 

to decrease (23). Given the highly polymorphic nature of the HLA system, 

shorter waiting lists only exacerbate the difficulty of finding a well-matched 

recipient for an individual heart. In contrast to kidney transplantation, much 

more consideration is required in terms of size matching the donor and recipient. 

Once this, together with ABO blood group compatibility, age matching, 

and perhaps Cytomegalovirus (CMV) compatibility has been taken into account, 

selecting suitable HLA-matched recipients from a small waiting list is extremely 

limiting and may not even be possible in some instances. Given the clinical 

urgency to transplant patients who are listed, the addition of a further selection


tier allowing HLA compatibility to be considered has not been supported. In 

addition, the relatively short cold ischemia time permissible for hearts (ideally 


(32) examined this theory in the early 1990s in a study of 466 liver transplants. 

This study concluded that full class I matching in liver transplantation may 

have an adverse effect, but that some matching may be desirable. 

Subsequent studies have found contradictory evidence, leaving unclear the 

influence of HLA matching in liver transplantation. There is one constant finding, 

however, that influences other than HLA compatibility are also involved 

in determining graft outcome. 

The unusual divergence from the expected with liver allografts is further 

extended by them apparently being much more tolerant to ABO blood group 

incompatibilities that other solid organ transplants. Even positive HLA-specific 

crossmatches have been reported as being tolerated in some cases. Both 

of these scenarios are still on the whole identified as strong risk factors. 

5.1.5. Corneal Transplantation 

Each year, more than 2000 people in the United Kingdom have their sight 

restored following corneal transplantation. In the United States, this figure is 

more than 40,000. Less than 10% of primary grafts undergo immune rejection 

despite no routine HLA matching and with immunosuppressive protocols limited 

to the topical application of corticosteroids. This success is indicative of the 

eye being an immunologically privileged site. The avascularity of successful 

corneal allografts is the traditional explanation for this phenomenon, but other 

mechanisms have now been recognized in sustaining this process. Suppression 

of inflammatory resources in the eye has thought to have arisen through evolutionary 

pressures to protect vision (33). The expression of Fas ligand (CD95L) 

in the eye acts to induce apoptosis of infiltrating inflammatory cells, whereas 

T-helper-cell-1 responses are actively suppressed. The fact that no passenger 

donor APCs are transplanted with the allograft, as in other solid organ transplants, 

means that the potential for direct allorecognition is eliminated. This is 

also thought to be a protective factor. 

Graft rejection does, however, occur if the graft bed becomes vascularized. 

In cases where a regraft is required, HLA matching, or the avoidance of HLA 

mismatches identified from the primary graft is required (34). As in all solid 

organ transplantation, any reexposure to mismatched HLA antigens in a second 

graft that have provided the target for a primary sensitization event is a 

contraindication to transplant. 

5.2. Hematopoietic Stem Cell Transplantation 

Hematopoietic stem cell transplantation (HSCT) is used to restore impaired 

bone marrow and is most commonly used to treat acute and chronic leukemias, 

myeloma, or aplastic anemia. In some cases HSCT may be used to resolve a 

congenital metabolic disorder, such as an enzyme deficiency. Autologous HSCTs


may be carried out by stimulating an individual to produce a large number of 

stem cells, which can then be harvested, stored, and returned to the donor after 

intensive chemotherapy. This technique allows the delivery of more extensive 

chemotherapy, knowing that the patient’s immune system can be restored safely 

after treatment. There is no need for HLA matching for autologous HSCT. 

Allogeneic HSCT refers to transplantation where the donor is a second individual. 

It is in these instances where HLA matching is of prime importance. In 

HSCT, the recipient’s bone marrow is ablated and replaced by the donor’s hematopoietic 

stem cells. The donor’s stem cells migrate to the recipient’s marrow 

cavity, where they seed and produce a new, healthy immune system. It is essential 

that the HLA match of the donor be as close as possible to that of the 

recipient, and it should be matched not only for HLA-A, -B, and -DR, but also 

for HLA-C, -DQ, and, if possible, -DP (35). Otherwise, as the donor marrow 

engrafts, the circulating donor leukocytes may identify the recipient as foreign 

and produce an immune response directly against the recipient. This phenomenon, 

graft-vs-host disease (GVHD), may affect skin, gut, and liver, among 

other organs. GVHD ranges in severity from mild (skin involvement) to life 

threatening (multiple organs affected). 

It is interesting that where the donor is a monozygotic twin of the recipient, 

there is an increased risk of leukemia returning posttransplant (relapse), compared 

with cases where the donor is an HLA-identical sibling. There is clearly 

a compromise with matching, therefore, where there is an advantage for the 

donor to have a slightly different genetic background. This facilitates the elimination 

of any residual leukemic cells within the recipient’s marrow by the leukocytes 

of the newly seeded graft. This phenomenon, the graft-vs-leukemia 

(GVL) effect, is associated with increased overall survival. 

In matching for HSCT, we aim to achieve a balance between the GVL effect 

and GVHD. The best overall survival rates are obtained when the donor is an 

HLA-identical sibling. Unfortunately, this is an option for only approx 25% of 

patients. The remaining 75% of patients in need of donor stem cells must rely 

on finding a suitably matched unrelated donor from one of the many donor 

registries worldwide. The biggest limitation on HSCT is the availability of 

adequately matched unrelated donors. The probability of finding a suitably 

matched donor is directly related to the population frequency of the HLA alleles 

present in the recipient. 

In 1999 a special report recommended that typing of HLA alleles should be at 

allele group resolution (two digits) (36). This has now been recognized as inadequate, 

and accreditation bodies such as the European Federation for Immunogenetics 

recommend that donors and recipients be matched for all loci at the 

allele level (four digits), where possible, with priority given to matching for 

class II alleles. Using this approach, survival rates for patients receiving trans-


plants from unrelated donors are not significantly different from those where the 

donor is an HLA-identical sibling (37). Some centers have extended matching 

by including additional markers within the MHC in an attempt to extend the 

matching of HLA haplotypes (38). 

Petersdorf et al. (39) suggested that in unrelated donation, a single mismatch 

at the allele level (four digits) at either HLA-A, -B, -Cw, -DRB1, or -DQB1 

does not significantly increase the risk of graft failure, whereas a single mismatch 

at the allele-group level (two digits) does. This introduces the concept 

that it may be possible to “trade off” acceptable mismatches in unrelated donors 

in favor of other desirable characteristics of a donor, such as matching for CMV 

serostatus, donor age, and donor gender (40). 

6. The Future 

There is overwhelming clinical support for transplantation as the treatment of 

choice for end-stage organ failure. As a result, this is a quickly expanding field 

both clinically and academically. Technical advances in developing molecular 

methodologies for high-resolution HLA typing are always in progress. The most 

promising of these methods are the Luminex and Microarray technologies, both 

of which use the underlying principals of PCR-SSOP described earlier. 

Clinically, it is quite possible that the near future will see an expansion in the 

use of single-cell populations in transplantation. This approach, utilizing pancreatic 

islets and neural cells, has already been pioneered at some specialist 

centers. Scientific manipulation of embryonic stem cells may also hold the key 

to future advances. Until such advances materialize or developments in immunosuppressive 

therapies allow grafts to be protected with no known side effects, 

there will always be a need for HLA matching. 

References 

1. Dausset, J. (1958) Iso-leuco anticorps. Acta Haematol. 20, 156–166. 

2. Van Rood, J. J. and Van Leeuwen, A. (1963) Leucocyte grouping. A method and 

its applications. J. Clin. Invest. 42, 1382–1390. 

3. Payne, R., Trip, M., Weigle, J., Bodmer, W., and Bodmer, J. (1964) A new leukocyte 

iso-antigen system in man. Cold Spring Harbour Symp. 29, 285–295. 

4. Snell, G. D. (1948) Methods for the study of histocompatibility genes. J. Genet. 

49, 87–108. 

5. Gorer, P. A. (1937) The genetic and antigenic basis for tumor transplantation. J. 

Pathol. Bacteriol. 44, 691–697. 

6. Marsh, S. G. E., Albert, E. D., Bodmer, W. F., et al. (2002) Nomenclature for 

factors of the HLA system 2002. Tissue Antigens 60, 407–464. 

7. Terasaki, P. I. and McClelland, J. D. (1964) Microdroplet assay of human cytotoxins. 

Nature 204, 998–1000.


8. Vartdal, F., Gaudernack, G., Funderud, S., et al. (1986) HLA class I and II typing 

using cells positively selected from blood by immunomagnetic isolation—a fast 

and reliable technique. Tissue Antigens 28, 301–312. 

9. Olerup, O. and Zetterquist, H. (1993) HLA-DR typing by PCR amplification with 

sequence-specific primers (PCR-SSP) in 2 hours; an alternative to serological DR 

typing in clinical practice including donor recipient matching in cadaveric transplantation. 

Tissue Antigens 39, 225–235. 

10. Bignon, J. D., Fernandez-Vina, M. A., Cheneau, M. L., et al. (1997) HLA DNA 

class II typing by PCR-SSOP: 12th International Histocompatibility Workshop 

experience, in HLA Genetic Diversity of HLA Functional and Medical Implication, 

Proceedings of the 12th International Histocompatibility Workshop, Vol. 1 

(Charron, D. ed.), EDK Press, Paris, pp. 21–25. 

11. Kennedy, L. J., Poulton, K. V., Thomson, W., et al. (1997) HLA class I DNA 

typing using sequence specific oligonucleotide probes (SSOP), in HLA Genetic 

Diversity of HLA Functional and Medical Implication, Proceedings of the 12th 

International Histocompatibility Workshop, Vol. 1 (Charron, D., ed.), EDK Press, 

Paris, pp. 216–225. 

12. Cao, K., Chopek, M., and Fernandez-Vina, M. A. (1999) High and intermediate 

resolution DNA typing systems for class I HLA-A, B, C genes by hybridisation 

with sequence specific oligonucleotide probes (SSOP). Rev, Immunogenet. 1, 

177–208. 

13. Buyse, I., Decorte, R., Baens, M., et al. (1993) Rapid DNA typing of class II HLA 

antigens using the polymerase chain reaction and reverse dot blot hybridisation. 

Tissue Antigens 41, 1–14. 

14. Patel, R. and Terasaki, P. I. (1969) Significance of the positive crossmatch test in 

kidney transplantation. N. Engl. J. Med. 280(14), 735–739. 

15. Opelz, G., Wujciak, T., Dohler, B., Scherer, S., and Mytilineos, J. (1999) HLA 

compatibility and organ transplant survival. Rev. Immunogenet. 1, 334–342. 

16. Dyer, P. A., Johnson, R. W., Martin, S., et al. (1989) Evidence that matching for 

HLA antigens significantly increases transplant survival in 1001 renal transplants 

performed in the northwest region of England. Transplantation 48(1), 

131–135. 

17. Festenstein, H., Doyle, P., and Holmes, J. (1986) Long-term follow-up in London 

Transplant Group recipients of cadaver renal allografts. The influence of HLA 

matching on transplant outcome. N. Engl. J. Med. 314(1), 7–14. 

18. Ayoub, G. and Terasaki, P. (1982) HLA-DR matching in multicenter, single-typing 

laboratory data. Transplantation 33(5), 515–517. 

19. Starzl, T. E., Eliasziw, M., Gjertson, D. J., et al. (1997) HLA and cross-reactive 

group matching for cadaveric kidney allocation. Transplantation 64, 983–991. 

20. Mange, K. C., Cherikh, W. S., Maghirang, J., and Bloom, R. D. (2001) A comparison 

of the survival of shipped and locally transplanted cadaveric renal allografts. 

N. Engl. J. Med.. 34 ,1237–1242. 

21. Oniscu, G. C., Plant, W., Pocock, P., and Forsythe, J. L. (2002) Scotland-Northern 

Ireland Alliance in conjunction with UK Transplant, United Kingdom. Does a


kidney-sharing alliance have to sacrifice cold ischemic time for better HLA matching? 


22. Eichhorn, E. J. (2001) Prognosis determination in heart failure. Am. J. Med. 110 

(Suppl. 7A), 14s–36s. 

23. Large, S. R.(2002) Is there a crisis in cardiac transplantation? Lancet 359, 803– 

803. 

24. Sheldon, S., Yonan, N. A., Aziz, T. N., et al. (1999) The influence of histocompatibility 

on graft rejection and graft survival within a single centre population of 

heart transplant recipients. Transplantation 68, 515–519. 

25. Smith, J. D., Rose, M. L., Pomerance, A., Burke, M., and Yacoub, M. H. (1995) 

Reduction of cellular rejection and increase in longer-term survival after heart 

transplantation after HLA-DR matching. Lancet 346(8986), 1318–1322. 

26. Opelz, G. and Wujciak, T. (1994) The influence of HLA compatibility on graft 

survival after heart transplantation. N. Engl. J. Med. 330(12), 816–819. 

27. Kerman, R. H., Van-Buren, C. T., Lewis, R. M., Frazier, O. H., Cooley, D., and 

Kahan, B. D. (1988) The impact of HLA A, B, and DR blood transfusions and 

immune responder status on cardiac allograft recipients treated with cyclosporine. 


28. Schulman, L. L., Weinberg, A. D., McGregor, C., Galantowicz, M. E., Suciu- 

Foca, N. M., and Itescu, S. (1998) Mismatches at the HLA-DR and HLA-B loci 

are risk factors for acute rejection after lung transplantation. Am. J. Respir. Crit. 

Care Med. 157, 1833–1837. 

29. Schulman, L. L., Weinberg, A. D., McGregor, C., Suciu-Foca, N. M., and Itescu, 

S. (2001) Influence of donor and recipient HLA locus mismatching on the development 

of obliterative bronchiolitis after lung transplantation. Am. J. Respir. Crit. 

Care Med. 163, 437–442. 

30. van den Berg, J. W., Hepkema, B. G., Geertsma, A., et al. (2001) Long-term outcome 

of lung transplantation is predicted by the number of HLA-DR mismatches. 


31. Chalermskulrat, W., Neuringer, I. P., Schmitz, J. L., et al. (2003) Human leukocyte 

antigen mismatches predispose to the severity of bronchiolitis obliterans syndrome 

after lung transplantation. Chest 123(6), 1825–1831. 

32. Donaldson, P., Underhill, J., Doherty, D., et al. (1993) Influence of human leukocyte 

antigen matching on liver allograft survival and rejection: “the dualistic 

effect.” Hepatology 17, 1008–1015. 

33. Niederkorn, J. Y. (2002) Immune privilege in the anterior chamber of the eye. 

Crit. Rev. Immunol. 22, 13–46. 

34. Bartels, M. C., Doxiadis, I. N., Colen, T. P., and Beekhuis, W. H. (2003) Longterm 

outcome in high-risk corneal transplantation and the influence of HLA-A 

and HLA-B matching. Cornea 22, 552–556. 

35. Charron D. (2003) Immunogenomics of hematopoietic stem cell transplantation. 

Transfus. Clin. Biol. 10, 156–158. 

36. Hurley, C. K., Wade, J. A., Oudshoorn, M., et al, on behalf of the Quality Assurance 

and Donor Registries Working Groups of the World Marrow Donor Asso-


ciation. (1999) A special report: histocompatibility testing guidelines for 

haematopoietic stem cell transplantation using volunteer donors. Hum. Immunol. 

60, 347–360. 

37. Mickelson, E. M., Petersdorf, E., Anasetti, C., Martin, P., and Hansen. J. A. (1998) 

HLA matching in haematopoietic cell transplantation, in HLA 1998 (Gjertson, D. 

W. and Terasaki, P. L., eds.), American Society for Histocompatibility and Immunogenetics, 

Lenexa, KS, pp. 47–56. 

38. Gaudieri, S., Longman-Jacobson, N., Tay, G. K., and Dawkins, R. L. (2001) 

Sequence analysis of the MHC class I region reveals the basis of the genomic 

matching technique. Hum. Immunol. 62(3), 279–285. 

39. Petersdorf, E. W., Hansen, J. A., Martin, P. J., et al. (2001) Major histocompatibility 

complex class I alleles and antigens in haematopoietic cell transplantation. 

N. Engl. J. Med. 345, 1794–1800. 

40. Kollman, C., Howe, C. W. S., Anasetti, C., et al. (2001) Donor characteristics as 

risk factors after transplantation of bone marrow from unrelated donors: the effect 

of donor age. Blood 97(7), 2043–2051.

Gene Transfer to Solid Organs 175 

8 

Strategies for Gene Transfer to Solid Organs 

Viral Vectors 

Charlotte Lawson 

Summary 

A major complication associated with transplantation of solid organs is immunological 

rejection, which is currently controlled pharmacologically with immunosuppressive 

drugs, which must be administered indefinitely and may have harmful side effects. Gene 

transfer to donor organs or recipient immune cells prior to transplantation could limit 

their use. The effects of transfer of candidate genes in experimental models of allograft 

rejection is outlined in this chapter, followed by a description of the features of an ideal 

gene-therapy vector. Finally, a brief overview of viral vector systems used commonly 

for gene transfer is presented. 

Key Words: Gene therapy; transplantation; viral vectors; retrovirus; adenovirus; 

adeno-associated virus; herpes simplex virus. 


Solid organ grafting remains the only cure for several end-stage diseases. A 

major complication associated with transplantation is immunological rejection 

of organs, which is currently controlled by systemic administration of immunosuppressive 

drugs indefinitely. This can lead to opportunistic infections and 

drug-specific toxicity. One of the major challenges in transplant immunology 

today is to overcome the need for such long-term regimes. Ex vivo gene transfer 

to donor organs or recipient immune cells prior to transplantation is an 

attractive approach. 

2. Genes To Be Delivered to Solid Organ Grafts 

Although at this time no gene-therapy trials are registered in either the United 

States (www4.od.nih.gov/oba/Rdna.htm) or the United Kingdom (www.doh. 



175

176 Lawson 

gov.uk/genetics/gtac) addressing the complications of solid organ transplantation, 

gene-transfer strategies have been employed in several animal models of 

allotransplantation using a number of different approaches. These therapies 

fall broadly into three categories: induction of immune tolerance, reduction of 

inflammatory responses, and prevention of ischemia/reperfusion (I/R) injury. 

2.1. Induction of Immune Tolerance 

A recent review (1) has described some of the strategies for the induction of 

immune tolerance of allografts by co-stimulatory blockade or molecular chimerism. 

Transfer of genes encoding soluble co-stimulatory molecules such as 

cytotoxic T-lymphocyte antigen-4-Ig or CD40-Ig can prolong survival of renal 

(2), islet (3), hepatic (4), or cardiac (5,6) allografts in rodent models. 

Donor-specific hyporesponsiveness has been achieved by transfer of autologous 

hematopoietic stem cells genetically modified to express donor-specific 

major histocompatibility complex (MHC) genes (molecular chimerism) in several 

rodent and large-animal allotransplantation models. This prolongs survival 

of renal and skin allografts (7–9) and can induce long-term T-cell tolerance (9). 

2.2. Cytokine Gene Transfer 

Cytokines play a critical role in modulating inflammation and cellular infiltration 

in transplanted organs. Proinflammatory and T-helper-type cytokines 

such as tumor necrosis factor, interferon (IFN)-γ, interleukin (IL)-8, IL-12, and 

IL-18 are upregulated during cold ischemia and are associated with poor outcome. 

It has been hypothesized, therefore, that overexpression of potent antiinflammatory 

cytokines such as IL-10 and IL-4 in graft tissue could limit 

ongoing inflammation and prevent further injury (10). Gene transfer of human 

(10), mouse (11), or viral (derived from Epstein-Barr virus BCRFI open reading 

frame [ORF] [12]) IL-10 in animal models of lung transplantation has been 

shown to prolong early graft function and reduce bronchial obliteration, while 

gene transfer of human (13) or viral (14,15) IL-10 has also been shown to 

prolong cardiac allograft survival. Gene transfer of IL-13, another anti-inflammatory 

cytokine, prior to allotransplantation modestly improved graft survival 

(16). Intracoronory transfer of transforming growth factor-β gene to donor 

hearts was also beneficial (14). In contrast, administration of autologous dendritic 

cells engineered to express IL-4 prior to transplantation led to enhanced 

pro-inflammatory gene expression and accelerated organ rejection of murine 

cardiac allografts (17). 

2.3. Modulation of Ischemia/Reperfusion Injury 

Nonallospecific processes also have an important role in graft survival, not 

least of which are inflammatory responses and I/R injury to donor organs at


time of transplantation. Several studies have examined the possibility of reducing 

the impact of this damage by transduction of potentially cytoprotective 

genes. Transduction of rat hearts with heat-shock proteins-70 and -72 or IL-1 

receptor antagonist using inactivated hemagglutinating virus of Japan prior to 

heterotopic transplantation has been shown to reduce I/R injury (18–20), 

whereas in a model of liver transplantation, gene transfer of copper–zinc superoxide 

dismutase led to indefinite graft survival and reduction in necrosis (21, 

22). Catalase and hemoxygenase-1 can also protect against I/R injury (21–27). 

2.4. Inhibition of Vasculopathy 

Vasculopathy is a well-described feature of chronic rejection of solid organ 

allografts comprising formation of an extensive neointima within grafted vessels. 

The lesion is similar in many respects to the lesion seen after restenosis 

injury with proliferation of smooth muscle cells, recruitment of inflammatory 

and hematopoietic cells, platelet aggregation, and thrombus formation. Several 

studies have shown that overexpression of genes that negatively regulate cellular 

proliferation in vitro can reduce neointima formation in vivo in animal models 

of restenosis injury (28). Overexpression of the cyclin-dependent kinase 

inhibitor p27kip1 (29) or a fusion protein of p27kip1 and p16Ink4 (30) attenuated 

smooth muscle cell proliferation and neointima formation in a balloon-injured 

porcine artery model. Inhibition of transcriptional activity of the transcription 

factor E2F by expression of a constitutively active form of Rb, a negative regulator 

of cell-cycle regulation (31), or Rb2 (32) or Rb-E2F fusion protein (33) 

has also all been shown to be effective in limiting neointima formation. The 

transfer of similar genes to allografts could prolong graft function beyond current 

expectations. 

2.5. RNA Interference 

An exciting possibility for the future is the inhibition of genes that may 

promote allo-immune reactions (e.g., co-stimulatory molecules, adhesion molecules, 

cytokines, or their receptors). Delivery of antisense oligodeoxynucleotides 

to intercellular adhesion molecule-1, using nonviral methods, to allografts 

at the time of implantation has been described and has been shown improve 

graft survival (34–36). The efficacy of such approaches may be improved with 

the development of techniques for RNA interference. This is a conserved process 

that involves the silencing of specific genes with double-stranded RNA 

(37,38). Short double-stranded RNA oligonucleotides (small interfering RNA 

[siRNA]) have been shown to “knock down” specific genes in vitro (39–41), 

whereas adenovirus vectors encoding the sequence required to produce complementary 

strands of siRNA attached via a linker can infect cells, leading to gene 

silencing of targeted genes in vitro (42) and in vivo (43). Recently, gene silenc-

178 Lawson 

ing of Fas has been achieved in vivo, leading to significant amelioration of 

fulminant hepatitis (44). 

3. General Considerations for Gene Transfer 

Although there are some examples of efficient transfer of naked DNA into 

cells and tissues, introduction of genetic material into most sites requires the 

use of a vector to efficiently deliver the DNA to cells. The ideal gene-therapy 

vector has several properties, which are outlined here. Current research into 

the development of vectors for gene therapy can be divided into viral and 

nonviral vector-mediated gene delivery. The relative advantages and disadvantages 

of both delivery methods are discussed in the next chapter. 

1. Efficient delivery of DNA: In general, naked DNA is very inefficiently taken up 

by cells, so there has been much effort to improve gene delivery using either 

modified viruses (viral vectors; see below) or refining nonviral delivery by targeting 

to cell-surface proteins (discussed in the following chapter). 

2. Safety: Vectors must not be pathogenic or toxic to patients. Although nonviral 

delivery systems are considered to be a relatively safe method of gene transfer, 

there are several safety concerns with viral vectors. One concern is that recombination 

events could occur in vivo between endogenous viral elements and transduced 

viral vectors, leading to the formation of potentially pathogenic 

replication-competent virus. Second, although the integration of introduced 

genetic material into the host cell genome is desirable, since it leads to longer 

term expression of the transgene, it carries with it the risk of insertional mutagenesis 

and activation of oncogenes. Introduction of plasmid DNA (either naked or 

packaged) is not without risk, however. A recent study has shown that bacterial 

lipopolysaccharide (LPS) contamination is an obligatory contaminant of plasmid 

DNA purified from bacteria by standard laboratory procedures and cannot be 

completely removed from plasmid preparations. Thus, introduction of plasmid 

DNA could have pathological consequences, triggering LPS-mediated toxicity 

in vivo (45). In addition, selectable markers derived from bacterial genomes, 

which may be incorporated into vectors for ex vivo propagation, could be antigenic 

if they enter the hematopoietic cell lineage. It is possible for protein to be 

expressed, which could be presented in MHC class I and cause CD8 T-cell immune 

responses (i.e., genetic immunization could occur). This could be detrimental to 

the patient (46). 

3. Specificity: It is important to avoid unpredictable side effects because of the ectopic 

expression of the transgene in normal tissues (in the context of transplantation these 

are recipient tissues). 

4. Regulation: This is a highly desirable property, allowing for activation of a transgene 

when needed, maintenance of transgene expression within a therapeutic 

window, and the possibility of silencing if necessary. There has been some success 

in vitro and in animal models using antibiotic-responsive promoters (e.g., 

TetON) (47) or use of a hypoxia switch (48–50), which may be of particular use 

in the transplant setting.


5. Delivery of any gene, whatever size or function: In theory, there is no limit to the 

size of DNA that can be delivered by nonviral methods of gene transfer. On the 

other hand, there is often a limit to the amount of foreign DNA that can be inserted 

into viral vectors depending on the size of the wild-type viral genome and the number 

of viral genes deleted because inserts much larger than the endogenous DNA 

that has been removed will not be efficiently packaged by viral structural proteins. 

6. High-level and long-term expression: DNA delivered by nonviral methods can 

be rapidly removed from cells by lysosomal degradation. There are many strategies 

to overcome this (see Chapter 9). Viral transfer of DNA is more efficient 

than nonviral transfer, and viruses have evolved strategies to avoid degradation 

within the host cell. However, immunogenicity of viral genes, necessary for transduction 

of target cells, may limit the duration of transgene expression. 

7. Cost-effectiveness: Vectors should be inexpensive to produce in large quantities. 

The production of sufficient quantities of viruses for gene-therapy applications 

often requires complex purification procedures and quality-control measures. On 

the other hand, vectors for nonviral transfer of DNA take less time to prepare, do 

not require such stringent quality control assays before use, and have less batchto-batch 

variation in potency. 

4. Viral Vectors 

The viral life cycle has evolved to efficiently transfer genetic material into 

host cells (infection) followed by expression of viral proteins and assembly of 

new viral particles (replication). Gene-therapy vectors have been developed 

that take advantage of the viral life cycle with a modified genome carrying a 

therapeutic gene cassette in place of the viral genome. Transduction is defined 

as the abortive (nonreplicative) infection introducing functional genetic information 

expressed from recombinant vectors in target cells. 

The viral genome comprises genes required for replication and infection as 

well as cis-acting regulatory sequences. In order to improve safety and prevent 

reconstitution into productive viral particles by recombination events, where 

possible most viral genes and regulatory sequences are removed during construction 

of viral vector plasmids. It has been found that viral genes can be 

expressed in trans on separate plasmids in “helper” or “packaging” cells to 

ensure stability and limit remobilization (51). Packaging cells are engineered 

eukaryotic cells that express viral proteins needed for propagation of vectors. 

This is generally achieved by permanent transfection of plasmids encoding 

viral proteins into cultured cell lines. Packaging cell lines typically express the 

viral proteins required to package the vectors but lack a packaging signal. In 

contrast, viral vector plasmids typically lack some or all of the genes required 

for propagation, but they will have a packaging signal and other virally encoded 

essential regulatory sequences, as well as a strong constitutive promoter (sometimes 

endogenous to the original virus or from other viruses, e.g., cytomegalovirus 

[CMV] early promoter) and polyadenylation signals. They may also

180 Lawson 

contain sequences required for efficient propagation of the vector in bacteria 

and a multicloning site for cloning of insert DNA. To further minimize replication-competent 

virus production, these genes may be encoded on more than 

one separate plasmid. Shuttle vectors or gutless vectors encoding only the gene 

of interest together with a strong promoter and polyadenylation sequences and 

essential viral packaging signals have also been employed in different viral 

delivery systems. Helper viruses are not often used because of the likelihood 

that a replication-competent virus could be generated through high-frequency 

recombination (52) (Fig. 1). 

Several different virus families have been exploited for gene therapy-applications 

owing to the efficiency of infection and cell tropism (Table 1). A brief 

overview of viral vector systems used commonly for gene transfer is given 

here. 

5. Retroviruses 

Retroviruses are RNA viruses that replicate through an integrated DNA intermediate 

(see ref. 53 for full description). Retroviral particles encapsulate two 

copies of the full-length viral RNA, each copy containing the full genetic information 

needed for virus replication, including the gag (group-specific antigen), 

pro (protease), pol (polymerase), and env (envelope) genes. Retroviruses can be 

classified into simple and complex retroviruses. Complex viruses encode the 

essential viral genes above as well as several accessory genes. Further classification 

divides retroviruses into oncoretroviruses (mostly simple retroviruses, e.g., 

murine leukemia virus [MLV]), lentiviruses (complex retroviruses, e.g., human 

immunodeficiency virus-1 [HIV-1]), and spumaviruses (complex retroviruses, 

e.g., human foamy virus). Currently all three types are being exploited as genetherapy 

tools. (For recent reviews see refs. 52, 54, and 55.) 

Fig. 1. (opposite page) Strategy for viral vector production. (A) Typical viral genome 

with essential viral genes, regulatory sequences, and packaging signal. In order to produce 

replication deficient viral vectors, the genetic material is separated onto (B) plasmid 

encoding viral packaging signal and minimum viral regulatory sequences, and 

(C) helper plasmids encoding essential viral genes required for viral replication and 

packaging. (D) Production of packaging cell line by transfection of helper plasmids. 

(E) Production of producer cell line by transfection of packaging cell line with viral 

vector plasmid. (F) Isolation and purification of virus particles from producer cell 

culture supernatants (e.g., retrovirus vectors) or lysates (e.g., Ad5 vectors). (G) Infection 

of target cells with viral vectors and (H) expression of protein of interest in target 

cells (can be secreted, cell surface, or intracellular protein or could be siRNA to inhibit 

expression of endogenous protein).

Gene Transfer to Solid Organs 181

182 

Table 1 

Characteristics of Commonly Used Viral Vectors 

Characteristics Advantages/future potential Drawbacks 

Oncoretrovirus Single-stranded RNA Relatively high titers Risk of insertional mutagenesis 

simple retrovirus (10 8 –10 7 cfu/mL) Possibility of formation of replication- 

Broad cell tropism competent retrovirus by homologous 

Viral genome integration leading recombination with HERVs 

to long-term expression of transgene Degradation of virus particles by 

transgene complement 

No toxic effects on infected cells Only infect dividing cells 

Up to 10 kb can be inserted 

Lentivirus Single-stranded RNA Can infect nondividing cells Possible serum convesion to HIV-1 

complex retrovirus Expanded cell tropism by pseudotyping (current generation vectors) 

Stable gene expression due to Insertional mutagenesis 

integration of viral genome Presence of tat and rev regulatory 

Relatively high titres proteins may cause immune 

(10 6 –10 7 cfu/mL) response 

Up to 10 kb can be inserted Possible recombination with HERVs 

leading to replication-competent virus 

Foamy vius Complex retrovirus Stable gene expression due to viral Risk of insertional mutagenesis 

with some simular- genome integration Recombination with HERVs 

ities to herpes simplex Innocuous to natural hosts in vivo, Serum conversion to human foamy virus 

virus life cycle although cytopathic to cells in culture (not shown to be pathogenic to humans 

Humans are “dead-end hosts” accidentally infected) 

Resistant to complement-mediated lysis 

Can be pseudotyped 

Relatively high titers (10 6 –10 7 cfu/mL) 

Up to 14 kb can be inserted 

182 Lawson

183 

Adenovirs (Ad) Nonenveloped virus with Very high titers (10 12 pfu/mL) Inflammatory and cytotoxic host 

linear double-standed High levels of gene expression immune responses 

DNA genome (transient) Preformed neutralizing antibodies to 

Can infect nondividing cells Ad particles 

Up to 7 kb can be inserted Not suitable for long-term expression 

(can be greater if more of Ad of gene since no integration into 

genome is detected) host cell genome 

Complicated vector genome 

Adeno- Small nonenveloped Wide cell tropism Difficult to purify 

associated virus single-stranded DNA Infection of nondividing cells Helper virus (Ad or HSV) may be 

(AAV) genome High titers (10 10 cfu/mL) required for propagation 

Belongs to Parvoviridae Possibility of latent infection Preformed neutralizing antibodies to 

family and integration into host cell AAV 

genome 

Up to 4 kb can be inserted Integration into host cell genome is 

Nonpathogenic, nontoxic not directed in AAV vectors and 

could result in insertional 

mutagenesis 

Herpes simplex Large enveloped double- Titres in the range (10 4 –10 8 cfu/mL) Inflammatory and toxic reactions 

virus (HSV) stranded DNA virus Up to 30 kb can be inserted in patients 

152 kb genome (including multiple genes) Complicated genome and 

Wild-type HSV is highly No integration into host cell genome propagation 

pathogenic Long-term episomal expression of 

transgene in neuronal cells 

Cytopathic effects in cancer cell 

HERV, human endogenous retrovirus. 

Gene Transfer to Solid Organs 183

184 Lawson 

5.1. Oncoretroviruses 

To date, several registered gene-therapy trials using retroviral transfer have 

used vectors based on MLV, an amphotropic (able to infect human cells) 

oncoretrovirus. Oncoretroviruses have a relatively simple genome, which can be 

easily rearranged to generate replication-defective recombinant viral vectors. In 

general, they retain retroviral long-terminal repeat sequences, a minimal packaging 

signal, and the gene of interest. Recombinant replication-defective particles 

are produced after transfection of oncoretroviral vectors (e.g., pMFG [56], pBAbe 

series [57]) into a suitable eukaryotic packaging cell line (e.g., Omega E; GP+E; 

GP EnvAm12 [57–59]). One disadvantage is that these vectors require dividing 

cells to be taken up and integrated into the host cell genome for long-term 

expression of the transgene. Therefore, their usefulness may be limited in clinical 

applications in which nondividing cells are the targets for gene therapy (60). 

5.2. Lentiviruses 

There has been some progress in the development of vectors based on 

lentiviruses, in particular HIV-1. The lentiviruses have a more complex genome 

than oncoretroviruses and therefore a more complex replication cycle. Lentiviruses 

are able to infect nondividing and terminally differentiated cell types, 

which is a major advantage over oncoretrovirus vectors for gene-therapy applications 

(60). The development of lentivirus vectors and packaging cell lines has 

been more difficult than that of oncoretrovirus vector-delivery systems. Early 

vectors based on HIV were nearly intact viral genomes with the env gene deleted 

and substituted in trans. This enabled the vectors to target CD4-expressing cells 

efficiently, but targeting to other cells was limited, and viral titers were low. 

Substitution of the amphotropic MLV envelope glycoprotein broadened the celltype 

specificity of these vectors (61), while vesicular stomatitis virus-G-protein 

(VSV-G) improved vector titer and greater stability of virus particles (62). This 

is known as pseudotyping. Literally, a pseudotyped virus is one in which one or 

more of the structural proteins of each virus particle are not encoded by the 

genetic material carried by the virus. However, in the gene-transfer field a 

pseudotyped virus is one in which the outer shell (the use of envelope glycoproteins 

from an enveloped virus or the capsid proteins from a nonenveloped virus) 

originates from a virus that differs from the source of the genome and replication 

apparatus (for review see ref. 63). 

A second approach was to delete almost all of the viral genome, leaving 

only a few essential cis-acting sequences and providing viral proteins in trans. 

Early attempts relied on co-transfection of viral vectors with helper DNA plasmid 

constructs. However, this strategy resulted in low titers and increased the 

risk for generation of recombinant replication-competent virus. The newest 

vectors (e.g., VSV-G pseudotyped HIV-1 vectors) can be produced with rela-


tively high titers (64–66). They are able to infect cell cycle-arrested cells in 

culture as well as retinal, muscle, and hepatic cells in vivo with stable expression 

for several months (64,67–69). 

There are now many lentiviral vectors are based on HIV-1 in part because of 

the huge amount of research into HIV-1 biology. However, owing to concerns 

over safety, vectors have also been developed from other lentiviruses, which 

are less pathogenic to humans, including HIV-2 and simian immunodeficiency 

virus, as well as from feline lentivirus (feline immunodeficiency virus). Chimeric 

lentivirus vector systems have also been developed. Pseudotyping with 

VSV-G combined with strong promoters such as CMV promoter has been used 

to improve cell tropism and transgene expression (55). 

5.3. Spumaviruses 

Spumaviruses or foamy viruses (FVs) are so named because of the cytopathic 

foam effect they induce in culture. They are complex retroviruses encoding 

three accessory genes designated bel1, bel2, and bel3 (70,71). They are 

innocuous in their natural hosts, which are mainly primates, although nonprimate 

FVs have been identified (72), and appear to be absent in humans. There 

have been some cases of accidental infection in humans, but they appear to be 

apathogenic (73), and there have been no reports of horizontal transmission, 

suggesting that humans may represent dead-end hosts (74). They persist indefinitely 

in their hosts, even in the presence of antibodies directed against FV 

proteins (75). There is a striking similarity between the replication cycles of FV 

and hepatitis B virus (76). 

FVs are highly lytic in culture and have a large cellular tropism (77). FV vectors 

have been developed that contain only the minimal viral sequences necessary 

for efficient gene transfer. This vector has been shown to transduce human 

hematopoietic CD34 + cells and human mesenchymal stem cells in vitro using a 

four-plasmid packaging cell system (78). Because of the lack of endogenous 

human FV, the apathogenicity after accidental infection, lack of horizontal 

transmission, ability to infect nondividing cells, and wide cell tropism, FVs are 

a promising prospect for future gene-therapy applications. 

6. Adenoviruses 

Adenoviruses (Ads) are nonenveloped viruses with a linear double-stranded 

DNA genome. There are 50 distinct serotypes in humans. They are associated 

with the common cold and can cause respiratory, intestinal, and eye infections 

in humans (79,80). Ads have been widely used for gene transfer because they 

have a broad host range and can infect proliferating or nondividing cells. Infection 

with Ad vectors lead to transient gene expression because the Ad genome 

does not integrate into the host cell genome.

186 Lawson 

The genome is functionally divided into early (E) and late (L) regions based 

on the time of transcription of each gene after infection, with inverted terminal 

repeats (ITRs) at either end (80–82). Ad enters the host cell via specific cellsurface 

receptors, including the well-described coxsackievirus and Ad receptor 

(83). It is internalized rapidly via receptor-mediated endocytosis, facilitated 

via receptors including integrins αvβ3 and αvβ5 (84). 

Many types of Ad vectors have been developed, including replication-competent 

and replication-defective vectors, mostly based on serotype 2 (Ad2) or 

serotype 5 (Ad5). The first generation of Ad vectors were E1- and E3-deleted. 

The second generation includes E1-, E3-, and E4- or E2-deleted vectors based 

on Ad5. E1-deleted Ad5 vectors are replication defective, but they can be 

grown in specific cell lines transformed with Ad E1, e.g., human embryonic 

kidney 293 cells (85), to supply E1 in trans. Deletions of up to 3.2 kb can be 

made in the E1 region. The nonessential E3 region has also been deleted to 

accommodate larger inserts. The left-hand ITR and packaging signals from the 

left-hand 300 bp of the genome are required for replication in 293 cells (86). 

First-generation Ad vectors were only transiently expressed due to a strong 

immune response elicited by the viral proteins. The use of immunosuppressive 

drugs could be used to extend transgene expression in the eye (87), lungs (88), 

and in a model of cardiac transplantation (89). 

Second-generation Ad vectors have overcome Ad immunogenicity to some 

extent by introduction of a mutation in the Ad E2a gene (90–92) or deletion in 

E4 (93). However, these modifications did not mediate significant prolongation 

of transgene expression compared to first-generation Ad vectors (94). 

A gutted (or gutless) Ad vector has been developed with all of the viral 

genes deleted in order to reduce immunogenicity. It contains only the ITR 

required for replication and 5'-cis-acting Ad encapsulation signals necessary 

for packaging (95–100). However, this vector is difficult to produce, requiring 

the use of helper virus to provide all the viral proteins in trans (80). 

7. Adeno-Associated Virus 

Adeno-associated virus (AAV) is a small nonenveloped, single-stranded 

DNA virus belonging to the parvoviridae group (for review, see ref. 101). 

There are two ORFs encoding for nonstructural proteins (Rep) and capsid proteins 

(Cap). ITR sequences at each end of the genome have been identified as 

the only cis-acting elements required for replication, packaging, and integration 

of AAV. Thus, AAV vectors can be generated by removal of ORFs with 

the gene of interest, between the two ITRs, giving AAV vectors a packaging 

capacity of 4.1–4.9 kb (102). 

Between 50 and 90% of the population is seropositive for AAV. There is no 

conclusive evidence of any association of AAV with pathology at this time. Six


AAV serotypes have been identified in primates. Serotype 2 has been isolated 

from humans and extensively studied. Heparin sulfate proteoglycan, fibroblast 

growth factor-R1, and αvβ5 have been identified as primary and co-receptors 

for AAV (80). 

AAV is dependent on the presence of a helper virus for propagation, usually 

Ad or herpesvirus (103,104). Some genotoxic agents may also induce AAV to 

replicate (105–107). In the absence of help, AAV integrates into human chromosome 

19 at a particular locus on q13.3qter and establishes latency. After 

co-infection with the helper virus, the AAV genome is rescued, replicated, and 

encapsidated into progeny viruses (108–110). 

AAV vectors have been produced by co-transfection of the AAV plasmid 

together with AAV helper plasmid containing the Rep and Cap genes into a 

human cell line (e.g., ref. 293). Early vectors required infection with helper 

Ad, but this has been eliminated by co-transfection of plasmids encoding Ad 

E2A, E4orf6, and VA RNA transcription units (80), eliminating the possibility 

of infection of the host with replication-competent helper Ad and subsequent 

adverse immune responses. 

Site-specific integration of latent AAV into human chromosome 19q13.3qter 

has generated much interest. However, this process requires AAV Rep 

proteins, which are not present in AAV vectors, although transgene expression 

has been reported for months and up to several years in some in vivo 

models (111–116), possibly owing to the presence of long-lived doublestranded 

episomal rAAV genomes (117–120) or random integration into the 

host cell genome (96,121–125). 

AAV vectors have been used to deliver transgenes to proliferating and quiescent 

cells of various species in vitro and in vivo, including muscle, liver, 

lung central nervous system, eye, and heart (111,112,114,121,126–129). One 

difficulty that has been encountered is a variation in transduction efficiency 

between different cell types. 

One advantage of using AAV vectors has been the apparent lack of induction 

of cellular immune responses, possibly because of the fact that the only 

genes expressed are the viral capsid and the transgene or the poor transduction 

of antigen-presenting cells. Lack of immunogenicity may account for the 

prolonged expression of transgenes in vivo. There is limited activation of the 

innate immune system and chemokine production, but to a lesser extent than 

for Ad (130). Humoral responses to AAV have been detected in animal models, 

and the presence of neutralizing antibodies greatly reduces the success of 

vector re-administration (131,132). Up to 32% of human subjects could have 

preformed neutralizing antibodies to AAV-2 (133), which could limit the usefulness 

of AAV for gene-therapy applications (80).

188 Lawson 

8. Herpes Simplex Virus-1 

Herpes simplex virus-1 (HSV-1) is a relatively large enveloped double-stranded 

DNA virus with a 152-kb genome, encoding at least 89 proteins with well-characterized 

disease pathology (134,135). Wild-type HSV-1 is a highly pathogenic 

virus, infecting mucosal epithelial tissue with subsequent lysis of the infected 

cells. The virus infects sensory neurons and is transported to the nucleus of the 

neuron. The virus then enters either a lytic or a latent state, both of which are 

attractive to exploit for gene-therapy applications (136–139). The lytic cycle of 

HSV-1 has been exploited for cancer therapy with attenuated replication-competent 

HSV-1 (140–142). In the latent state, viral DNA remains extrachromasomal, 

with only latency-associated transcripts being transcribed. This process 

is poorly understood but is attractive to gene therapists. 

Given the relatively large size of HSV-1, the major benefit of utilizing replication-defective 

HSV-1 rather than other viral transfection systems is the ability 

to insert large and/or multiple foreign genes into these vectors. Also, HSV-1 

has a relatively large cell tropism, and the genome remains extrachromasomal, 

minimizing risks of insertional mutagenesis. 

HSV-1 genes have been classified as essential or nonessential, depending 

on their requirement for viral replication in cell culture. However, even genes 

classified as nonessential are important for HSV-1 replication, and so HSV-1 

mutants have been categorized as either helper virus dependent or independent. 

The helper virus-dependent viruses are also termed amplicons and consist 

minimally of packaging sequences and an origin of viral DNA replication 

(143,144). Helper virus-independent viruses (replication defective) have deletions 

in one or more essential genes (e.g., deletion of immediate early genes a 

4, a 22, and a 27) (145) and can be grown in packaging cell lines that express 

the essential gene(s) to provide the gene product in trans. 

It is possible to insert up to 12 kb of new genetic material into a replicationdefective 

HSV-1 vector by deletion of essential genes (immediate early genes) 

as well as nonessential genes. In one such vector, genes encoding IL-2, granulocyte-macrophage–colony-stimulating 

factor, B7.1, and LacZ or IFN-γ were 

inserted as separate transcriptional units and simultaneously expressed in vitro 

in primary melanoma cells for up to 1 wk (146) or L929 tumors (147). HSV-1 

replication-defective vectors are therefore an attractive tool in the transplant 

setting because genes to induce tolerance, limit I/R injury, and dampen inflammatory 

responses could all be combined into one vector for delivery. 

9. Summary 

Gene transfer to donor organs remains an exciting possibility for the future 

in that it could overcome the need for lifelong immunosuppression of recipients 

and allow the implantation of allogeneic or xenogeneic organs without adverse


consequences. At this time there are no registered trials for human gene therapy 

to prolong allograft survival, but several research groups are focusing on prolongation 

of allograft function using gene-transfer technology. Most of these 

studies have used viral methods of gene transfer, which, as outlined above, 

provide an effective route of administration, although concerns about safety, 

immunogenicity, and longevity of expression of transgenes may limit the use of 

current generations of viral vectors in human transplantation gene-therapy trials. 

However, many gene-therapy trials using viral vectors have been approved 

and have shown minimal harmful side effects in other areas of medicine, and 

research continues to improve vector safety and efficiency. 

Acknowledgments 

CL is supported by a British Heart Foundation Intermediate Fellowship and 

grants from the Harefield Research Foundation and Royal Brompton and 

Harefield NHS Trust Clinical Research Committee. 

References 

1. Bagley, J. and Iacomini, J. (2003) Gene therapy progress and prospects: gene 

therapy in organ transplantation. Gene Ther. 10, 605–611. 

2. Tomasoni, S., Azzollini, N., Casiraghi, F., Capogrossi, M. C., Remuzzi, G., and 

Benigni, A. (2000) CTLA4Ig gene transfer prolongs survival and induces donorspecific 

tolerance in a rat renal allograft. J. Am. Soc. Nephrol. 11, 747–752. 

3. Takehara, M., Murakami, M., Inobe, M., et al. (2001) Long-term acceptance of 

allografts by in vivo gene transfer of regulatable adenovirus vector containing 

CTLA4IgG and loxP. Hum. Gene Ther. 12, 415–426. 

4. Nomura, M., Yamashita, K., Murakami, M., et al. (2002) Induction of donorspecific 

tolerance by adenovirus-mediated CD40Ig gene therapy in rat liver transplantation. 


5. Matsuno, Y., Iwata, H., Yoshikawa, S., et al. (2002) Suppression of graft coronary 

arteriosclerosis by gene gun-mediated CTLA4-Ig gene transfer. Transplant. 

Proc. 34, 2619–2621. 

6. Guillot, C., Guillonneau, C., Mathieu, P., et al. (2002) Prolonged blockade of 

CD40-CD40 ligand interactions by gene transfer of CD40Ig results in long-term 

heart allograft survival and donor-specific hyporesponsiveness, but does not prevent 

chronic rejection. J. Immunol. 168, 1600–1609. 

7. Heim, D. A., Hanazono, Y., Giri, N., et al. (2000) Introduction of a xenogeneic 

gene via hematopoietic stem cells leads to specific tolerance in a rhesus monkey 

model. Mol. Ther. 1, 533–544. 

8. Sonntag, K. C., Emery, D. W., Yasumoto, A., et al. (2001) Tolerance to solid 

organ transplants through transfer of MHC class II genes. J. Clin. Invest. 107, 

65–71. 

9. Bagley, J., Tian, C., Sachs, D. H., and Iacomini, J. (2002) Induction of T-cell 

tolerance to an MHC class I alloantigen by gene therapy. Blood 99, 4394–4399.

190 Lawson 

10. de Perrot, M., Fischer, S., Liu, M., et al. (2003) Impact of human interleukin-10 

on vector-induced inflammation and early graft function in rat lung transplantation. 

Am. J. Respir. Cell Mol. Biol. 28, 616–625. 

11. Shoji, F., Yonemitsu, Y., Okano, S., et al. (2003) Airway-directed gene transfer 

of interleukin-10 using recombinant Sendai virus effectively prevents post-transplant 

fibrous airway obliteration in mice. Gene Ther. 10, 213–218. 

12. Itano, H., Mora, B. N., Zhang, W., et al. (2001) Lipid-mediated ex vivo gene 

transfer of viral interleukin 10 in rat lung allotransplantation. J. Thorac. 

Cardiovasc. Surg. 122, 29–38. 

13. Hong, Y. S., Laks, H., Cui, G., Chong, T. ,and Sen, L. (2002) Localized immunosuppression 

in the cardiac allograft induced by a new liposome-mediated IL-10 

gene therapy. J. Heart Lung Transplant. 21, 1188–1200. 

14. Brauner, R., Nonoyama, M., Laks, H., et al. (1997) Intracoronary adenovirusmediated 

transfer of immunosuppressive cytokine genes prolongs allograft survival. 

J. Thorac. Cardiovasc. Surg. 114, 923–933. 

15. DeBruyne, L. A., Li, K., Chan, S. Y., Qin, L., Bishop, D. K., and Bromberg, J. 

S. (1998) Lipid-mediated gene transfer of viral IL-10 prolongs vascularized cardiac 

allograft survival by inhibiting donor-specific cellular and humoral immune 

responses. Gene Ther. 5, 1079–1087. 

16. Ke, B., Shen, X. D., Zhai, Y., et al. (2002) Heme oxygenase 1 mediates the 

immunomodulatory and antiapoptotic effects of interleukin 13 gene therapy in 

vivo and in vitro. Hum. Gene Ther. 13, 1845–1857. 

17. Kaneko, K., Wang, Z., Kim, S. H., Morelli, A. E., Robbins, P. D., and Thomson, 

A. W. (2003) Dendritic cells genetically engineered to express IL-4 exhibit 

enhanced IL-12p70 production in response to CD40 ligation and accelerate organ 

allograft rejection. Gene Ther. 10, 143–152. 

18. Suzuki, K., Murtuza, B., Sammut, I. A., et al. (2002) Heat shock protein 72 

enhances manganese superoxide dismutase activity during myocardial 

ischemia-reperfusion injury, associated with mitochondrial protection and apoptosis 

reduction. Circulation 106, I270–1276. 

19. Suzuki, K., Murtuza, B., Smolenski, R. T., et al. (2001) Overexpression of 

interleukin-1 receptor antagonist provides cardioprotection against ischemiareperfusion 

injury associated with reduction in apoptosis. Circulation 104(12 

Suppl 1), I308–I313. 

20. Jayakumar, J., Suzuki, K., Sammut, I. A., et al. (2001) Heat shock protein 70 

gene transfection protects mitochondrial and ventricular function against 

ischemia-reperfusion injury. Circulation 104, I303–307. 

21. Lehmann, T. G., Wheeler, M. D., Schoonhoven, R., Bunzendahl, H., Samulski, 

R. J.,and Thurman, R. G. (2000) Delivery of Cu/Zn-superoxide dismutase genes 

with a viral vector minimizes liver injury and improves survival after liver transplantation 

in the rat. Transplantation 69, 1051–1057. 

22. Lehmann, T. G., Wheeler, M. D., Schwabe, R. F., et al. (2000) Gene delivery of 

Cu/Zn-superoxide dismutase improves graft function after transplantation of fatty 

livers in the rat. Hepatology 32, 1255–1264.


23. Zhu, H. L., Stewart, A. S., Taylor, M. D., Vijayasarathy, C., Gardner, T. J. ,and 

Sweeney, H. L. (2000) Blocking free radical production via adenoviral gene transfer 

decreases cardiac ischemia-reperfusion injury. Mol. Ther. 2, 470–475. 

24. Kato, H., Amersi, F., Buelow, R., et al. (2001) Heme oxygenase-1 overexpression 

protects rat livers from ischemia/reperfusion injury with extended cold preservation. 


25. Coito, A. J., Buelow, R., Shen, X. D., et al. (2002) Heme oxygenase-1 gene transfer 

inhibits inducible nitric oxide synthase expression and protects genetically fat 

Zucker rat livers from ischemia-reperfusion injury. Transplantation 74, 96–102. 

26. Ke, B., Shen, X. D., Melinek, J., et al. (2001) Heme oxygenase-1 gene therapy: a 

novel immunomodulatory approach in liver allograft recipients? Transplant. 

Proc. 33, 581–582. 

27. Ke, B., Buelow, R., Shen, X. D., et al. (2002) Heme oxygenase 1 gene transfer 

prevents CD95/Fas ligand-mediated apoptosis and improves liver allograft survival 

via carbon monoxide signaling pathway. Hum. Gene Ther. 13, 1189–1199. 

28. Crook, M. F. and Akyurek, L. M. (2003) Gene transfer strategies to inhibit 

neointima formation. Trends Cardiovasc. Med. 13, 102–106. 

29. Tanner, F. C., Boehm, M., Akyurek, L. M., et al. (2000) Differential effects of 

the cyclin-dependent kinase inhibitors p27(Kip1), p21(Cip1), and p16(Ink4) on 

vascular smooth muscle cell proliferation. Circulation 101, 2022–2025. 

30. Tsui, L. V., Camrud, A., Mondesire, J., et al. (2001) p27-p16 fusion gene inhibits 

angioplasty-induced neointimal hyperplasia and coronary artery occlusion. Circ. 

Res. 89, 323–328. 

31. Chang, M. W., Barr, E., Lu, M. M., Barton, K., and Leiden, J. M. (1995). Adenovirus-mediated 

over-expression of the cyclin/cyclin-dependent kinase inhibitor, 

p21 inhibits vascular smooth muscle cell proliferation and neointima 

formation in the rat carotid artery model of balloon angioplasty. J. Clin. Invest. 

96, 2260–2268. 

32. Claudio, P. P., Fratta, L., Farina, F., et al. (1999) Adenoviral RB2/p130 gene 

transfer inhibits smooth muscle cell proliferation and prevents restenosis after 

angioplasty. Circ. Res. 85, 1032–1039. 

33. Wills, K. N., Mano, T., Avanzini, J. B., et al. (2001) Tissue-specific expression 

of an anti-proliferative hybrid transgene from the human smooth muscle alphaactin 

promoter suppresses smooth muscle cell proliferation and neointima formation. 

Gene Ther. 8, 1847–1854. 

34. Poston, R. S., Mann, M. J., Hoyt, E. G., Ennen, M., Dzau, V. J., and Robbins, R. 

C. (1999) Antisense oligodeoxynucleotides prevent acute cardiac allograft rejection 

via a novel, nontoxic, highly efficient transfection method. Transplantation 

68, 825–832. 

35. Feeley, B. T., Poston, R. S., Park, A. K., et al. (2000) Optimization of ex vivo 

pressure mediated delivery of antisense oligodeoxynucleotides to ICAM-1 reduces 

reperfusion injury in rat cardiac allografts. Transplantation 69, 1067–1074. 

36. Toda, K., Kayano, K., Karimova, A., et al. (2000) Antisense intercellular adhesion 

molecule-1 (ICAM-1) oligodeoxyribonucleotide delivered during organ preserva-

192 Lawson 

tion inhibits posttransplant ICAM-1 expression and reduces primary lung isograft 

failure. Circ. Res. 86, 166–174. 

37. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. 

(1998) Potent and specific genetic interference by double-stranded RNA in 

Caenorhabditis elegans. Nature 391, 806–811. 

38. Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P., and Sharp, P. A. (1999) 

Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev. 13, 

3191–3197. 

39. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, 

T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured 

mammalian cells. Nature 411, 494–498. 

40. Paddison, P. J., Caudy, A. A., Bernstein, E., Hannon, G. J., and Conklin, D. S. 

(2002) Short hairpin RNAs (shRNAs) induce sequence-specific silencing in 

mammalian cells. Genes Dev. 16, 948–958. 

41. Paddison, P. J., Caudy, A. A. and Hannon, G. J. (2002) Stable suppression of 

gene expression by RNAi in mammalian cells. Proc. Natl. Acad. Sci. USA 99, 

1443–1448. 

42. Shen, C., Buck, A. K., Liu, X., Winkler, M. and Reske, S. N. (2003) Gene silencing 

by adenovirus-delivered siRNA. FEBS Lett. 539, 111–114. 

43. Xia, H., Mao, Q., Paulson, H. L., and Davidson, B. L. (2002) siRNA-mediated 

gene silencing in vitro and in vivo. Nat. Biotechnol. 20, 1006–1010. 

44. Song, E., Lee, S. K., Wang, J., et al. (2003) RNA interference targeting Fas protects 

mice from fulminant hepatitis. Nat. Med. 9, 347–351. 

45. Gordillo, G. M., Xia, D., Mullins, A. N., Bergese, S. D., and Orosz, C. G. (1999) 

Gene therapy in transplantation: pathological consequences of unavoidable plasmid 

contamination with lipopolysaccharide. Transplant. Immunol. 7, 83–94. 

46. Riddell, S. R., Elliott, M., Lewinsohn, D. A., et al. (1996) T-cell mediated rejection 

of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected 

patients. Nat. Med. 2, 216–223. 

47. Apparailly, F., Millet, V., Noel, D., Jacquet, C., Sany, J. and Jorgensen, C. (2002) 

Tetracycline-inducible interleukin-10 gene transfer mediated by an adeno-associated 

virus: application to experimental arthritis. Hum. Gene Ther. 13, 1179–1188. 

48. Tang, Y., Schmitt-Ott, K., Qian, K., Kagiyama, S., and Phillips, M. I. (2002) 

Vigilant vectors: adeno-associated virus with a biosensor to switch on amplified 

therapeutic genes in specific tissues in life-threatening diseases. Methods 28, 

259–266. 

49. Modlich, U., Pugh, C. W., and Bicknell, R. (2000) Increasing endothelial cell 

specific expression by the use of heterologous hypoxic and cytokine-inducible 

enhancers. Gene Ther. 7, 896–902. 

50. Hernandez-Alcoceba, R., Pihalja, M., Qian, D., and Clarke, M. F. (2002) New 

oncolytic adenoviruses with hypoxia- and estrogen receptor-regulated replication. 

Hum. Gene Ther. 13, 1737–1750. 

51. Kay, M. A., Glorioso, J. C., and Naldini, L. (2001) Viral vectors for gene therapy: 

the art of turning infectious agents into vehicles of therapeutics. Nat. Med. 7, 33–40.


52. Hu, W. S. and Pathak, V. K. (2000) Design of retroviral vectors and helper cells 

for gene therapy. Pharmacol. Rev. 52, 493–511. 

53. Coffin, J. M., Hughes, S. H., and Varmus, H. E. (1997) Retroviruses (Coffin, J. 

M., Hughes, S. H., and Varmus, H. E., eds.), Cold Spring Harbor Laboratory 

Press, New York. 

54. Brenner, S. and Malech, H. L. (2003) Current developments in the design of 

onco-retrovirus and lentivirus vector systems for hematopoietic cell gene therapy. 

Biochim. Biophys. Acta 1640, 1–24. 

55. Buchschacher, G. L., Jr. and Wong-Staal, F. (2001) Approaches to gene therapy 

for human immunodeficiency virus infection. Hum. Gene Ther. 12, 1013–1019. 

56. Riviere, I., Brose, K., and Mulligan, R. C. (1995). Effects of retroviral vector 

design on expression of human adenosine deaminase in murine bone marrow 

transplant recipients engrafted with genetically modified cells. Proc. Natl. Acad. 

Sci. USA 92, 6733–6737. 

57. Morgenstern, J. P. and Land, H. (1990) Advanced mammalian gene transfer: high 

titre retroviral vectors with multiple drug selection markers and a complementary 

helper-free packaging cell line. Nucleic Acids Res. 18, 3587–3596. 

58. Markowitz, D. G., Goff, S. P., and Bank, A. (1988). Safe and efficient ecotropic 

and amphotropic packaging lines for use in gene transfer experiments. Trans. 

Assoc. Am. Physicians 101, 212–218. 

59. Markowitz, D., Goff, S., and Bank, A. (1988). A safe packaging line for gene 

transfer: separating viral genes on two different plasmids. J. Virol. 62, 1120– 

1124. 

60. Lewis, P. F. and Emerman, M. (1994). Passage through mitosis is required for 

oncoretroviruses but not for the human immunodeficiency virus. J. Virol. 68, 

510–516. 

61. Page, K. A., Landau, N. R., and Littman, D. R. (1990). Construction and use of a 

human immunodeficiency virus vector for analysis of virus infectivity. J. Virol. 

64, 5270–5276. 

62. Yee, J. K., Miyanohara, A., LaPorte, P., Bouic, K., Burns, J. C., and Friedmann, 

T. (1994). A general method for the generation of high-titer, pantropic retroviral 

vectors: highly efficient infection of primary hepatocytes. Proc. Natl. Acad. Sci. 

USA 91, 9564–9568. 

63. Sanders, D. A. (2002) No false start for novel pseudotyped vectors. Curr. Opin. 

Biotechnol. 13, 437–442. 

64. Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996) Efficient 

transfer, integration, and sustained long-term expression of the transgene in 

adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. USA 93, 

11,382–11,388. 

65. Naldini, L., Blomer, U., Gallay, P., et al. (1996) In vivo gene delivery and stable 

transduction of nondividing cells by a lentiviral vector. Science 272, 263–267. 

66. Blomer, U., Naldini, L., Kafri, T., Trono, D., Verma, I. M. and Gage, F. H. (1997) 

Highly efficient and sustained gene transfer in adult neurons with a lentivirus 

vector. J. Virol. 71, 6641–6649.

194 Lawson 

67. Miyoshi, H., Takahashi, M., Gage, F. H., and Verma, I. M. (1997) Stable and 

efficient gene transfer into the retina using an HIV-based lentiviral vector. Proc. 

Natl. Acad. Sci. USA 94, 10,319–10,323. 

68. Kafri, T., Blomer, U., Peterson, D. A., Gage, F. H., and Verma, I. M. (1997) 

Sustained expression of genes delivered directly into liver and muscle by 

lentiviral vectors. Nat. Genet. 17, 314–317. 

69. Kafri, T., van Praag, H., Ouyang, L., Gage, F. H., and Verma, I. M. (1999) A 

packaging cell line for lentivirus vectors. J. Virol. 73, 576–584. 

70. Vogt. (1997) Retroviral virions and genomes, in Retroviruses (Coffin, J. M., 

Hughes, S. H., and Varmus, H. E., eds.), Cold Spring Harbor Press, New York, 

pp. 27–69. 

71. Rethwilm, A., Darai, G., Rosen, A., Maurer, B., and Flugel, R. M. (1987) 

Molecular cloning of the genome of human spumaretrovirus. Gene 59, 19–28. 

72. Lecellier, C. H. and Saib, A. (2000) Foamy viruses: between retroviruses and 

pararetroviruses. Virology 271, 1–8. 

73. Heneine, W., Switzer, W. M., Sandstrom, P., et al. (1998) Identification of a 

human population infected with simian foamy viruses. Nat. Med. 4, 403–407. 

74. Callahan, M. E., Switzer, W. M., Matthews, A. L., et al. (1999) Persistent 

zoonotic infection of a human with simian foamy virus in the absence of an intact 

orf-2 accessory gene. J. Virol. 73, 9619–9624. 

75. Linial, M. (2000) Why aren’t foamy viruses pathogenic? Trends Microbiol. 8, 

284–289. 

76. Seeger, C. and Mason, W. S. (1996) DNA replication in eukaryotic cells, in DNA 

Replication in Eukaryotic Cells (de Pamphilis, M., ed.), Cold Spring Harbor 

Laboratory Press, New York, pp. 815–831 

77. Hill, C. L., Bieniasz, P. D., and McClure, M. O. (1999) Properties of human 

foamy virus relevant to its development as a vector for gene therapy. J. Gen. 

Virol. 80(Pt 8), 2003–2009. 

78. Trobridge, G., Josephson, N., Vassilopoulos, G., Mac, J., and Russell, D. W. 

(2002) Improved foamy virus vectors with minimal viral sequences. Mol. Ther. 

6, 321–328. 

79. Rowe, W. P., Huebner, R. J., Gilmore, L. K., Parrott, R. H., and Ward, T. G. 

(1953) Isolation of a cytopathogenic agent from human adenoids undergoing 

spontaneous degeneration in tissue culture. Proc. Soc. Exp. Biol. Med. 84, 570– 

573. 

80. Lai, C. M., Lai, Y. K. and Rakoczy, P. E. (2002) Adenovirus and adeno-associated 

virus vectors. DNA Cell Biol. 21, 895–913. 

81. Ginsberg, H. S. (1984) The Adenoviruses, Plenum Press, New York. 

82. Ginsberg, H. S., Lundholm-Beauchamp, U., Horswood, R. L., et al. (1989) Role 

of early region 3 (E3) in pathogenesis of adenovirus disease. Proc. Natl. Acad. 

Sci. USA 86, 3823–3827. 

83. Bergelson, J. M., Cunningham, J. A., Droguett, G., et al. (1997) Isolation of a 

common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 

275, 1320–1323.


84. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). 

Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but 

not virus attachment. Cell 73, 309–319. 

85. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977) Characteristics of 

a human cell line transformed by DNA from human adenovirus type 5. J. Gen. 

Virol. 36, 59–74. 

86. Hearing, P., Samulski, R. J., Wishart, W. L., and Shenk, T. (1987). Identification 

of a repeated sequence element required for efficient encapsidation of the adenovirus 

type 5 chromosome. J. Virol. 61, 2555–2558. 

87. Shen, W. Y., Lai, M. C., Beilby, J., et al. (2001) Combined effect of cyclosporine 

and sirolimus on improving the longevity of recombinant adenovirus-mediated 

transgene expression in the retina. Arch. Ophthalmol. 119, 1033–1043. 

88. Cassivi, S. D., Liu, M., Boehler, A., et al. (1999) Transgene expression after 

adenovirus-mediated retransfection of rat lungs is increased and prolonged by 

transplant immunosuppression. J. Thorac. Cardiovasc. Surg. 117, 1–7. 

89. Yap, J., O’Brien, T., Tazelaar, H. D., and McGregor, C. G. (1997) Immunosuppression 

prolongs adenoviral mediated transgene expression in cardiac allograft 

transplantation. Cardiovasc. Res. 35, 529–535. 

90. Engelhardt, J. F., Litzky, L., and Wilson, J. M. (1994). Prolonged transgene 

expression in cotton rat lung with recombinant adenoviruses defective in E2a. 

Hum. Gene Ther. 5, 1217–1229. 

91. Engelhardt, J. F., Ye, X., Doranz, B., and Wilson, J. M. (1994). Ablation of E2A 

in recombinant adenoviruses improves transgene persistence and decreases 

inflammatory response in mouse liver. Proc. Natl. Acad. Sci. USA 91, 6196– 

6200. 

92. Yang, Y., Nunes, F. A., Berencsi, K., Gonczol, E., Engelhardt, J. F., and Wilson, 

J. M. (1994). Inactivation of E2a in recombinant adenoviruses improves the prospect 

for gene therapy in cystic fibrosis. Nat. Genet. 7, 362–369. 

93. Qian, H. S., Channon, K., Neplioueva, V., et al. (2001) Improved adenoviral 

vector for vascular gene therapy : beneficial effects on vascular function and 

inflammation. Circ. Res. 88, 911–917. 

94. Wen, S., Schneider, D. B., Driscoll, R. M., Vassalli, G., Sassani, A. B., and 

Dichek, D. A. (2000) Second-generation adenoviral vectors do not prevent rapid 

loss of transgene expression and vector DNA from the arterial wall. Arterioscler. 

Thromb. Vasc. Biol. 20, 1452–1458. 

95. Fisher, K. J., Choi, H., Burda, J., Chen, S. J., and Wilson, J. M. (1996) Recombinant 

adenovirus deleted of all viral genes for gene therapy of cystic fibrosis. Virology 

217, 11–22. 

96. Fisher, K. J., Jooss, K., Alston, J., et al. (1997) Recombinant adeno-associated 

virus for muscle directed gene therapy. Nat. Med. 3, 306–312. 

97. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. 

T. (1996) A new adenoviral vector: Replacement of all viral coding sequences 

with 28 kb of DNA independently expressing both full-length dystrophin and 

beta-galactosidase. Proc. Natl. Acad. Sci. USA 93, 5731–5736.

196 Lawson 

98. Kumar-Singh, R. and Chamberlain, J. S. (1996) Encapsidated adenovirus 

minichromosomes allow delivery and expression of a 14 kb dystrophin cDNA to 

muscle cells. Hum. Mol. Genet. 5, 913–921. 

99. Kumar-Singh, R. and Farber, D. B. (1998) Encapsidated adenovirus mini-chromosome-mediated 

delivery of genes to the retina: application to the rescue of 

photoreceptor degeneration. Hum. Mol. Genet. 7, 1893–1900. 

100. Kumar-Singh, R., Yamashita, C. K., Tran, K., and Farber, D. B. (2000) Construction 

of encapsidated (gutted) adenovirus minichromosomes and their application 

to rescue of photoreceptor degeneration. Methods Enzymol. 316, 724–743. 

101. Berns, K. I. and Giraud, C. (1996) Biology of adeno-associated virus, in Adeno- 

Associated Virus (AAV) Vectors in GeneTherapy (Berns, K. I. and Giraud, C., 

eds.), Springer Verlag, Berlin, pp. 1–24. 

102. Dong, J. Y., Fan, P. D., and Frizzell, R. A. (1996) Quantitative analysis of the 

packaging capacity of recombinant adeno-associated virus. Hum. Gene Ther. 7, 

2101–2112. 

103. Casto, B. C., Atchison, R. W., and Hammon, W. M. (1967) Studies on the relationship 

between adeno-associated virus type I (AAV-1) and adenoviruses. I. 

Replication of AAV-1 in certain cell cultures and its effect on helper adenovirus. 

Virology 32, 52–59. 

104. Buller, R. M., Janik, J. E., Sebring, E. D.,and Rose, J. A. (1981) Herpes simplex 

virus types 1 and 2 completely help adenovirus-associated virus replication. J. 

Virol. 40, 241–247. 

105. Yalkinoglu, A. O., Heilbronn, R., Burkle, A., Schlehofer, J. R., and zur Hausen, 

H. (1988) DNA amplification of adeno-associated virus as a response to cellular 

genotoxic stress. Cancer Re.s. 48, 3123–3129. 

106. Yalkinoglu, A. O., Zentgraf, H., and Hubscher, U. (1991) Origin of adeno-associated 

virus DNA replication is a target of carcinogen-inducible DNA amplification. 

J. Virol. 65, 3175–3184. 

107. Sanlioglu, S., Duan, D., and Engelhardt, J. F. (1999) Two independent molecular 

pathways for recombinant adeno-associated virus genome conversion occur after 

UV-C and E4orf6 augmentation of transduction. Hum. Gene Ther. 10, 591–602. 

108. Kotin, R. M., Siniscalco, M., Samulski, R. J., et al. (1990) Site-specific integration 

by adeno-associated virus. Proc. Natl. Acad. Sci. USA 87, 2211–2215. 

109. Kotin, R. M., Linden, R. M., and Berns, K. I. (1992) Characterization of a preferred 

site on human chromosome 19q for integration of adeno-associated virus 

DNA by non-homologous recombination. EMBO J. 11, 5071–5078. 

110. Samulski, R. J., Zhu, X., Xiao, X., et al. (1991) Targeted integration of adenoassociated 

virus (AAV) into human chromosome 19. EMBO J. 10, 3941–3950. 

111. Flotte, T. R., Afione, S. A., Conrad, C., et al. (1993) Stable in vivo expression of 

the cystic fibrosis transmembrane conductance regulator with an adeno-associated 

virus vector. Proc. Natl. Acad. Sci. USA 90, 10,613–10,617. 

112. Kaplitt, M. G., Leone, P., Samulski, R. J., et al. (1994) Long-term gene expression 

and phenotypic correction using adeno-associated virus vectors in the mammalian 

brain. Nat. Genet. 8, 148–154.


113. McCown, T. J., Xiao, X., Li, J., Breese, G. R., and Samulski, R. J. (1996) Differential 

and persistent expression patterns of CNS gene transfer by an adeno-associated 

virus (AAV) vector. Brain Res. 713, 99–107. 

114. Snyder, R. O., Spratt, S. K., Lagarde, C., et al. (1997) Efficient and stable adenoassociated 

virus-mediated transduction in the skeletal muscle of adult immunocompetent 

mice. Hum. Gene Ther. 8, 1891–1900. 

115. Lalwani, A. K., Walsh, B. J., Carvalho, G. J., Muzyczka, N., and Mhatre, A. N. 

(1998) Expression of adeno-associated virus integrated transgene within the 

mammalian vestibular organs. Am. J. Otol. 19, 390–395. 

116. Schimmenti, S., Boesen, J., Claassen, E. A., Valerio, D., and Einerhand, M. P. 

(1998) Long-term genetic modification of rhesus monkey hematopoietic cells 

following transplantation of adenoassociated virus vector-transduced CD34+ 

cells. Hum. Gene Ther. 9, 2727–2734. 

117. Duan, D., Yue, Y., Yan, Z., McCray, P. B., Jr., and Engelhardt, J. F. (1998) 

Polarity influences the efficiency of recombinant adenoassociated virus infection 

in differentiated airway epithelia. Hum. Gene Ther. 9, 2761–2776. 

118. Malik, A. K., Monahan, P. E., Allen, D. L., Chen, B. G., Samulski, R. J. and 

Kurachi, K. (2000) Kinetics of recombinant adeno-associated virus-mediated 

gene transfer. J. Virol. 74, 3555–3565. 

119. Nakai, H., Storm, T. A., and Kay, M. A. (2000) Recruitment of single-stranded 

recombinant adeno-associated virus vector genomes and intermolecular recombination 

are responsible for stable transduction of liver in vivo. J. Virol. 74, 9451– 

9463. 

120. Nakai, H., Yant, S. R., Storm, T. A., Fuess, S., Meuse, L., and Kay, M. A. 

(2001) Extrachromosomal recombinant adeno-associated virus vector genomes 

are primarily responsible for stable liver transduction in vivo. J. Virol. 75, 6969– 

6976. 

121. Xiao, X., Li, J., and Samulski, R. J. (1996) Efficient long-term gene transfer into 

muscle tissue of immunocompetent mice by adeno-associated virus vector. J. 

Virol. 70, 8098–8108. 

122. Miao, C. H., Snyder, R. O., Schowalter, D. B., et al. (1998) The kinetics of rAAV 

integration in the liver. Nat. Genet. 19, 13–15. 

123. Miao, C. H., Nakai, H., Thompson, A. R., et al. (2000) Nonrandom transduction 

of recombinant adeno-associated virus vectors in mouse hepatocytes in vivo: cell 

cycling does not influence hepatocyte transduction. J. Virol. 74, 3793–3803. 

124. Nakai, H., Iwaki, Y., Kay, M. A., and Couto, L. B. (1999) Isolation of recombinant 

adeno-associated virus vector-cellular DNA junctions from mouse liver. J. 

Virol. 73, 5438–5447. 

125. Wu, P., Phillips, M. I., Bui, J., and Terwilliger, E. F. (1998) Adeno-associated 

virus vector-mediated transgene integration into neurons and other nondividing 

cell targets. J. Virol. 72, 5919–5926. 

126. Kaplitt, M. G., Xiao, X., Samulski, R. J., et al. (1996) Long-term gene transfer in 

porcine myocardium after coronary infusion of an adeno-associated virus vector. 

Ann. Thorac. Surg. 62, 1669–1676.

198 Lawson 

127. Ali, R. R., Reichel, M. B., Thrasher, A. J., et al. (1996) Gene transfer into the mouse 

retina mediated by an adeno-associated viral vector. Hum. Mol. Genet. 5, 591–594. 

128. Ponnazhagan, S., Mukherjee, P., Wang, X. S., et al. (1997) Adeno-associated virus 

type 2-mediated transduction in primary human bone marrow-derived CD34+ 

hematopoietic progenitor cells: donor variation and correlation of transgene 

expression with cellular differentiation. J. Virol. 71, 8262–8267. 

129. Rolling, F., Shen, W. Y., Tabarias, H., et al. (1999) Evaluation of adeno-associated 

virus-mediated gene transfer into the rat retina by clinical fluorescence photography. 

Hum. Gene Ther. 10, 641–648. 

130. Zaiss, A. K., Liu, Q., Bowen, G. P., Wong, N. C., Bartlett, J. S., and Muruve, D. 

A. (2002) Differential activation of innate immune responses by adenovirus and 

adeno-associated virus vectors. J. Virol. 76, 4580–4590. 

131. Xiao, W., Chirmule, N., Berta, S. C., McCullough, B., Gao, G., and Wilson, J. 

M. (1999) Gene therapy vectors based on adeno-associated virus type 1. J. Virol. 

73, 3994–4003. 

132. Chirmule, N., Xiao, W., Truneh, A., et al. (2000) Humoral immunity to adenoassociated 

virus type 2 vectors following administration to murine and nonhuman 

primate muscle. J. Virol. 74, 2420–2425. 

133. Chirmule, N., Propert, K., Magosin, S., Qian, Y., Qian, R., and Wilson, J. (1999) 

Immune responses to adenovirus and adeno-associated virus in humans. Gene 

Ther. 6, 1574–1583. 

134. Roizman, B. and Sears, A. E. (1996) Human herpes viruses and their replication, 

in Fundamental Virology, 3rd ed.. (Fields, B. N., Knipe, D. M., Howley, P. M., 

Chanock, R. M., and Melnick, J. L., eds.), Lippincott-Raven, Philadelphia, pp. 

2231–2296. 

135. Advani, S. J., Weichselbaum, R. R., Whitley, R. J., and Roizman, B. (2002) 

Friendly fire: redirecting herpes simplex virus-1 for therapeutic applications. 

Clin. Microbiol. Infect. 8, 551–563. 

136. Burton, E. A., Bai, Q., Goins, W. F., and Glorioso, J. C. (2001) Targeting gene 

expression using HSV vectors. Adv. Drug Deliv. Rev. 53, 155–170. 

137. Burton, E. A., Wechuck, J. B., Wendell, S. K., Goins, W. F., Fink, D. J., and 

Glorioso, J. C. (2001) Multiple applications for replication-defective herpes simplex 

virus vectors. Stem Cells 19, 358–377. 

138. Burton, E. A., Bai, Q., Goins, W. F., and Glorioso, J. C. (2002) Replicationdefective 

genomic herpes simplex vectors: design and production. Curr. Opin. 

Biotechnol. 13, 424–428. 

139. Burton, E. A., Fink, D. J., and Glorioso, J. C. (2002) Gene delivery using herpes 

simplex virus vectors. DNA Cell. Biol. 21, 915–936. 

140. Martuza, R. L., Malick, A., Markert, J. M., Ruffner, K. L., and Coen, D. M. 

(1991) Experimental therapy of human glioma by means of a genetically engineered 

virus mutant. Science 252, 854–856. 

141. Mineta, T., Rabkin, S. D., and Martuza, R. L. (1994) Treatment of malignant 

gliomas using ganciclovir-hypersensitive, ribonucleotide reductase-deficient herpes 

simplex viral mutant. Cancer Res. 54, 3963–3966.


142. Pyles, R. B., Warnick, R. E., Chalk, C. L., Szanti, B. E., and Parysek, L. M. 

(1997) A novel multiply-mutated HSV-1 strain for the treatment of human brain 

tumors. Hum. Gene Ther. 8, 533–544. 

143. Frenkel, N., Singer, O., and Kwong, A. D. (1994) Minireview: the herpes simplex 

virus amplicon—a versatile defective virus vector. Gene Ther. 1(Suppl 1), 

S40–S46. 

144. Fraefel, C., Jacoby, D. R., and Breakefield, X. O. (2000) Herpes simplex virus 

type 1-based amplicon vector systems. Adv. Virus Res. 55, 425–451. 

145. Krisky, D. M., Wolfe, D., Goins, W. F., et al. (1998) Deletion of multiple immediate-early 

genes from herpes simplex virus reduces cytotoxicity and permits 

long-term gene expression in neurons. Gene Ther. 5, 1593–1603. 

146. Krisky, D. M., Marconi, P. C., Oligino, T. J., et al. (1998) Development of herpes 

simplex virus replication-defective multigene vectors for combination gene 

therapy applications. Gene Ther. 5, 1517–1530. 

147. Moriuchi, S., Oligino, T., Krisky, D., et al. (1998) Enhanced tumor cell killing in 

the presence of ganciclovir by herpes simplex virus type 1 vector-directed 

coexpression of human tumor necrosis factor-alpha and herpes simplex virus thymidine 

kinase. Cancer Res. 58, 5731–5737.

Nonviral Vectors 201 

9 

Nonviral Vectors 

Louise Collins 

Summary 

Gene therapy holds great promise for treating a variety of human diseases and conditions. 

The field of gene therapy has advanced rapidly in the last decade. However, a 

major limiting factor remains the lack of a suitable vector for gene delivery. Although 

viruses are currently the most commonly researched vector, because of continuing 

safety concerns research has broadened to developing nonviral alternatives. 

Nonviral vectors fall into several categories. They can be physical methods, which 

provide relatively crude delivery approaches, such as direct cell injection, or chemical 

delivery vehicles. Chemical vectors almost always include a polycation component to 

assist the passage of DNA to the cell’s nucleus. 

The passage of the transgene through the cell to the nucleus is hampered by many 

obstacles. Approaches to overcome these, both intracellularly and extracellularly, in 

order to maximize gene expression are currently under investigation. 

Nonviral vectors offer a safe and versatile alternative to their viral counterparts. 

Although still in their infancy, the different nonviral approaches under development 

hold great potential for many clinical applications. 

Key Words: Nonviral; gene therapy; vector. 


Viral vectors have been successfully developed to produce relatively longterm, 

high-level transfection efficiencies to a wide variety of cells, both replicating 

and postmitotic. However, they are still far from the perfect vector. 

Nonviral gene-delivery vehicles have received increasing focus in recent years 

because they offer substantial safety advantages over viral vectors. The predominant 

concern with viral gene delivery is that of insertional activation 

within the host genome, leading to oncogenic or tumor-suppressor activation. 

Concerns have been highlighted, first following the death of a teenager from 



201

202 Collins 

Table 1 

Advantages and Disadvantages of Viral and Nonviral DNA Vectors 

Viral vectors Nonviral vectors 

Advantages Advantages 

High transfection efficiency No viral components 

Long term gene expression through Low or no immunogenicity 

integration of transgene No limit to DNA insert size 

(retrovirus, AAV) Cell specificity possible with targeted 

Intrinsic properties for intracellular ligands 

trafficking Relatively simple preparation procedures 

Standardized homogenous, stable reagents 

Scale up possible 

Disadvantages Disadvantages 

Replication competent virus Low transfection efficiency 

formation by homologous Transient gene expression–episomal 

recombination expression 

Oncogenic activation following Intracellular barrier–may require 

integration additional agents 

Helper virus carryover (AAV) Cellular toxicity with some vectors 

Immunogenicity (PEI,liposomes) 

Viral protein overload Inflammation due to unmethylated 

Limited cell tropism CpG DNA sequences 

Time consuming preparation 

Batch to batch variation 

AAV, adeno-associated virus; PEI, polyethyleneimine. 

adverse immune responses to adenoviral treatment for a liver enzyme deficiency 

(1) and, more recently, in reports of two boys developing leukemia after 

being treated for severe combined immunodeficiency with retroviruses (2). 

It is with this concern, as well as other well-documented disadvantages, 

illustrated in Table 1, that research into nonviral alternatives has advanced 

with such speed in recent years. Nonviral vectors must achieve by design 

what viruses have evolved to do naturally, mimicking the advantageous components 

for rapid transport and efficient expression of foreign DNA within a 

host cell, but including none of the associated limitations. For transplantation 

applications they offer a nonimmunogenic alternative for delivery of genes to 

the graft or to the host immune system in an otherwise immunologically overloaded 

environment. 

Many different approaches to nonviral vector design have been documented. 

These use both physical and chemical methods, but as yet there is not one single 

system that can be effectively applied in every gene-therapy situation.


Although publications involving nonviral vectors for immunoregulatory gene 

delivery to a specific transplantation target are few, there is significant progress 

in gene delivery to targeted cells or transplantable tissues. Additionally, ex vivo 

gene delivery has shown great potential with many nonviral gene-delivery systems. 

Relevant research is discussed here, in reference to the appropriate vectors. 

2. Physical Methods 

The need for a vector at all is questionable because delivery can be crudely, 

but effectively, achieved by direct administration of naked plasmid DNA to 

the target tissue or cell (reviewed in ref. 3). Direct injection to skeletal muscle 

tissue results in transient gene expression, which indicates its promise as a 

vaccination procedure (4). Direct delivery of donor major histocompatibility 

complex class I antigen to skeletal muscle has been shown to modify allograft 

response in a transplantation model (5). Efficient levels of transfection have 

also been achieved with direct injection into the liver (6), myocardium (7,8), 

skin (9), as well as brain (10, 11) and solid tumors (12). 

The development of intravascular plasmid delivery has markedly increased 

the interest in the field of naked DNA gene therapy. Vascular delivery may be 

systemic or regional, in which DNA is introduced directly into vessels that supply 

a specific tissue, improving cell access (13). Intravascular or direct injection 

of immunomodulatory genes in donor grafts is an attractive alternative to 

current systemic immunosuppression treatments. Delivery of the functionally 

immunosuppressive cytokine transforming growth factor-β1 to murine cardiac 

transplant models by direct DNA injection was shown to significantly prolong 

graft survival (7). 

Untargeted systemic injection of naked DNA into whole animals results in 

low-level, short-term, and wide tissue distribution of gene expression (14). 

However, increasing hydrodynamic pressure by rapid delivery of a large DNA 

volume results in a substantial increase in transgene expression, almost exclusively 

located in the liver following systemic administration (15). More importantly, 

hydrodynamic gene delivery can be applied to localized delivery for 

specific organs including the liver (unpublished data) and kidney (16). 

Other physical methods for DNA delivery include particle bombardment 

using DNA-coated gold beads (17, 18) and ultrasound methods to temporarily 

disrupt membranes (19). Most important in recent years, however, has been the 

development of electroporation technology. This is a technique routinely used 

in the laboratory for making transient pores in cell membranes (20). Refinement 

of pulse conditions to reduce cell toxicity, and the development of equipment 

that enables in vivo use, have renewed interest in it for gene-therapy applications 

(21, 22).

204 Collins 

The advantage of these physical methods, apart from the lack of viral components, 

is their obvious simplicity. However, physical methods are generally harsh 

and unphysiological in their nature of cell entry. A fine balance is required to 

keep cell stress to a minimum but, at the same time, achieve sufficient membrane 

disruption to allow the DNA in. 

3. Chemical Methods 

There are many different nonviral gene delivery vehicles that make use of 

the properties of chemicals and proteins to assist cell entry. Nearly all successful 

nonviral DNA-delivery systems contain some form of polycation. The 

charge enables binding to plasmid DNA resulting in condensation, as well as 

electrostatic binding to anionic cell surface groups such as proteoglycans (23). 

3.1. Liposomes 

Liposomal gene delivery, or Lipoplex, was the first purely nonviral system 

to reach clinical trials through the pioneering work of Felgner and colleagues in 

1987 (24). They developed a cationic lipid that forms small (average diameter 

100 nm) unilamellar liposomes under optimal conditions (25). The surface of 

these liposomes is positively charged and thus readily attracted to the negative 

phosphate backbone of DNA, spontaneously forming lipid/DNA complexes in 

which the DNA is protected from intracellular degradation (26). Internalization 

is thought to occur via both coated pit and noncoated endocytosis pathways, 

depending on the positive charge of the liposome and the size of the complexes, 

resulting in efficient cell transfection (27). 

Since the initial design, many effective variations have been reported, some 

of which are shown in Fig. 1. Several of these are available commercially 

(reviewed in ref. 28). A cationic lipid generally consists of four different functional 

domains: a positively charged head group (usually a single or multiple 

amine-derived group), a spacer of varying lengths, a linker bond, and a hydrophobic 

anchor. The relationship between structure and efficiency of gene delivery 

has been an area of intense research (29). 

Most of the cationic lipid preparations used for cell transfection have constituted 

a cationic amphiphile together with a neutral “helper” lipid, such as 

dioleoylphosphatidylethanolamine or cholesterol. The helper lipid is required 

for stabilization and has been shown to improve transfection significantly (30). 

It is also thought to play a role in membrane disruption, enhancing passage of 

DNA through the cell, although the precise mechanism remains unclear (31). 

The success of lipoplex delivery is widespread. Reports of efficient cationic 

lipid-mediated delivery of DNA and RNA both in vitro and in vivo have been 

extensively published, providing transient and stable transfectants to a wide 

range of tissues and organs in many animal species. Several transplant models

205 

Fig. 1. Structures of commonly used chemical nonviral vectors. DMRIE, 1,2-dimyriotyloxypropyl-3-dimethyl-hydroxy ethyl 

ammonium bromide; DOTAP, dioleoyltrimethylamino propane. 

Nonviral Vectors 205

206 Collins 

have used liposomal delivery methods. Viral interleukin (IL)-10 has been delivered 

using lipid-mediated gene transfer to both rat lung (32) and murine cardiac 

(33) allografts and has shown enhanced graft survival by inhibiting donor-specific 

cellular and humoral immune responses. 

Intravenous injection of lipid–DNA complexes produces increased levels of 

gene expression compared to naked DNA alone (34), with accumulation in the 

lung endothelium (35). However, because of the high positive charge, complexes 

aggregate with serum proteins (36) and potentially with other body fluids 

(37), leading to problems in vivo. Some cell toxicity has been reported 

(38). It has been shown to be possible to lengthen the circulation time, shield 

the cationic charges, and divert the lipoplexes to other organs by incorporating 

a hydrophilic polymer, polyethylene glycol (PEG) (39,40). This can occur with 

or without added tissue selectivity by including natural targeting ligands such 

as transferrin (41), folate (42), asialofetuin (43), or antibodies (44). Transferrin-enhanced 

lipids have been shown to successfully deliver viral IL-10 to corneal 

endothelium, suppressing corneal allograft rejection (44). 

The inclusion of additional features to enhance liposomal DNA delivery 

have consisted of polylysine (45, 46) or membrane-permeabilizing agents (27). 

In a similar way, liposomes have been shown to enhance other nonviral vector 

systems, such as the arginine-glycine-aspartate (RGD)-peptide integrin targeting 

vector (47–49), and also to improve transfection with some viruses, including 

adenoviruses (50) and the hemaglutinating virus of Japan (51). 

3.2. Receptor-Mediated Gene Transfer 

With Polylysine-Based Polymers 

Receptor-mediated gene transfer takes advantage of the ability of receptors 

on the cell surface to bind and internalize a ligand, enabling increased celltarget 

specificity. Targeting ligands can be natural or recombinant proteins, 

synthetic peptides, vitamins, carbohydrates, or specific antibodies. 

The fundamental components of a receptor-mediated gene-delivery system 

(see Fig. 2) are the ligand that binds effectively and specifically to a cell surface 

receptor and the DNA-binding moiety, usually a polycation, that is conjugated 

or synthesized with the ligand, and which electrostatically binds and condenses 

the plasmid DNA. 

The DNA-binding moiety serves as the link, binding the DNA to the targeting 

ligand, and in addition it compresses the helical structure of the plasmid and 

condenses it into a small, tightly packed molecule. Most of the DNA-condensing 

agents are polycations, although other high-affinity binding molecules have 

also been used, including the DNA-intercalating agents bisacridine (52) and 

Hoechst 33258 (53), sequence-specific DNA-binding proteins, such as the 

DNA-binding domain of the yeast GAL4 transcription factor (54), or naturally


Fig. 2. Basic components of a receptor-mediated gene-delivery system. 

occurring DNA-binding proteins, such as spermine (55), histones (56), and protamines 

(57). 

Undoubtedly the most effective and extensively researched DNA-binding 

moiety to date is the naturally occurring, biodegradable peptide poly(L-lysine). 

It has been shown to be a highly effective condensing agent (58, 59). As part 

of several different polyplex vector systems, it has been shown to shield the 

DNA effectively from degradation by cell nucleases (46, 60). It has also been 

suggested that polylysine may possess nuclear trafficking properties, further 

enhancing gene delivery. The length and type of positively charged amino 

acids have been reported to influence DNA condensation and ultimately the 

size and stability of the resulting DNA–ligand complexes in solution (59, 61). 

The ligand is the most important component of the receptor-mediated genedelivery 

vehicle. Lysine chains of high molecular weight have been shown to 

mediate gene delivery effectively alone. However, polylysine is most effective 

when linked with a targeting ligand. The ligand provides the specificity of the 

system by the initial contact with the cell surface and subsequent internalization. 

Three categories have been used to date: whole naturally occurring proteins 

(such as asialorosomucoid, transferrin, or insulin), structural motifs of 

receptor-binding affinity from natural ligands (galactose residues or RGD peptide), 

or antibodies against an epitope on the extracellular portion of the receptor 

(e.g., polymeric immunoglobulin receptor). 

Table 2 illustrates the wide range of targeting ligands and antibodies that 

have been investigated as DNA vectors, together with the polycations utilized 

and their intended cellular targets. It is apparent that many of these targeted 

systems have huge potential in the transplantation gene-therapy field. Many 

are targeted to organs such as liver and lung as well as to specific cell types 

such as endothelium and vascular smooth muscle cells, which play a significant 

role in graft rejection and immune regulation.

208 

Table 2 

Ligands Used for Receptor-Mediated Gene-Delivery Vectors 

Ligand Polycation Receptor Cell/tissue target Reference 

α1-Antitrypsin motif peptide Polylysine, oligolysine Serpin–enzyme complex Liver, brain 105,106 

receptor 

ASGP, asialoorosomucoid Polylysine ASGP receptor Liver 107,108 

EGF and anti-EGF Polylysine, PEI EGF receptor Tumor cells 79,89,109 

FGF Polylysine FGF receptor Various 110 

Folate Polylysine, EPI Folate receptor Tumor cells 42,111,113 

Galactosylated ligands Polylysine, oligolysine, 

(various, e.g., albumin) histones ASGP receptor Liver 114,118 

Insulin Polylysine Insulin receptor Liver 119,120 

Malarial circumsporozoite Polylysine Unknown Erthyrocytes 121 

protein 

RGD peptides Oligolysine, PEI Integrins Multiple cell types 77,97,122,125 

Synthetic ligands, Polylysine, PEI Sugar-specific receptors Liver, tumor, endothelium, 126,129 

galactosylated, lactosylated, (e.g., lectins, mannose monocytes, macrophages, 

or mannosylated ligands receptor) lung, epithelium, etc. 

Transferrin Polylysine, protamine, Transferrin receptor Rapidly dividing tissues, 74,78,130 

PEI (e.g., tumors) 

208 Collins

209 

α-CD3 antibody Polylysine, PEI CD3 Peripheral blood 76 

mononuclear cells 

Anti-CD5 Polylysine CD5 Lymphocytes 131 

Antibody ChCEy Polylysine ChCE7 Neuroblastoma 132 

Anti-her2 Polylysine Her2 133 

Antisecretory component Polylysine Polymeric Lund and live epithelium 134 

antibodies immunoglobulin 

receptor 

Anti-thrombomodulin Polylysine Thrombomodulin Neuroblastoma, endothelium, 132, 135 

leukemic cells 

Anti-TGF Polylysine EGF receptor Tumor cells 136 

Anti-IgG Polylysine Surface lymphocytes 137 

immunoglobuin 

IgG Polylysine FcR Macrophages 138 

ASGP, asialoglycoprotein; EGF, epidermal growth factor; EPI, polyethyleneimine; FGF, fibroblast growth factor; RGD, arginine-glycineaspartate; 

TGF, transforming growth factor; IgG, immuoglobulin G. 

Nonviral Vectors 209

210 Collins 

It must not be forgotten that in partner to the ligand, the receptor is an essential 

consideration in vector design. Ideally a receptor would be unique for a specific 

cell type or tissue to provide a highly specialized targeted delivery system. The 

binding affinity of the ligand to the receptor is important. If it is too high, it may 

prevent the ligand–DNA complexes from dissociating from the receptor following 

internalization, and they may be returned to the cell surface (62), but if it is 

too weak, it would reduce binding to the cell surface and corresponding internalization 

efficiency. Receptor targets for ligand-directed gene delivery are almost 

exclusively actively recycling receptor types that associate with coated pits. 

The most attractive advantage of the receptor-mediated gene transfer system, 

however, is the targeting property of the ligand to the cell receptor that makes 

possible the development of a highly specific system. The cell also remains relatively 

unharmed because the process of cell entry exploits natural cellular uptake 

pathways. In particular, the design of peptides or structural motifs derived from 

larger molecules eliminates any unwanted side effects associated with the rest of 

the molecule, producing smaller vector complexes to aid in diffusion and reduce 

any potential immunogenicity. 

Polylysine has been shown, in some circumstances, to induce an inflammatory 

response when injected into animals (63), but animals in which the DNA– 

ligand–polylysine complexes are introduced via receptor-mediated endocytosis 

have not shown any immunological response (64). This would make multiple 

administrations possible if necessary. 

3.3. Organic Polymers 

Polyethyleneimine (PEI), a polymer widely used in the manufacturing industry, 

has been more recently exploited in the gene-therapy field (reviewed in 

ref. 65). Available in both a linear and a branched form and in many different 

molecular weights (see Fig. 1), it has proved a valuable method of nonviral gene 

delivery. 

PEI is a highly positively charged polymer, which allows rapid and effective 

DNA condensation into small, stable complexes protected from nuclease 

degradation under physiological conditions (66). The positive charge allows 

electrostatic binding to the cell surface followed by natural endocytic uptake 

processes. The high buffering capacity (“proton sponge”) over a broad pH 

range, a result of the high number of protonable nitrogen groups, aids delivery 

of plasmid DNA to a variety of cell types in vitro and in vivo without the 

addition of any membrane-disruption agents (67, 68). 

Gene expression has been achieved in a number of in vivo models including 

rat kidneys (69), mouse brains (67, 70), mouse tumors (71, 72), and rabbit lungs 

(73). Following systemic administration, transgene expression is found predominantly 

in the lungs, similar to cationic liposomes.


Toxicity has been associated with the use of PEI in vivo, thought to be caused 

by the excessive positive charges on the polymer (67). This can be significantly 

reduced by shielding PEI–DNA complexes with PEG (74), as has been shown 

with lipids. This shielding also diverts intravenous delivery of the complexes 

away from the lung and toward the liver (75), adding some degree of specificity 

to the PEI vector. The untargeted nature of PEI limits the suitability of the vector 

for clinical applications. Targeting has, however, been introduced by the 

addition of ligands, such as transferrin (76), RGD peptides (77), anti-CD3 (78), 

and epidermal growth factor (79), either with or without the added PEG shield. 

Polyamidoamine cascade polymers, or Starburst dendrimers, were the first 

polycations to show high transfection potential without the need for additional 

endosomolytic agents. Dendrimers are spherical, highly branched polymers 

with varying degrees of branching forming different generations, many of which 

are commercially available (see Fig. 1). Like PEI, they are highly positively 

charged, with high densities of amines on the surface, which are able to electrostatically 

condense the DNA and internalize by endocytosis. The remaining 

inner amine residues are then available to neutralize the acid pH in the endosomal 

vesicles, allowing DNA to escape degradation (80). 

Like liposomes and several polycation-delivery systems, dendrimers have 

been shown to transfect corneal endothelium and to deliver genes encoding 

soluble tumor necrosis factor receptor immunoglobulin (TNFR-Ig) to block 

TNF action and reduce corneal allograft rejection (81). Dendrimers have also 

been used in a murine cardiac transplantation model to deliver viral IL-10, 

resulting in prolongation of graft survival (82). 

4. Barriers for Nonviral Gene Delivery 

The administration of DNA complexes, and subsequent passage to the nucleus 

of a specific cell type for expression, is a path hampered by many obstacles (see 

Fig. 3). Barriers to successful transgene expression may be extracellular or intracellular. 

4.1. Extracellular 

The route of administration of the complexes is of particular importance. It is 

important to establish the intended tissue target and deliver accordingly. For 

example, aerosol delivery to the lung or direct intravascular delivery to the liver 

are far more direct, localized methods compared to intravenous delivery to target 

a distant tissue or organ. Further tissue specificity can be achieved by the 

inclusion of tissue-specific promoters and enhancers in the plasmid DNA to 

limit expression to the tissue of choice. 

For transplantation purposes, ex vivo graft manipulation offers an attractive 

and highly targeted delivery method whether the vector is cell targeted or not.

212 Collins 

Fig. 3. Receptor-mediated endocytosis via clathrin-coated pits. 

There is no possibility of unwanted gene delivery in distant organs or tissues, 

which often occurs following systemic delivery. 

Almost all nonviral vectors are highly positively charged, which is beneficial 

for electrostatic attachment to cell-surface anionic molecules. When applied 

systemically, however, this leads to many nonspecific interactions with blood 

components and plasma proteins including albumin, fibronectin, and Ig (83), 

leading to short circulation time and reduced cellular uptake. There is also the 

possibility of aggregation with erythrocytes, potentially resulting in vessel 

obstruction. It is thought that the high cationic charge, together with the size of 

some of the complexes, leads to complement activation in a number of situations, 

especially with large polylysine molecules and PEI (84).


To address these potential hurdles, complexes have been sterically stabilized 

by the attachment of hydrophilic polymers, such as PEG (40) or human 

placental microsomal aromatase (85), to shield the cationic charge in order to 

improve circulation stability, prevent aggregation, and reduce toxicity. 

Diffusion through the tissues is strongly influenced by size, charge, and solubility 

of the DNA vector complexes. However, it is essential that complexes 

can be transported through capillaries, extravasate out of blood vessels, and be 

taken up by the cell. Extravasation through the endothelium is strictly limited 

by size, and it is only in some tissues such as liver, spleen, bone marrow, and 

some tumors that large fenestrations make it possible for particles of 100 nm or 

more to enter the parenchymal cells. In other tissues the natural defense system 

of the reticuloendothelium prevents access by any unwanted foreign particles. 

4.2. Intracellular 

4.2.1. Uptake by Target Cell 

The membrane lipid bilayers selectively screen all foreign molecules entering 

the cell. Uptake through cellular membranes is dependent on the DNA 

complex surface charge and size. It is thought that the route of entry for cationic 

nonviral vectors is adsorptive or receptor-mediated endocytosis through 

clathrin-coated pits (86). Although an innovative way to introduce genetherapy 

vectors into the cell, it does have its disadvantages as it exposes the 

complexes to enzymatic degradation in the endosomal–lysosomal pathway (sea 

Fig. 3). 

The use of transduction domains from viral proteins such as HIV-TAT (87) 

or herpes simplex VP22 (88) is being investigated. Such proteins are capable 

of taking large molecules directly into the cytoplasm, circumventing the endocytic 

entry mechanisms. 

4.2.2. Endosomal Release 

Interruption of the endosomal–lysosomal pathway is thought to be the most 

rate-limiting step to successful nonviral gene delivery. Prevention of intraendosomal 

DNA degradation has been addressed in a number of ways, using both 

organic and natural agents. 

PEI and dendrimers have been shown to have intrinsic endosomolytic properties 

resulting from their ability to become highly protonated in the acid lysosomal 

environment, leading to endosomal swelling and subsequent rupture 

—the “proton sponge” hypothesis (67, 80). They have thus effectively been 

used either alone or in combination with targeting ligands to achieve high transfection 

levels. Similarly, some cationic lipids have shown endosomolytic properties 

when used at very low levels, and these are able to enhance other nonviral 

vectors without any reported toxicity (31).

214 Collins 

Receptor-mediated polylysine-based delivery vehicles require assistance 

with endosomolysis, since they lack any buffering capacity during the pH drop. 

Original success was achieved by the simple addition of the organic lysosomotropic 

agent chloroquine. Chloroquine allows DNA to escape by preventing 

pH decrease and, hence, enzymatic degradation within the endosomes (89). 

The success of its use has been widely reported in vitro, but toxicity has limited 

its use in vivo and for any clinical applications. 

One of the most sophisticated methods has been adapted from viruses. Destabilizing 

proteins are present in many viruses. The best studied is a 20-aminoacid 

peptide synthesized from the hemagglutinin protein of the influenza virus 

(90). Inside the lysosomal compartment, the peptide gains fusogenic activity 

following protonation in the acidic environment, resulting in a hydrophobic, 

helical structure that inserts and disrupts the vesicular membrane, releasing the 

contents. This is an elegant use of nature’s evolutionary success in a nonviral 

system. Other synthetic peptides displaying similar properties have also been 

used, such as glutamic acid–alanine–leucine–alanine (GALA) (91) and lysinealanine-leucine-alanine 

(KALA) (92). The immunogenic potential of these peptides 

is minimal because they are small. 

Other membrane-disrupting methods employed include ultrasound (39) and 

a method called photochemical transfection, which uses photosensitizing compounds 

to accumulate in lysosomal membranes of a selected tissue, which disrupt 

the vesicle upon illumination (93). 

4.2.3. Cytoplasm Stability 

Transport across the cytoplasm is a relatively slow process, depending on 

the size of the complexes. A fine balance, however, is needed between the 

requirement for protection of the DNA from cytoplasmic nucleases and the 

ability of the complexes to disassemble, freeing the DNA for nuclear entry. 

Recently, intracellular release of DNA has been more specifically triggered by 

using polyplexes (85, 94) or cationic lipids (95) containing disulfide bonds, 

which reduce and release the DNA in the cytoplasm. However, there is evidence 

of intact PEI–DNA complexes reaching the nucleus, so it may not be 

necessary to separate components prior to nuclear entry (86). 

4.2.4. Transport to the Nucleus 

DNA nuclear entry has been suggested to be dependent on cell division and 

nuclear envelope dissolution. However, this is not universal to all nonviral vectors, 

and certainly linear PEI (96) and RGD peptides (97, 98) have been shown 

to successfully transfect postmitotic cells. It is thought that DNA is also able to 

enter through pores in the nuclear membrane. 

It has been suggested that less than 1% of the plasmid DNA molecules in the 

cytoplasm actually reach the nucleus. These levels can be improved by incor-


porating a nuclear localizing signal (NLS) peptide to redirect DNA transport to 

the nucleus. Some vectors, including polylysine, the fusogenic peptide, and 

PEI, are thought to have intrinsic nuclear homing abilities. Some sequences 

within the plasmid DNA have been suggested to lead to nuclear import by 

binding to cellular proteins such as transcription factors (99). 

Several NLSs have been isolated from proteins that are naturally synthesised 

in the cytoplasm but are required in the nucleus. Most are centered around a 

lysine or arginine motif. The most commonly used NLS is from the SV40 large 

T antigen (100). 

5. Specificity and Longevity of Gene Expression 

Gene delivery using nonviral vectors results in transient episomal expression 

of the plasmid. This has major advantages over integrating viral vectors, which 

have been shown to integrate into the host genome at sites of tumor suppression 

or oncogenic activation. However, expression with nonviral vectors is short 

lived, and, despite its low immunogenicity, which would enable multiple administration 

in vivo, for many clinical applications long-term expression would be 

favored. To address this issue, research has looked at a number of approaches. 

The inclusion of tissue-specific locus control regions (101,102) and similarly the 

addition of ubiquitous chromatin-opening elements in the DNA plasmids have 

been shown to improve longevity of expression by delaying gene silencing and 

holding the DNA in a more open, transcriptionally active conformation. The production 

of artificial chromosomes containing all of the features necessary to confer 

their own gene transcription and regulation independently of the cell’s 

machinery (reviewed in ref. 103) is another avenue explored. More recently, a 

safer system for site-selective mammalian genome integration using transposons 

(e.g., Sleeping Beauty) has been developed (104). 

6. Conclusion 

Nonviral vectors have many distinct advantages over viruses, not least because 

they lack all potentially hazardous viral components. They can theoretically take 

a DNA piece of any size to a targeted type of cell or tissue for treatment of a 

specific disease. From a manufacturing point of view, they are readily standardized, 

easy to prepare, and relatively low in cost. 

The major disadvantage of nonviral vectors is that, currently, the transfection 

efficiency is lower than that achieved with viruses and expression is only 

transient, although their relative nonimmunogenicity makes them ideally suited 

for repeat administration. 

It is clear that there will never be a universal DNA vector applicable for all 

gene-therapy treatments. Delivery strategies need to be optimized on a disease-by-disease 

basis. While nonviral vectors have not yet reached clinical use,

216 Collins 

there are, to date, more than 80 clinical trials for a range of diseases including 

cystic fibrosis, arthritis, artery disease, and many cancers, all using nonviral 

vectors (http://www.wiley.co.uk/genetherapy). As a better understanding of 

extracellular and intracellular barriers to gene delivery is unleashed, we will in 

time develop a more refined nonviral design that will ultimately lead to successful 

gene-therapy treatment. 

While still in its infancy, the application of gene therapy for transplantation 

holds great promise for modulating graft or host immune responses. It may 

eventually replace or at least substantially reduce the aggressive immunosuppressive 

regime that is currently essential to organ graft survival. Additionally, 

there is a possibility of furthering the genetic modification of organs to make 

them acceptable for xenotransplantation. 

References 

1. Marshall, E. (1999) Gene therapy death prompts review of adenovirus vector. 

Science 286, 2244–2245. 

2. Marshall, E. (2003) Gene therapy. Second child in French trial is found to have 

leukemia. Science 299, 320. 

3. Herweijer, H. and Wolff, J. A. (2003) Progress and prospects: naked DNA gene 

transfer and therapy. Gene Ther. 10, 453–458. 

4. Velaz-Faircloth, M., Cobb, A. J., Horstman, A. L., Henry, S. C., and Frothingham, 

R. (1999) Protection against Mycobacterium avium by DNA vaccines expressing 

mycobacterial antigens as fusion proteins with green fluorescent protein. Infect. 

Immunol. 67, 4243–4250. 

5. Geissler, E. K., Wang, J., Fechner, J. H. Jr., Burlingham, W. J., and Knechtle, S. 

J. (1994) Immunity to MHC class I antigen after direct DNA transfer into skeletal 

muscle. J. Immunol. 152, 413–421. 

6. Zhang, G., Vargo, D., Budker, V., Armstrong, N., Knechtle, S., and Wolff, J. A. 

(1997) Expression of naked plasmid DNA injected into the afferent and efferent 

vessels of rodent and dog livers. Hum. Gene Ther. 8, 1763–1772. 

7. Qin, L., Chavin, K. D., Ding, Y., et al. (1995) Multiple vectors effectively achieve 

gene transfer in a murine cardiac transplantation model. Transplantation 59, 809– 

816. 

8. Alexander, M. Y., Webster, K. A., McDonald, P. H., and Prentice, H. M. (1999) 

Gene transfer and models of gene therapy for the myocardium. Clin. Exp. 

Pharmacol. Physiol 26, 661–668. 

9. Yu, W. H., Kashani-Sabet, M., Liggitt, D., Moore, D., Heath, T. D., and Debs, R. J. 

(1999) Topical gene delivery to murine skin. J. Invest. Dermatol. 112, 370–375. 

10. Schwartz, B., Beonoist, C., Abdullah, B., et al. (1996) Gene transfer by naked 

DNA into adult mouse brain. Gene Ther. 3, 405–411. 

11. Meuli-Simmen, C., Liu, Y., Yeo, T. T., et al. (1999) Gene expression along the 

cerebral-spinal axis after regional gene delivery. Hum. Gene Ther. 10, 2689– 

2700.


12. Yang, J.-P. and Huang, L. (1996) Direct gene transfer to mouse melanoma by 

intratumor injection of free DNA. Gene Ther. 3, 542–548. 

13. Zhang, G., Budker, V., Williams, P., Hanson, K., and Wolff, J. A. (2002) Surgical 

procedures for intravascular delivery of plasmid DNA to organs. Methods 

Enzymol. 346, 125–133. 

14. Kawabata, K., Takakura, Y., and Hashida, M. (1995) The fate of plasmid DNA 

after intravenous injection in mice: involvement of scavenger receptors in its 

hepatic uptake. Pharm. Res. 12, 825–830. 

15. Maruyama, H., Higuchi, N., Nishikawa, Y.,et al. (2002) High-level expression of 

naked DNA delivered to rat liver via tail vein injection. J. Gene Med. 4, 333–341. 

16. Maruyama, H., Higuchi, N., Nishikawa, Y., et al. (2002) Kidney-targeted naked 

DNA transfer by retrograde renal vein injection in rats. Hum. Gene Ther. 13, 

455–468. 

17. Yang, N.-S., Burkholder, J., Roberts, B., Martinell, B., and McCabe, D. (1990) 

In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment. 

Proc. Natl. Acad. Sci. USA 87, 9568–9572. 

18. Sun, W. H., Burkholder, J. K., Sun, J., et al. (1995) In vivo cytokine gene transfer 

by gene gun reduces tumor growth in mice. Proc. Natl. Acad. Sci. USA 92, 2889– 

2893. 

19. Taniyama, Y., Tachibana, K., Hiraoka, K., et al. (2002) Development of safe and 

efficient novel nonviral gene transfer using ultrasound: enhancement of transfection 

efficiency of naked plasmid DNA in skeletal muscle. Gene Ther. 9, 372–380. 

20. Weaver, J. C. (1993) Electroporation: a general phenomenon for manipulating 

cells and tissues. J. Cell. Biochem. 51, 426–435. 

21. Somiari, S., Glasspool-Malone, J., Drabick, J. J., et al. (2000) Theory and in vivo 

application of electroporative gene delivery. Mol. Ther. 2, 178–187. 

22. Li, S. and Benninger, M. (2002) Applications of muscle electroporation gene 

therapy. Curr. Gene Ther. 2, 101–105. 

23. Mislick, K. A. and Baldeschwieler, J. D. (1996) Evidence for the role of proteoglycans 

in cation-mediated gene transfer. Proc. Natl. Acad. Sci. USA 93, 12,349– 

12,354. 

24. Felgner, P. L., Gadek, T. R., Holm, M., et al. (1987) Lipofection: a highly efficient, 

lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. USA 

84, 7413–7417. 

25. Zabner, J., Fasbender, A. J., Moninger, T., Poellinger, K. A., and Welsh, M. J. 

(1995) Cellular and molecular barriers to gene transfer by a cationic lipid. J. Biol. 

Chem. 270, 18,997–19,007. 

26. Felgner, P. L. and Ringold, G. M. (1989) Cationic liposome-mediated transfection. 

Nature 337, 387–388. 

27. Legendre, J.-Y. and Szoka, F. C. Jr. (1993) Cyclic amphipathic peptide-DNA 

complexes mediated high-efficiency transfection of adherent mammalian cells. 


28. Templeton, N. S. (2003) Cationic liposomes as in vivo delivery vehicles. Curr. 

Med. Chem. 10, 1279–1287.

218 Collins 

29. Niculescu-Duvaz, D., Heyes, J., and Springer, C. J. (2003) Structure-activity relationship 

in cationic lipid mediated gene transfection. Curr. Med. Chem. 10, 1233– 

1261. 

30. Farhood, H., Serbina, N., and Huang, L. (1995) The role of dioleoyl phosphatidylethanolamine 

in cationic liposome mediated gene transfer. Biochim. Biophys. 

Acta 1235, 289–295. 

31. Hafez, I. M., Maurer, N., and Cullis, P. R. (2001) On the mechanism whereby 

cationic lipids promote intracellular delivery of polynucleic acids. Gene Ther. 8, 

1188–1196. 

32. Itano, H., Mora, B. N., Zhang, W., et al. (2001) Lipid-mediated ex vivo gene 

transfer of viral interleukin 10 in rat lung allotransplantation. J. Thorac. 

Cardiovasc. Surg. 122, 29–38. 

33. DeBruyne, L. A., Li, K., Chan, S. Y., Qin, L., Bishop, D. K., and Bromberg, J. 

S. (1998) Lipid-mediated gene transfer of viral IL-10 prolongs vascularised 

cardiac allograft survival by inhibiting donor-specific cellular and humoral 

immune responses. Gene Ther. 5, 1079–1087. 

34. Liu, Y., Liggitt, D., Zhong, W., Tu, G., Gaensler, K., and Debs, R. (1995) Cationic 

liposome-mediated intravenous gene delivery. J. Biol. Chem. 270, 24,864–24,870. 

35. Ishiwata, H., Suzuki, N., Ando, S., Kikuchi, H., and Kitagawa, T. (2000) Characteristics 

and biodistribution of cationic liposomes and their DNA complexes. J. 

Control Release 69, 139–148. 

36. Keogh, M.-C., Chen, D., Lupu, F., et al. (1997) High efficiency reported gene 

transfection of vascular tissue in vitro and in vivo using a cationic lipid-DNA 

complex. Gene Ther. 4, 162–171. 

37. Remy, J.-S., Kichler, A., Mordvinov, V., Schuber, F., and Behr, J.-P. (1995) Targeted 

gene transfer into hepatoma cells with lipopolyamine-condensed DNA particles 

presenting galactose ligands: A stage toward artificial viruses. Proc. Natl. 

Acad. Sci. USA 92, 1744–1748. 

38. Filion, M. C. and Phillips, N. C. (1997) Toxicity and immunomodulatory activity 

of liposomal vectors formulated with cationic lipids toward immune effector 

cells. Biochim. Biophys. Acta 1329, 345–356. 

39. Anwer, K., Kao, G., Proctor, B., Anscombe, I., Florack, V., Earls, R., Wilson, E., 

McCreery, T., Unger, E., Rolland, A., and Sullivan, S. M. (2000) Ultrasound 

enhancement of cationic lipid-mediated gene transfer to primary tumors following 

systemic administration. Gene Ther. 7, 1833–1839. 

40. Kim, J. K., Choi, S. H., Kim, C. O., Park, J. S., Ahn, W. S., and Kim, C. K. (2003) 

Enhancement of polyethylene glycol (PEG)-modified cationic liposome-mediated 

gene deliveries: effects on serum stability and transfection efficiency. J. 

Pharm. Pharmacol. 55, 453–460. 

41. Cheng, P. W. (1996) Receptor ligand facilitated gene transfer: enhancement of 

liposome-mediated gene transfer and expression by transferrin. Hum. Gene Ther. 

7, 285–282. 

42. Hofland, H. E., Masson, C., Iginla, S., et al. (2002) Folate-targeted gene transfer 

in vivo. Mol. Ther. 5, 739–744.


43. Hara, T., Aramaki, Y., Takada, S., Koike, K., and Tsuchiya, S. (1995) Receptormediated 

transfer of pSV2CAT DNA to mouse liver cells using asialofetuin-labeled 

liposomes. Gene Ther. 2, 784–788. 

44. Tan, P. H., Manunta, M., Ardjomand, N., et al. (2003) Antibody targeted gene 

transfer to endothelium. J. Gene Med. 5, 311–323. 

45. Gao, X. and Huang, L. (1996) Potentiation of cationic liposome-mediated gene 

delivery by polycations. Biochem. 35, 1027–1036. 

46. Vitiello, L., Chonn, A., Wasserman, J. D., Duff, C., and Worton, R. G. (1996) 

Condensation of plasmid DNA with polylysine improves liposome-mediated 

gene transfer into established and primary muscle cells. Gene Ther. 3, 396–404. 

47. Hart, S. L., Arancibia-Cárcamo, C. V., Wolfert, M. A., et al. (1998) Lipid-mediated 

enhancement of transfection by a nonviral integrin-targeting vector. Hum. 

Gene Ther. 9, 575–585. 

48. Li, J. M., Collins, L., Zhang, X., Gustafsson, K., and Fabre, J. W. (2000) Efficient 

gene delivery to vascular smooth muscle cells using a nontoxic, synthetic 

peptide vector system targeted to membrane integrins: a first step toward the 

gene therapy of chronic rejection. Transplantation 70, 1616–1624. 

49. Zhang, X., Collins, L., and Fabre, J. W. (2001) A powerful cooperative interaction 

between a fusogenic peptide and lipofectamine for the enhancement of receptortargeted, 

non-viral gene delivery via integrin receptors. J. Gene Med. 3, 560–568. 

50. Dodds, E., Piper, T. A., Murphy, S. J., and Dickson, G. (1999) Cationic lipids 

and polymers are able to enhance adenoviral infection of cultured mouse 

myotubes. J. Neurochem. 72, 2105–2112. 

51. Kaneda, Y. (2001) Improvements in gene therapy technologies. Mol. Urol. 5, 

85–89. 

52. Haensler, J. and Szoka, F. C. Jr. (1993) Synthesis and characterisation of a 

trigalactosylated bisacridine compound to target DNA to hepatocytes. Bioconjug. 

Chem. 4, 85–93. 

53. Soto, J., Bessodes, M., Pitard, B., Mailhe, P., Scherman, D., and Byk, G. (2000) 

Non-electrostatic complexes with DNA: towards novel synthetic gene delivery 

systems. Bioorg. Med. Chem. Lett. 10, 911–914. 

54. Fominaya, J. and Wels, W. (1996) Target cell specific DNA transfer mediated by 

a chimeric multidomain protein. J. Biol. Chem. 271, 10,560–10,568. 

55. Marquet, R., Wyart, A., and Houssier, C. (1987) Influence of DNA length on 

spermine-induced condensation. Importance of the bending and stiffening of 

DNA. Biochim. Biophys. Acta. 909, 165–172. 

56. Fritz, J. D., Herweijer, H., Zhang, G., and Wolff, J. A. (1996) Gene transfer into 

mammalian cells using histone-condensed plasmid DNA. Hum. Gene Ther. 7, 

1395–1404. 

57. Sorgi, F. L., Bhattacharya, S., and Huang, L. (1997) Protamine sulfate enhances 

lipid-mediated gene transfer. Gene Ther. 4, 961–968. 

58. Wagner, E., Cotten, M., Foisner, R., and Birnstiel, M. L. (1991) Transferrinpolycation-DNA 

complexes: The effect of polycations on the structure of the 

complex and DNA delivery to cells. Proc. Natl. Acad. Sci. USA 88, 4255–4259.

220 Collins 

59. Wolfert, M. A. and Seymour, L. W. (1996) Atomic force microscopic analysis of 

the influence of the molecular weight of poly(L)lysine on the size of polyelectrolyte 

complexes formed with DNA. Gene Ther. 3, 269–273. 

60. Chiow, H. C., Tangco, M. V., Levine, S. M., et al. (1994) Enhanced resistance to 

nuclease degradation of nucleic acids complexes to asialoglycoprotein-polylysine 

carriers. Nuc. Acid. Res. 22, 5439–5446. 

61. Olins, D. E., Olins, A. L., and Von Hippel, P. H. (1986) Model nucleoprotein 

complexes: Studies on the interaction of cationic homopolypeptides with DNA. 

J. Mol. Biol. 24, 157–176. 

62. Lemoine, N. R. and Cooper, D. N. (1996) Gene Therapy. Bios Scientific Publishers, 

Oxford, UK. 

63. Gill, T. J., Papermaster, D. S., Kunz, H. W., and Marfey, P. S. (1968) Studies on 

synthetic polypeptide antigens. J. Biol. Chem. 213, 289–300. 

64. Wilson, J. M., Grossman, M., Wu, C. H., Chowdhury, N. R., Wu, G. Y., and 

Chowdhury, J. R. (1992) Hepatocyte-directed gene transfer in vivo to transient 

improvement of Hypercholesterolemia in low density lipoprotein receptor-deficient 

rabbits. J. Biol. Chem. 267, 963–967. 

65. Kircheis, R., Wightman, L., and Wagner, E. (2001) Design and gene delivery 

activity of modified polyethylenimines. Adv. Drug Deliv. Rev. 53, 341–358. 

66. Goula, D., Remy, J.-S., Erbacher, P., et al. (1998) Size, diffusibilty and transfection 

performance of linear PEI/DNA complexed in the mouse central nervous 

system. Gene Ther. 5, 712–717. 

67. Boussif, O., Lezoualc’h, F., Zanta, M. A., et al. (1995) A versatile vector for gene 

and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. 


68. Kichler, A., Leborgne, C., Coeytaux, E., and Danos, O. (2001) Polyethyleniminemediated 

gene delivery: a mechanistic study. J. Gene Med. 3, 135–144. 

69. Boletta, A., Benigni, A., Lutz, J., Remuzzi, G., Soria, M. R., and Monaco, L. 

(1997) Nonviral gene delivery to the rat kidney with polyethylenimine. Hum. 

Gene Ther. 8, 1243–1251. 

70. Lemkine, G. F., Goula, D., Becker, N., Paleari, L., Levi, G., and Demeneix, B. A. 

(1999) Optimisation of polyethylenimine-based gene delivery to mouse brain. J. 

Drug Target 7, 305–312. 

71. Coll, J. L., Chollet, P., Brambilla, E., Desplanques, D., Behr, J. P., and Favrot, 

M. (1999) In vivo delivery to tumors of DNA complexed with linear polyethylenimine. 

Hum. Gene Ther. 10, 1659–1666. 

72. Aoki, K., Furuhata, S., Hatanaka, K., et al. (2001) Polyethylenimine-mediated 

gene transfer into pancreatic tumor dissemination in the murine peritoneal cavity. 

Gene Ther. 8, 508–514. 

73. Ferrari, S., Pettenazzo, A., Garbati, N., Zacchello, F., Behr, J. P., and Scarpa, M. 

(1999) Polyethylenimine shows properties of interest for cystic fibrosis gene 

therapy. Biochim. Biophys. Acta 1447, 219–225. 

74. Ogris, M., Brunner, S., Schuller, S., Kircheis, R., and Wagner, E. (1999) 

PEGylated DNA/transferrin-PEI complexes: reduced interaction with blood com-


ponents, extended circulation in blood and potential for systemic gene delivery. 

Gene Ther. 6, 595–605. 

75. Nguyen, H. K., Lemieux, P., Vinogradov, S. V., et al. (2000) Evaluation of 

polyether-polyethyleneimine graft copolymers as gene transfer agents. Gene 

Ther. 7, 126–138. 

76. Kircheis, R., Kichler, A., Wallner, G., et al. (1997) Coupling of cell-binding 

ligands to polyethylenimine for targeted gene delivery. Gene Ther. 4, 409–418. 

77. Erbacher, P., Remy, J. S., and Behr, J. P. (1999) Gene transfer with synthetic 

virus-like particles via the integrin-mediated endocytosis pathway. Gene Ther. 6, 

138–145. 

78. Kircheis, R., Kichler, A., Wallner, G., et al. (1997) Coupling of cell-binding 

ligands to polyethylenimine for targeted gene delivery. Gene Ther. 4, 409–418. 

79. Blessing, T., Kursa, M., Holzhauser, R., Kircheis, R., and Wagner, E. (2001) 

Different strategies for formation of pegylated EGF-conjugated PEI/DNA complexes 

for targeted gene delivery. Bioconjug. Chem. 12, 529–537. 

80. Tang, M. X., Redemann, C. T., and Szoka, F. C. Jr. (1996) In vitro gene delivery 

by degraded polyamidoamine dendrimers. Bioconjug. Chem. 7, 703–714. 

81. Hudde, T., Rayner, S. A., Comer, R. M., et al. (1999) Activated polyamidoamine 

dendrimers, a non-viral vector for gene transfer to the corneal endothelium. Gene 

Ther. 6, 939–943. 

82. Qin, L., Pahud, D. R., Ding, Y., et al. (1998) Efficient transfer of genes into 

murine cardiac grafts by Starburst polyamidoamine dendrimers. Hum. Gene Ther. 

9, 553–560. 

83. Oupicky, D., Konak, C., Dash, P. R., Seymour, L. W., and Ulbrich, K. (1999) 

Effect of albumin and polyanion on the structure of DNA complexes with polycation 

containing hydrophilic nonionic block. Bioconjug. Chem. 10, 764–772. 

84. Plank, C., Mechtler, K., Szoka, F. C. Jr., and Wagner, E. (1996) Activation of the 

complement system by synthetic DNA complexes: a potential barrier for intravenous 

gene delivery. Hum. Gene Ther. 7, 1437–1446. 

85. Oupicky, D., Carlisle, R. C., and Seymour, L. W. (2001) Triggered intracellular 

activation of disulfide crosslinked polyelectrolyte gene delivery complexes with 

extended systemic circulation in vivo. Gene Ther. 8, 713–724. 

86. Godbey, W. T., Wu, K. K., and Mikos, A. G. (1999) Tracking the intracellular 

path of poly(ethylenimine)/DNA complexes for gene delivery. Proc. Natl. Acad. 

Sci. USA 96, 5177–5181. 

87. Ford, K. G., Souberbielle, B. E., Darling, D., and Farzaneh, F. (2001) Protein 

transduction: an alternative to genetic intervention? Gene Ther. 8, 1–4. 

88. Elliott, G. and O’Hare, P. (1997) Intercellular trafficking and protein delivery by 

a herpesvirus structural protein. Cell 88, 223–233. 

89. Tietz, P. S., Yamazaki, K., and LaRusso, N. F. (1990) Time-dependent effects of 

chloroquine on pH of hepatocyte lysosomes. Biochem. Pharmacol. 40, 1419– 

1421. 

90. Carr, C. M. and Kim, P. S. (1993) A spring loaded mechanism for the 

comformational change of influenza hemagglutinin. Cell 73, 823–832.

222 Collins 

91. Simoes, S., Slepushkin, V., Gaspar, R., de Lima, M. C., and Duzgunes, N. (1998) 

Gene delivery by negatively charged ternary complexes of DNA, cationic liposomes 

and transferrin or fusigenic peptides. Gene Ther. 5, 955–964. 

92. Lim, D. W., Yeom, Y. I., and Park, T. G. (2000) Poly(DMAEMA-NVP)-b-PEGgalactose 

as gene delivery vector for hepatocytes. Bioconjug. Chem. 11, 688–695. 

93. Hogset, A., Prasmickaite, L., Tjelle, T. E., and Berg, K. (2000) Photochemical 

transfection: a new technology for light-induced, site-directed gene delivery. 

Hum. Gene Ther. 11, 869–880. 

94. McKenzie, D. L., Kwok, K. Y., and Rice, K. G. (2000) A potent new class of 

reductively activated peptide gene delivery agents. J. Biol. Chem. 275, 9970– 

9977. 

95. Wetzer, B., Byk, G., Frederic, M., Airiau, M., Blanche, F., Pitard, B., and 

Scherman, D. (2001) Reducible cationic lipids for gene transfer. Biochem. J. 

356, 747–756. 

96. Brunner, S., Furtbauer, E., Sauer, T., Kursa, M., and Wagner, E. (2002) Overcoming 

the nuclear barrier: cell cycle independent nonviral gene transfer with 

linear polyethylenimine or electroporation. Mol. Ther. 5, 80–86. 

97. Shewring, L. D., Collins, L., Lightman, S. L., Hart, S. L., Gustafsson, K., and 

Fabre, J. W. (1997) A nonviral vector system for efficient gene transfer to corneal 

endothelial cells via membrane integrins. Transplantation 64, 763–769. 

98. Collins, L., Asuni, A. A., Anderton, B. H., and Fabre, J. W. (2003) Efficient gene 

delivery to primary neuron cultures using a synthetic peptide vector system. J. 

Neurosci. Methods 125, 113–120. 

99. Vacik, J., Dean, B. S., Zimmer, W. E., and Dean, D. A. (1999) Cell-specific 

nuclear import of plasmid DNA. Gene Ther. 6, 1006–1014. 

100. Goldfarb, D. S., Gariépy, J., Schoolnik, G., and Kornberg, R. D. (1986) Synthetic 

peptides as nuclear localisation signals. Nature 322, 641–644. 

101. Miao, C. H., Thompson, A. R., Loeb, K., and Ye, X. (2001) Long-term and therapeutic-level 

hepatic gene expression of human factor IX after naked plasmid 

transfer in vivo. Mol. Ther. 3, 947–957. 

102. Miao, C. H., Ohashi, K., Patijn, G. A., et al. (2000) Inclusion of the hepatic locus 

control region, an intron, and untranslated region increases and stabilizes hepatic 

factor IX gene expression in vivo but not in vitro. Mol. Ther. 1, 522–532. 

103. Larin, Z. and Mejia, J. E. (2002) Advances in human artificial chromosome technology. 

Trends Genet. 18, 313–319. 

104. Kaminski, J. M., Huber, M. R., Summers, J. B., and Ward, M. B. (2002) Design 

of a nonviral vector for site-selective, efficient integration into the human genome. 

FASEB J. 16, 1242–1247. 

105. Ziady, A. G., Perales, J. C., Ferkol, T., Gerken, T., Beegen, H., Perlmutter, D. H., 

and Davis, P. B. (1997) Gene transfer into hepatoma cell lines via the serpin 

enzyme complex receptor. Am. J. Physiol. 273, 545–552. 

106. Patel, S., Zhang, X., Collins, L., and Fabre, J. W. (2001) A small, synthetic peptide 

for gene delivery via the serpin-enzyme complex receptor. J. Gene Med. 3, 

271–279.


107. Wu, G. Y. and Wu, C. H. (1987) Receptor-mediated in vitro gene transformation 

by a soluble DNA carrier system. J. Biol. Chem. 262, 4429–4432. 

108. Singh, M., Kisoon, N., and Ariatti, M. (2001) Receptor-mediated gene delivery 

to HepG2 cells by ternary assemblies containing cationic liposomes and 

cationized asialoorosomucoid. Drug Deliv. 8, 29–34. 

109. Chen, J., Gamou, S., Takayanagi, A., and Shimizu, N. (1994) A novel gene delivery 

system using EGF receptor-mediated endocytosis. FEBS Lett. 338, 167–169. 

110. Sosnowski, B. A., Gonzalez, A. M., Chandler, L. A., Buechler, Y. J., Pierce, G. 

F., and Baird, A. (1996) Targeting DNA to cells with basic fibroblast growth 

factor (FGF2) J. Biol. Chem. 271, 33,647–33,653. 

111. Leamon, C. P. and Low, P. S. (1991) Delivery of macromolecules into living 

cells: A method that exploits folate receptor endocytosis. Proc. Natl. Acad. Sci. 

USA 88, 5572–5576. 

112. Lee, R. J. and Low, P. S. (1994) Delivery of liposomes into cultured KB cells via 

folate receptor-mediated endocytosis. J. Biol. Chem. 269, 3198–3204. 

113. Guo, W. and Lee, R. L. (1999) Receptor-targeted gene delivery via folate-conjugated 

polyethylenimine. AAPS. PharmSci. 1, E19. 

114. Chen, J., Stickles, R. J., and Daichendt, K. A. (1994) Galactosylated histonemediated 

gene transfer and expression. Hum. Gene Ther. 5, 429–435. 

115. Ferkol, T., Lindberg, G. L., Chen, J., Perales, J. C., Crawford, D. R., Ratnoff, O. 

D., and Hanson, R. W. (1993) Regulation of the phosphoenolpyruvate 

carboxykinase/human factor IX gene introduced into the livers of adult rats by 

receptor-mediated gene transfer. FASEB J. 7, 1081–1091. 

116. Plank, C., Zatloukal, K., Cotten, M., Mechtler, K., and Wagner, E. (1992) Gene 

transfer into hepatocytes using asialoglycoprotein receptor mediated endocytosis 

of DNA complexed with an artificial tetra-antennary galactose ligand. 

Bioconjug. Chem. 3, 533–539. 

117. Carlos Perales, J., Ferkol, T., Beegen, H., Ratnoff, O. D., and Hanson, R. W. 

(1994) Gene transfer in vivo: Sustained expression and regulation of genes introduced 

into the liver by receptor-targeted uptake. Proc. Natl. Acad. Sci. USA 91, 

4086–4090. 

118. Nishikawa, M., Yamauchi, M., Morimoto, K., Ishida, E., Takakura, Y., and 

Hashida, M. (2000) Hepatocyte-targeted in vivo gene expression by intravenous 

injection of plasmid DNA complexed with synthetic multi-functional gene delivery 

system. Gene Ther. 7, 548–555. 

119. Huckett, B., Ariatti, M., and Hawtrey, A. O. (1990) Evidence for targeted gene 

transfer by receptor-mediated endocytosis. Stable expression following insulindirected 

entry of NEO into HepG2 cells. Biochem. Pharmacol. 40, 253–263. 

120. Rosenkranz, A. A., Yachmenev, S. V., Jans, D. A., et al. (1992) Receptor-mediated 

endocytosis and nuclear transport of a transfecting DNA construct. Exp. 

Cell. Res. 199, 323–329. 

121. Ding, Z. M., Cristiano, R. J., Roth, J. A., Takacs, B., and Kuo, M. T. (1995) 

Malarial circumsporozoite protein is a novel gene delivery vehicle to primary 

hepatocyte cultures and cultured cells. J. Biol. Chem. 270, 3667–3676.

224 Collins 

122. Hart, S. L., Harbottle, R. P., Cooper, R. G., Miller, A. D., Williamson, R., and 

Coutelle, C. (1995) Gene delivery and expression mediated by an integrin-binding 

peptide. Gene Ther. 2, 552–554. 

123. Hart, S. L., Collins, L., Gustafsson, K., and Fabre, J. W. (1997) Integrin-mediated 

transfection with peptides containing arginine-glycine-aspartic acid domains. Gene 

Ther. 4, 1225–1230. 

124. Harbottle, R. P., Cooper, R. G., Hart, S. L., et al. (1998) An RGD-Oligolysine 

peptide: A prototype construct for integrin mediated gene delivery. Hum. Gene 

Ther. 9, 1037–1047. 

125. Collins, L., Sawyer, G. J., Zhang, X. H., Gustafsson, K., and Fabre, J. W. (2000) 

In vitro investigation of factors important for the delivery of an integrin-targeted 

nonviral DNA vector in organ transplantation. Transplantation 69, 1168– 

1176. 

126. Midoux, P., Mendes, C., Legrand, A., et al. (1993) Specific gene transfer mediated 

by lactosylated poly-l-lysine into hepatoma cells. Nuc. Acid. Res. 21, 871– 

878. 

127. Ferkol, T., Perales, J. C., Mularo, F., and Hanson, R. W. (1996) Receptor-mediated 

gene transfer into macrophages. Proc. Natl. Acad. Sci. USA 93, 101–105. 

128. Ferkol, T., Mularo, F., Hilliard, J., et al. (1998) Transfer of the human Alpha 1antitrypsin 

gene into pulmonary macrophages in vivo. Am. J. Respir. Cell Mol. 

Biol. 18, 591–601. 

129. Diebold, S. S., Lehrmann, H., Kursa, M., Wagner, E., Cotten, M., and Zenke, M. 

(1999) Efficient gene delivery into human dendritic cells by adenovirus 

polyethylenimine and mannose polyethylenimine transfection. Hum. Gene Ther. 

10, 775–786. 

130. Wagner, E., Zenke, M., Cotten, M., Beug, H., and Birnstiel, M. L. (1990) Transferrin- 

polycation conjugates as carriers for DNA uptake into cells. Proc. Natl. 

Acad. Sci. USA 87, 3410–3414. 

131. Merwin, J. R., Carmichael, E. P., Noell, G. S., et al. (1995) CD5-mediated specific 

delivery of DNA to T lymphocytes: compartmentalization augmented by 

adenovirus. J. Immunol. Methods 186, 257–266. 

132. Coll, J. L., Wagner, E., Combaret, V., et al. (1997) In vitro targeting and specific 

transfection of human neuroblastoma cells by chCE7 antibody-mediated gene 

transfer. Gene Ther. 4, 156–161. 

133. Foster, B. J. and Kern, J. A. (1997) HER2-targeted gene transfer. Hum. Gene 

Ther. 8, 719–727. 

134. Ferkol, T., Kaetzel, C. S., and Davis, P. B. (1993) Gene transfer into respiratory 

epithelial cells by targeting the polymeric immunoglobulin receptor. J. 

Clin. Invest. 92, 2394–2400. 

135. Thurnher, M., Wagner, E., Clausen, H., et al. (1994) Carbohydrate receptormediated 

gene transfer to human T leukaemic cells. Glycobiology 4, 429–435. 

136. Fominaya, J., Uherek, C., and Wels, W. (1998) A chimeric fusion protein containing 

transforming growth factor-α mediates gene transfer via binding to the 

ECF receptor. Gene Ther. 5, 521–530.


137. Schachtschabel, U., Pavlinkova, G., Lou, D., and Kohler, H. (1996) Antibodymediated 

gene delivery for B-cell lymphoma in vitro. Cancer Gene Ther. 3, 

365–372. 

138. Rojanasakul, Y., Wang, L. Y., Malanga, C. J., Ma, J. K., and Liaw, J. (1994) Targeted 

gene delivery to alveolar macrophages via Fc receptor-mediated endocytosis. 

Pharm. Res. 11, 1731–1736.

Antibody Relevance After Transplantation 227 

10 

Detection and Clinical Relevance 

of Antibodies After Transplantation 

John D. Smith and Marlene Rose 

Summary 

Until recently, the role of antibodies in graft failure has been hampered by poor methods 

of defining specificity. Development of solid phase assays using purified major histocompatibility 

complex (MHC) molecules has greatly advanced our ability to monitor 

anti-human leukocyte antigen (HLA) antibodies in patients and to distinguish between 

HLA and non-HLA antibodies. The purpose of this chapter is to describe the methods for 

detecting antibodies and what we have learned in recent years regarding the role of welldefined 

antibodies to HLA and non-HLA antigens. Use of the complement-dependent 

lymphocytotoxic test was instrumental in defining patients who are sensitized to donor 

HLA antigens, and it still plays a major role in avoiding transplantation of organs into 

sensitized patients. However, solid phase assays are more useful for following patients 

posttransplant. A major advance has been the demonstration that anti-MHC class II antibodies 

are made late after transplantation and contribute to late graft failure. This has 

been demonstrated for renal and lung transplantation, but has not yet been confirmed for 

other organs. Clearer definition of non-HLA antibodies has been achieved, such as the 

autoantigen vimentin and MHC I-related chain A. Experimental studies using minor mismatched 

strain combinations confirm that non-HLA antibodies bind to donor endothelial 

cells; these antibodies seem to cause apoptosis but not complement-mediated lysis. 

Key Words: Antibodies; humoral rejection; non-HLA antigens; HLA; complement; 

antiendothelial antibodies. 

1. Methodological Considerations 

Human leukocyte antigen (HLA) antibodies can be detected by a number of 

different techniques that employ live cells or purified HLA molecules. Traditionally, 

cell-based techniques assessing cell viability were used, but newer 

methods utilizing purified HLA molecules bound to a solid surface giving 



227

228 Smith and Rose 

greater sensitivity and specificity are now employed. Indeed, solid phase methods 

have revolutionized detection of antibodies and have led to greater recognition 

of their importance in posttransplant events. 

1.1. Complement Dependent Cytotoxicity 

The earliest method commonly used to detect HLA-specific antibodies was a 

microlymphocytotoxic assay known as the complement-dependent cytotoxicity 

(CDC) assay (1). Briefly, viable lymphocytes are incubated with sera; during 

this stage, any antibodies present in the serum specific for the HLA molecules 

expressed on the surface of the target cells bind to the cell surface. Rabbit 

complement is added, and antibody bound to the cell surface activates the classical 

complement pathway, leading to production of the membrane attack complex 

of complement (C5-9), which ultimately causes lysis of the target cell. 

Staining of the cells is used to determine cell viability. The most commonly 

used stains are the cocktail of the fluorescent stains ethidium bromide and acridine 

orange. 

In order to determine the frequency and specificity of HLA antibodies in 

antisera, a panel of HLA-typed lymphocytes are used as targets and the specificity 

determined by the patterns of reactivity. An adequate cell panel is necessary 

in order to be able to detect all HLA antibodies. The method of selection 

of a cell panel is an important consideration. Panels can be selected to cover 

the majority of known HLA specificities, which may not reflect the frequency 

of HLA antigens in the general population, or panels can be random, where 

sera are screened with a panel of cells that are representative of the population. 

For example, a serum containing antibodies directed against the HLA-A2 antigen 

may react with 40% of the cell panel if a random panel is used because the 

HLA-A2 antigen maybe present in approx 40% of the population one is using. 

However, if a selected cell panel is used, the reactivity may be much lower. 

The results from the CDC assay have therefore been reported as a percentage 

of the cell panel with which a serum has reacted, known as the percentage 

panel reactive antibody frequency (%PRA). Each laboratory will have produced 

its own panel, and because of the differences in panel composition, the 

PRA results from different laboratories cannot be compared. Therefore, the 

use of the term PRA is decreasing, with the majority of laboratories no longer 

using the phrase. 

CDC assays are able to detect both immunoglobulin (Ig)G and IgM antibodies 

with the use of dithiothreitol (DTT) in the assay. Although relatively crude 

and insensitive, DTT breaks down disulfide bonds, and because IgM contains 

significantly more than IgG, the IgM reactivity is preferentially degraded. 

Despite its widespread use in the past, the CDC assay has a number of limitations. 

First, an adequate cell panel is difficult to obtain and maintain. Second,


cell viability and the source of complement can easily influence the specificity 

and sensitivity of the assay. In addition, only complement-dependent antibodies 

are detected, and not all antibody reactivity detected may be HLA specific. 

Furthermore, false-positive results owing to the presence of IgM non-HLA 

autoreactive antibodies can also lead to misleading results. IgM non-HLA antibodies 

react with the majority of normal lymphocytes, but not with lymphocytes 

from chronic lymphocytic leukemia (CLL) patients. These antibodies have 

been shown to be irrelevant to transplant outcome in renal transplantation (2), 

and therefore a patient should not be considered sensitized purely on the basis 

of percentage PRA. These antibodies are of the IgM class and will therefore be 

removed by treatment with DTT, and in order to determine the presence of HLA 

antibodies it is necessary to define an HLA specificity to the antibodies. 

As HLA class II antigens are only found on B cells within the lymphocyte 

populations, the detection of HLA class II antibodies has always been problematic. 

Historically, this has been achieved by using lymphocytes isolated from the 

peripheral blood of patients with CLL, a B-cell lymphoma. However, the sensitivity 

and accuracy of the assay was limited, and identification of class II antibodies 

was almost certainly underestimated. For ethical reasons it is now difficult 

to obtain blood samples from CLL patients, and their use is thus limited. 

Following transplantation, therapies used to combat rejection include the 

use of the monoclonal antibody (MAb) OKT3 and antithymocyte globulin, 

which are antibody preparations directed against T cells. Unfortunately, these 

antibodies are detectable in the serum of patients in the CDC assay demonstrated 

by an IgG response to all panel members’ lymphocytes. 

With the introduction of newer, more sensitive techniques, the use of CDC 

has declined, and it is now used as an additional test rather than a front-line 

method for the detection of HLA antibodies. Until the mid to late 1990s, the 

majority of all HLA antibody screening and published studies utilized CDC 

screening, and it was often difficult to determine the true nature and effect of 

HLA antibodies on the outcome of transplantation. 

1.2. Flow Cytometry 

Flow cytometry assays were originally developed to be more sensitive than 

the CDC assay. Rather than using panels comprised of individual cells, flow 

cytometry antibody screening used pools of cells designed to cover all of the 

major serological HLA specificities (3). The cell types used included CLL cells, 

Epstein–Barr virus transformed lymphoblastoid cell lines, as well as peripheral 

blood lymphocytes (PBLs). 

The assay involves an initial incubation of serum with target cells followed 

by a series of washes and incubation with a fluorescein isothiocyanate conjugated 

(FITC) MAb directed against human IgG. Following this, the cells are


passed through the flow cytometer, and the number of positive cells and channel 

shift increase above negative controls is calculated. Screening sera with 

individual cell panels is cumbersome for initial antibody screening, but the use 

of pooled cells enables the initial detection of antibodies. Once it is established 

that a serum contains antibodies, screening against individual cells allows the 

identification of HLA specificities. As with CDC, there are problems associated 

with assigning a %PRA. 

1.3. Solid Phase Assays 

In recent years, advances have been made in the detection of HLA-specific 

antibodies with the introduction of assays utilizing purified HLA molecules. The 

HLA molecules are purified from either lymphoblastoid cell lines for class I and 

class II molecules or from platelets for class I (4–6). Two distinct types of assay 

are available involving mixtures of HLA molecules from many (up to 100 individuals) 

cell lines to detect the presence or absence of HLA antibodies or HLA 

molecules purified from individual cell lines in order to determine the specificity 

of the antibodies. Three different types of solid phase assays are available. 

1.3.1. Flow Cytometric Bead Assays 

Flow cytometry microparticles coated with soluble HLA molecules are incubated 

with serum followed by a further incubation with an FITC MAb against 

human IgG. Beads coated with either mixtures of HLA molecules or individual 

molecules make possible detection of the presence of HLA antibodies or the 

identification of HLA specificities. Studies have shown these flow cytometry 

microparticles to be a more sensitive and specific test than CDC for the detection 

of HLA-specific antibodies (7). 

1.3.2. Enzyme-Linked Immunosorbent Assays 

Enzyme-linked immunosorbent assays (ELISAs) also incorporate soluble 

HLA antigens coating the surface of plastic trays (4, 5). Two types of ELISA 

tests are available. The first uses mixtures of HLA molecules and allows the 

determination of the presence of HLA-specific antibody, whereas the second 

assay uses HLA molecules purified from individual cells coated into separate 

wells of the plastic tray, allowing the identification of specificity. These ELISA 

tests have the advantage that reactions are based on optical density readings 

and can be ranked in order of strength to allow determination of reactivity. It is 

generally considered that ELISA test kit sensitivity is greater than that of CDC, 

but less than that of flow cytometry. 

1.3.3. Luminex Assays 

The luminex bead system incorporates minute polystyrene beads that contain 

varying amounts of two different fluorochromes. The differing amounts of


the two fluorochromes enable the separate identification of 100 different beads 

when passed through the flow cell of a specialized flow cytometer known as a 

luminex machine. Because the beads can be identified according to the amount 

of fluorochromes contained within the bead, many different bead types can be 

multiplexed in a single reaction. It is therefore possible to use panels of a large 

number of beads to identify antibody specificity. The advantage of the luminex 

assays is that they are extremely specific, highly sensitive (comparable to flow 

cytometry), and extremely rapid. 

1.4. General Comments on Solid Phase Assays 

Solid phase assays have several advantages over conventional CDC assays: 

• There is no requirement for viable lymphocytes and complement. 

• They detect only HLA-specific antibodies. 

• They detect non-complement-fixing antibodies. 

• They are objective and can be partially automated. 

• They are commercially available. 

Large studies of solid phase assays have found that they are extremely reliable 

in detecting IgG HLA antibodies, although the use of reagents to detect 

IgM antibodies appears to be less reliable. More recently, production of recombinant 

HLA molecules has enabled both flow cytometry and luminex beads to 

be coated with single HLA antigens, making the identification of HLA antibodies 

and, in the case of highly sensitized patients, the identification of HLA antigens 

to which the patient is not sensitized, simpler. 

1.5. Crossmatching 

Crossmatching for solid organ transplantation has traditionally been performed 

using the CDC test (8). In 1969 Patel and Terasaki were able to demonstrate 

that 80% of patients with a positive crossmatch against donor lymphocytes 

experienced graft failure within 2 d of transplantation compared with just 4% of 

patients with a negative crossmatch (9). It has been accepted since this time that 

renal transplantation should not proceed in the face of a positive crossmatch. 

The CDC crossmatch involves incubation of donor lymphocytes (T cells, B 

cells, or a mixture of T and B cells) with recipient serum samples followed by 

the addition of rabbit complement. An increase in cell death over control wells 

indicates the presence of donor-specific antibodies and is considered a positive 

crossmatch. Many centers also perform the crossmatch in the presence of DTT, 

as it is now believed that IgG antibodies are those significantly associated with 

graft failure. 

The recently developed flow cytometric crossmatch test is considered a 

highly sensitive method for detecting donor-specific HLA antibodies. Unfortunately, 

both the CDC and flow crossmatches detect not only HLA antibodies


but non-HLA antibodies as well. The target cells for both techniques are donor 

lymphocytes commonly isolated from donor spleen, lymph node, or peripheral 

blood. More often, T cells are isolated for detection of class I antibodies and B 

cells for the detection of class I and class II antibodies by the CDC assay. The 

use of PBLs for crossmatching is less than ideal because PBLs contain relatively 

low numbers of B cells, which could affect the reliability of the test, 

particularly for detection of class II antibodies. 

The crossmatch test, whether using CDC or flow cytometry, is always performed 

prior to renal transplantation, whereas in cardiothoracic transplantation, 

the limitations of time caused by the short ischemic time of the organs mean that 

crossmatching must be performed retrospectively (usually the following day) 

with recipient serum collected before transplantation. For sensitized patients 

undergoing cardiothoracic transplantation, a crossmatch against donor lymphocytes 

is usually performed prospectively with lymphocytes isolated from peripheral 

blood, with the transplant proceeding only if the result is negative. 

A crossmatch result is either negative or positive. A positive result is usually 

due to the presence of donor-specific antibodies but, as with CDC screening, 

may also be the result of non-HLA antibodies. If the result is caused by 

IgM non-HLA antibodies, this is not generally considered a contraindication to 

transplantation. 

As with CDC antibody screening, the CDC crossmatch suffers from a number 

of inherent problems. First, the test is relatively insensitive compared with 

flow cytometry and solid phase assays. Second, the requirement for viable cells 

of good quality is often a problem. Third, lymphocytes express many more 

molecules than HLA, and it is therefore possible that any reactivity detected 

may not necessarily be attributed to HLA antibodies. 

1.6. Screening Strategies 

It is essential that the histocompatibilty and immunogenetics (H&I) laboratory 

develop a comprehensive program for HLA antibody detection and identification 

when providing a service for solid organ transplant programs. It has 

been shown that fewer than half of the patients awaiting solid organ transplantation 

will have produced HLA antibodies (10). In the modern era it is necessary 

to have a test capable of rapidly detecting the presence of antibodies, 

followed by more extensive methods to define the specificity of the antibodies 

detected in the initial screen. The techniques outlined in the previous sections 

are all commercially available to the H&I laboratory and should not be considered 

alternative techniques. However, these techniques can all yield different 

information, and it is therefore advisable to devise screening strategies that 

utilize a combination of these techniques to maximize the information available 

to the clinician.


The crossmatch is the final test used before transplantation, and it is therefore 

essential that the screening techniques provide information predictive of 

the crossmatch test and have a comparable sensitivity and specificity. 

1.7. Detection of Non-HLA Antibodies 

Antibodies directed against a number of molecules and cell types have been 

detected and implicated in decreases in graft survival and function (11–17). 

Antibodies to cellular proteins are commhonly described using ELISA techniques 

where the target protein is either bound directly to the ELISA plate or 

captured into the assay with MAbs specific for the protein bound to the surface 

of the plate. Patient serum would then be added, followed by detection with a 

MAb to human Igs conjugated to an enzymatic system such as horseradish 

peroxidase or alkaline phosphatase allowing a colorimetric detection. 

Antibodies to particular cell types such as endothelial cells (ECs) or epithelial 

cells (14, 18,19) are often detected using flow cytometric techniques. Either 

cell lines of the specific type or primary cultured cells are incubated with patient 

serum followed by a second incubation with an FITC antibody to human Igs 

(these can also be isotype-specific). The amount of fluoroscein binding is then 

measured in the flow cytometer. 

2. Association Between Posttransplant 

Production of Antibodies and Rejection 

It is universally accepted that transplantation of organs into patients with 

preformed antibodies to donor antigens can cause hyperacute rejection, and 

this situation is avoided whenever possible. However, more controversial is 

whether antibodies formed after transplantation have a pathogenic role. There 

are three major problems with ascribing a role for antibodies in graft deterioration: 

poor definition of antigen specificity, failure to localize antibodies in the 

graft, and lack of information regarding mechanisms of damage. Considerable 

progress has been made with regard to tissue-localization of antibodies, especially 

in the area of renal transplantation; e.g., deposition of C4d in the graft is 

one of the diagnostic citeria for humoral rejection following renal transplantation 

(20). More is now known about complement-independent pathways of 

antibody activation (21). This chapter focuses on the progress made in defining 

the specificity of antibodies made after transplantation and in particular the 

distinction between HLA and non-HLA antibodies. 

Although antibodies can be damaging at any time after transplantation, the 

current interest in the long-term fate of grafts has helped to focus attention on 

antibodies. Many grafts fail or become dysfunctional because of a fibrogenic 

and obliterative disease affecting the main conduits, be they blood vessels or airways. 

Such complications are known as cardiac allograft vasculopathy (CAV),


bronchiolitis obliterans syndrome (BOS), or chronic renal rejection following 

heart, lung, and renal transplantation, respectively. 

Precise identification of antigen specificity is crucial to understanding the 

role of antibodies in graft failure, partly in order to obtain robust assays, the 

results of which can be compared between labs. Also, knowing the precise target 

of the antibody response could lead to therapeutic intervention. 

2.1. Antibodies to Major Histocompatibility Complex Antigens 

Until recently, live cells were used to measure antibody reactivity in patient 

sera, as described above. This was done using complement-dependent cytotoxicity 

or, alternatively, flow cytometry. However, using live cells underestimates 

antibodies to major histocompatibility complex (MHC) class II antigens, which 

are only expressed on monocytes and B cells in peripheral blood. Even specificities 

attributed to MHC class I antigens, which are abundantly expressed on 

the surface of leukocytes, were not always confirmed using blocking MAbs. 

Use of solid phase assays has been especially useful for defining reactivity to 

MHC class II antigens. It has been reported that a B-cell-positive crossmatch 

prior to transplantation is associated with more rejection episodes (22) or poor 

graft survival (23), but it is not known to what extent B-cell reactivity represented 

reactivity to MHC class II antigens. Human microvascular ECs constitutively 

express MHC class II antigens (24), and antibodies targeting ECs could 

be damaging. Palmer et al. have demonstrated a high association between de 

novo production of antibodies to donor-specific MHC antigens (using flow 

cytometric analysis of HLA-coated beads) and development of BOS after lung 

transplantation (25). They concluded that although de novo production of donorspecific 

anti-HLA antibodies is rare after lung transplantation (occurring in 10 

of 90 patients), 8 of 10 patients developed BOS as opposed to only 38% of the 

flow-negative patients. Of considerable interest was the observation that in 90% 

of the flow-positive cases, antibody was to MHC class II antigens. Jaramillo et 

al. (26) also reported a strong association between antidonor antibodies and 

BOS after lung transplantation; these authors compared the ELISA method with 

complement-dependent cytotoxicity and found that only 2 of 15 BOS patients 

were antibody positive by complement-dependent cytotoxicity, but 10 of 15 

were positive using the ELISA method. In contrast to Palmer et al. (25), none of 

the antibodies were against MHC class II antigens—they were all to class I 

antigens. The results of Palmer et al., along with recent studies from renal transplantation, 

suggest that anti-class II antigens are much more common than previously 

thought and are associated with late graft failure. Worthington et al. 

(27) studied 112 recipients of renal allografts that had failed within 5 yr. This 

group was compared with 123 recipients with functioning allografts who had 

been transplanted during the same time period. All recipients had been negative


for donor HLA-specific antibodies before transplantation. After transplantation, 

50.9% of the 112 patients in the failure group produced donor HLA-specific 

antibodies, compared with 1.6% of the 123 controls (p


interest in AECAs was stimulated by cases of hyperacute or accelerated rejection 

in patients who had been transplanted with a negative crossmatch to donor 

leukocytes. The early suggestion of a common polymorphic non-HLA antigen 

system between ECs and monocytes (12, 30) has not been confirmed by 

biochemical identification of the relevant antigens. It also clear that renal 

graft failure can occur because of IgM or IgG antibodies against donor ECs 

that do not cross-react with donor monocytes, lymphocytes, or keratinocytes 

(31, 32). Although cases of hyperacute rejection in the face of a negative leukocyte-specific 

crossmatch seem rarer these days, possibly owing to better 

crossmatch procedures, the story of non-HLA antibodies does not go away. 

Indeed, with more interest in the long-term fate of grafts and pathogenesis of 

chronic graft vasculopathy, there is increased interest in the role of non-HLA 

antibodies. 

There is strong evidence that non-HLA antibodies, in particular AECAs, 

can be made at any time after transplantation and are associated with acute and 

chronic rejection. One of the earliest studies to show an association between 

AECAs and chronic cardiac allograft vasculopathy used Western blotting to 

measure AECAs (13). That AECAs correlate with chronic cardiac allograft 

vasculopathy has been confirmed using flow cytometry (18) and ELISA (33, 

34). More recently, a syndrome of septal capillary injury, accompanied by endothelial 

localization of C1q, C3, C4d, and Ig deposition, has been associated 

with production of AECAs after lung transplantation (35). These patients hhhwere 

negative for PRAs at the time of diagnosis, but unfortunately this study did not 

investigate production of donor-specific antibodies. Bas-Bernardet et al., showed 

that 47% of renal transplant recipients who are presensitized to HLA antigens 

also have AECAs in their sera (36). Sera from these patients was absorbed 

against platelets (eliminating antibodies to MHC class I antigens) and tested 

against resting ABO- and HLA-matched aortic ECs. The AECAs of IgG isotype 

predominantly reacted with EC surface antigens upregulated by interferon 

(IFN)-γ and tumor necrosis factor-α; in contrast, AECAs of IgM isotype only 

reacted with untreated ECs. The EC antigens recognized by IgG were 35 and 50 

kDa. Clinically, no significant effect of pretransplant AECAs on acute rejection 

or 5-yr graft survival was detected, but as the authors caution, only 52 patients 

were analyzed in this study. 

Production of non-HLA antibodies is also associated with BOS after lung 

transplantation (14), in this case antibodies to epithelial cells. Thus, AECAs 

were found in 5 of 11 patients who developed BOS and 0 of 11 patients who 

remained free of BOS. In this study the serum had absorbed any anti-HLA 

antibodies, confirming that reactivity was not against HLA antigens. Interestingly, 

in this study, patients with BOS who were not producing non-HLA antibodies 

were making antibodies to HLA antigens (14).


As with the technical difficulties of monitoring antibodies to live cells 

described previously, the non-HLA story is complicated by the fact that 

groups use different methods of detecting AECAs, namely live, fixed, or processed 

ECs. Identification of antigen specificity not only gives one mechanistic 

insight, it usually leads to more reliable assays. Using two-dimensional 

gel electrophoretic separation of endothelial proteins, we were able to identify 

the most abundant immunoreactive endothelial antigen targeted by patient 

sera as the intermediate filament vimentin (37). Since then we have reported 

that use of a simple robust ELISA for anti-vimentin antibodies identifies 

patients at risk of developing CAV (15, 38). Vimentin is the intermediate filament 

characteristic of ECs, fibroblasts, and leukocytes. Interestingly, although 

desmin is the main intermediate filament of quiescent smooth muscle cells, 

vimentin is co-expressed in smooth muscle cells, which are proliferating or 

migrating. Vimentin is therefore abundantly expressed in the intima of blood 

vessels with CAV. The question arises as to what the source of vimentin in 

the clinical setting is. We have shown that vimentin is not present on the 

surface of healthy ECs, but it is exposed at the surface of ECs that have been 

driven into apoptosis or necrosis (Holder and Rose, in preparation). It is also 

present on the cell surface of some cell lines. In view of the fact that apoptosis/necrosis 

occur at every stage after transplantation (39), the most likely 

explanation is that vimentin is exposed on apoptopic cells—these could be of 

donor (ECs) or recipient (infiltrating leukocytes) origin. As far as we know, 

vimentin is not a polymorphic antigen. The current view is that it is acting as 

an autoantigen. We would then suggest that apoptopic cells are recognized 

by recipient dendritic cells (40) and that antigens derived from the apoptopic 

cells are processed and presented to recipient T cells in an MHC self-restricted 

manner. Recently we have used vimentin peptides bound to A*0201 tetramers 

to demonstrate the presence of vimentin-specific self-restricted CD8 + T 

cells in cardiac transplant patients (41), confirming that vimentin acts as an 

autoantigen after heart transplantation and that cross-priming, as described 

above, probably occurs. 

Experimental studies have demonstrated that transplantation breaks tolerance 

to autoantigens (42). Clinically, there have been numerous descriptions 

of antibody responses to autoantigens after heart transplantation, including anticardiac 

myosin antibodies (43,44), antiphospholipid antibodies (45), and antibodies 

to oxidized low-density lipoprotein (LDL) (46). Such responses are 

associated with more rejection episodes. Collagen V has been identified as a 

major component in human bronchiolar lavage, and experimental studies have 

suggested that immune reactivity to collagen V may reduce survival of lung 

allografts (47, 48). The majority of clinical studies have used antibody response 

as a readout of an autoimmune response.


Recent studies suggest that there may be a wide range of antigens that can act 

as autoantigens after transplantation; thus expression cloning using EC cDNA 

libraries from either human umbilical vein ECs or coronary artery ECs has identified 

a great diversity of putative autoantigens that are recognized by sera from 

patients with cardiac graft vasculopathy (49,50). These antigens include ribosomal 

proteins L7 and L9 (50), autoantigens that are also associated with autoimmune 

diseases such as systemic lupus erythematosus. Although most of the 

antigens identified were nuclear or cytoplasmic antigens, neuropilin-2 (np2), an 

antigen expressed on the surface of ECs, was also identified as a possible 

autoantigen after cardiac transplantation (49). This is interesting because np2 is 

a receptor for vascular endothelial growth factor (VEGF), suggesting that autoantibodies 

to np2 might be able to activate VEGF, thus causing EC growth, 

which might contribute to the diffuse and concentric narrowing of coronary 

arteries characteristic of cardiac graft vasculopathy. Further studies are in 

progress to test this hypothesis. A working hypothesis for involvement of autoimmune 

responses after cardiac transplantation would be that organs are damaged 

at every stage after transplantation (including prior to implantation), leading 

to release or exposure of putative autoantigens. 

There is interest in the role of apoptopic cells as reservoirs of autoantigens 

(51). Cytosolic and nuclear antigens are disorganized during apoptosis, resulting 

in exposure of cryptic epitopes (52); for example, ribosomal proteins are 

expressed as blebs at the surface of apoptopic keratinocytes, suggesting a possible 

stimulating source for the antiribosomal protein antibodies we have found 

in some of the cardiac transplant patients (50). Similarly, expression of phosphatidyl 

serine could lead to production of antiphospholipid antibodies, which 

occurs after clinical heart transplantation (45). Indeed, immunization of mice 

with apoptopic cells results in autoantibody production (53). The fact that the 

indirect pathway of antigen presentation comes to dominate immune responsiveness 

in long-term transplant patients (54) also gives support to this hypothesis. 

Whereas the majority of studies have used peptides derived from HLA 

antigens to detect the indirect pathway, there is no reason why peptides derived 

from autoantigens cannot be processed and presented by recipient antigen-presenting 

cells to potentially autoreactive T and B cells. 

Another advance in the area of non-HLA antibodies has been use of B-lymphoblastoid 

cell lines transfected with MHC class I-related A (MICA) or MHC 

class I-related B (MICB) antigens (17) to screen for antibodies. MICA and 

MICB genes are located in close proximity to the HLA-B-locus on chromosome 

6 and encode 62-kDa cell surface glycoproteins, which share limited 

sequence homologies with HLA class I (55). ECs and monocytes may express 

MICA (56), whereas lymphocytes do not. A recent study of 748 sera from 139 

renal transplant patients showed that the presence of anti-MICA antibodies


(before or after transplantation) correlated with rejection episode and early graft 

loss (17). Importantly, the antibodies causing graft loss were formed in the 

absence of donor-specific antibodies. This interesting study raises the possibility 

that reactivity to MICA antigen, expressed on ECs, may explain some of the 

earlier reports of graft loss in patients with a negative crossmatch to donor leukocytes 

(11,31,32) as well as positive binding of sera to the cell surface of live 

ECs (18,34). It must be said that Sumitran-Karuppan et al. (32) reported their 

endothelial antigen to be 97–110 kDa, which suggests it is not MICA or MICB. 

The study of Jaramillo et al. (26) reported that antibodies to epithelial cells did 

not react with ECs, excluding MICA as an antigen. However, these authors did 

report their epithelial antigen to be a 60-kDa cytosolic molecule that was present 

on the surface of some but not all cell lines. This raises the possibility that it 

could be vimentin, which we have found to be expressed on the surface of some 

EC lines (A. Holder, M. Rose, unpublished data). 

2.3. Mechanism of Damage of HLA and Non-HLA Antibodies 

Traditionally, complement-mediated lysis has been considered to be the major 

mechanism whereby IgG antibodies binding MHC class I antigens cause damage. 

It is now clear that complement-independent mechanisms are also involved. 

There is little published about how antibodies to MHC class II antigens are damaging. 

Although we know that anti-MHC class II antibodies cause activation of 

leukocytes, far less is known about their effects on parenchymal cells such as 

endothelial or epithelial cells. Recently, it has been shown that ligation of IFN-γtreated 

human fibroblasts with MAb to HLA-DR causes secretion of Rantes, 

interleukin (IL)-8, monocyte chemoattractant protein-1, and IL-6 (57). In the 

context of transplantation, it will be important to know whether alloantibodies to 

MHC class II antigens cause activation (pro-inflammatory or apoptopic?) or lysis 

of parenchymal cells. This is likely to be an area of rapid advancement it the next 

few years. 

As far as non-HLA antibodies are concerned, there is not going to be a single 

or common mechanism of damage. The wide diversity of specificities of non- 

HLA antibodies means that mechanisms of damage are likely to vary accordingly. 

It is more straightforward to understand the mechanism of damage if the 

antigens are expressed on the cell surface, such as MICA and neuropilin (discussed 

earlier). Antibodies to MICA cause complement-dependent lysis of donor 

kidney microvascular ECs and MICA-transfected cells (17). In the absence of 

complement, they induce tissue factor and plasminogen activator inhibitor of 

microvascular ECs. Similarly, antibodies that bind to a 60-kDa antigen expressed 

on epithelial cell lines cause signal transduction, resulting in epithelial cell proliferation 

and upregulation of transforming growth factor-β (14). These antibodies 

were derived from lung transplant recipients with BOS. The target of anti-


vimentin antibodies is currently not known, but the recent report that activated 

platelets express cell surface vimentin (58) suggests that anti-vimentin antibodies 

may cause platelet aggregation and initiate thrombosis. Although titers of 

antibodies to oxidized low-density lipoprotein (LDL) correlate with impaired 

coronary artery endothelial vasodilation in heart transplant recipients (46), the 

reason for this correlation may not be directly linked to antibodies. It may be that 

levels of antibodies in this case reflect the load of oxidized LDL in the arteries. 

F(ab) 2 fragments of AECAs from a patient with Kawasaki disease have been 

shown to activate human ECs to secrete IL-6 and show enhanced expression of 

adhesion molecules (59), but the precise cell surface antigen target was not elucidated. 

Indeed, it was suggested that AECAs may contain multiple target antigens, 

a situation that would apply equally to transplantation. It is difficult to 

attribute a damaging role to antibodies when the target antigen is cytosolic, but it 

is likely that some autoantibodies cross-react with cell surface antigens. Experimental 

studies that transplant across minor-mismatch MHC combinations (60– 

62) are valuable because they provide unambiguous evidence that non-HLA 

antibodies bind to donor ECs. Antigalactose antibodies, raised in Gal –/– mice, 

bind to Gal +/+ ECs and cause rejection of xenografted rat hearts transplanted into 

mice. Interestingly, the ability to cause rapid rejection was not restricted to 

complement-fixing antigalactose antibodies; IgG1 antibodies, which poorly fix 

complement, also cause rapid rejection (62). Wu et al. concluded that, although 

non-HLA antibodies bind to donor ECs, they are not efficient at fixing complement; 

nevertheless non-HLA AECAs transfer chronic graft vasculopathy in vivo 

and cause apoptosis of donor ECs in vitro (61). Interestingly, Bas-Bernardet et 

al. (36) confirm using human sera that IgG AECAs from renal transplant recipients 

induce apoptosis of human ECs but do not cause complement-mediated 

lysis. The biological effects of these in vitro assays still need to be ascertained by 

in vivo experiments. Why AECAs are so inefficient at lysing ECs by complement 

fixation is not known; it could be a function of the relative resistance of 

ECs to complement-mediated lysis or the isotype of the binding antibody. This 

issue is yet to be resolved. 

3. Conclusion 

There is good evidence that de novo production of antibodies to MHC and 

non-MHC antigens contribute to graft deterioration at all times after transplantation. 

Recent studies suggest an important role for anti-MHC class II antibodies 

in late graft failure. There are multiple mechanisms of antibody-mediated 

injury depending on the nature of the antigen and the tissues that express the 

antigens. Some of the non-HLA antigens may be part of a polymorphic system 

(such as MICA), while others may represent minor antigen mismatches and 

others appear to be autoantigens. Although complement-mediated lysis is the


conventional way to measure antibody-mediated damage, it is likely that non- 

HLA antibodies cause chronic damage to target parenchymal cells by multiple 

mechanisms including pro-inflammatory cell activation, induction of growth 

factors, fibrogenesis, thrombotic events, and apoptosis. Regular monitoring of 

posttransplant antibody production using solid phase antigen-binding assays 

will continue to clarify the role of antibodies in graft deterioration. 

References 

1. Terasaki, P. I. and McClelland, J. D. (1964) Microdroplet assay of human serum 

cytotoxins. Nature 204, 998–1000. 

2. Ting, A. (1983) The lymphocytotoxic crossmatch test in clinical renal transplantation. 


3. Harmer, A. W., Sutton, M., Bayne A., Vaughan, R. W., and Welsh. K. I. (1993) A 

highly sensitive, rapid screening method for the detection of antibodies directed 

against HLA class I and II antigens. Transplant. Int. 6, 277–280. 

4. Baier, K. A., Meyer J. A., O’Brien, B. J., et al. (1994) Solubilized HLA class I 

antigen enzyme-linked immunoassay to identify HLA-typing reagents. Hum. 

Immunol. 40, 187–190. 

5. Kao, K. J., Scornik J. C., and Small, S. J. (1993) Enzyme-linked immunoassay for 

anti-HLA antibodies—an alternative to panel studies by lymphocytotoxicity. 


6. Pei, R., Lee, J. H., Shih, N. J., Chen, M., and Terasaki, P. I. (2003) Single human 

leukocyte antigen flow cytometry beads for accurate identification of human leukocyte 

antigen antibody specificities. Transplantation 75, 43–49. 

7. Pei, R., Lee, J., Chen, T., Rojo S., and Terasaki, P. I. (1999) Flow cytometric 

detection of HLA antibodies using a spectrum of microbeads. Hum. Immunol. 60, 

1293–1302. 

8. Brand, D. L., Ray, J. G., Hare, D. B., Kayhoe D. E., and McClelland, J. D. (1970) 

Preliminary trials towards standardisation of leukocyte typing, in Histocompatibilty 

Testing (P. I. Terasaki, ed), Munskaard, Copenhagen, pp. 357–367. 

9. Patel, R. and Terasaki, P. I. (1969) Significance of the positive crossmatch test in 

kidney transplantation. N .Engl. J. Med. 280, 735–739. 

10. Lucas, D. P., Paparounis, M. L., Myers, L., Hart, J. M. and Zachary, A. A. (1997) 

Detection of HLA class I-specific antibodies by the QuikScreen enzyme-linked 

immunosorbent assay. Clin. Diagn. Lab. Immunol. 4, 252–257. 

11. Brasile, L., Zerbe, T., Rabin, B., Clarke, J., Abrams, A., and Cerilli, J. (1985) 

Identification of the antibody to vascular endothelial cells in patients undergoing 

cardiac transplantation. Transplantation 40, 672–675. 

12. Cerilli, J., Bay, W., and Brasile, L. (1983) The significance of the monocyte 

crossmatch in recipients of living-related HLA identical kidney grafts. Hum. 

Immunol. 7, 45–50. 

13. Dunn, M. J., Crisp, S. J.,, Rose, M. L., Taylor, P. M., and Yacoub, M. H. (1992) 

Anti-endothelial antibodies and coronary artery disease after cardiac transplantation. 

Lancet 339, 1566–1570.


14. Jaramillo, A., Naziruddin, B., Zhang, L., et al. (2001) Activation of human airway 

epithelial cells by non-HLA antibodies developed after lung transplantation: a 

potential etiological factor for bronchiolitis obliterans syndrome. Transplantation 

71, 966–976. 

15. Jurcevic, S., Ainsworth, M. E., Pomerance A., , et al. (2001) Anti-vimentin antibodies 

are an independent predictor of transplant-associated coronary artery disease 

after cardiac transplantation. Transplantation 71, 886–892. 

16. Latif, N., Rose, M. L., Yacoub, M. H., and Dunn, M. J. (1995) Association of 

pretransplantation antiheart antibodies with clinical course after heart transplantation. 


17. Sumitran-Holgersson, S., Wilczek, H. E., Holgersson J., and Soderstrom, K. (2002) 

Identification of the nonclassical HLA molecules, mica, as targets for humoral 

immunity associated with irreversible rejection of kidney allografts. Transplantation 

74, 268–277. 

18. Ferry, B. L., Welsh, K. I., Dunn, M. J., et al. (1997) Anti-cell surface endothelial 

antibodies in sera from cardiac and kidney transplant recipients: association with 

chronic rejection. Transplant. Immunol. 5, 17–24. 

19. Shenton, B. K., Bal, W., Bell, A. E., et al. (1995) The value of flow cytometric 

crossmatching in lung transplantation: relevance of pretransplant antibodies to 

lung epithelial cells. Transplant. Proc. 27,1295–1297. 

20. Watschinger, B. (2002) Capillary C4d deposition as a marker of humoral immunity 

in renal allograft rejection. J. Am. Soc. Nephrol. 13, 2420-2423. 

21. Lepin, E. J., Jin, Y. P., Barwe, S. P., Rozengurt, E., and Reed, E. F. (2004) HLA 

class I signal transduction is dependent on Rho GTPase and ROK12. Biochem. 

Biophys. Res. Commun. 323, 213–217. 

22. Itescu, S., Tung, T. C., Burke, E. M., et al. (1998) Preformed IgG antibodies against 

major histocompatibility complex class II antigens are major risk factors for highgrade 

cellular rejection in recipients of heart transplantation. Circulation 98, 786–793. 

23. Smith, J. D., Danskine, A. J., Laylor, R. M., Rose, M. L., and Yacoub, M. H. (1993) 

The effect of panel reactive antibodies and the donor specific crossmatch on graft 

survival after heart and heart-lung transplantation. Transplant. Immunol. 1, 60–65. 

24. Page, C., Rose, M., Yacoub, M., and Pigott, R. (1992) Antigenic heterogeneity of 

vascular endothelium. Am. J. Pathol. 141, 673–683. 

25. Palmer, S. M., Davis, R. D., Hadjiliadis, D., et al. (2002) Development of an 

antibody specific to major histocompatibility antigens detectable by flow 

cytometry after lung transplant is associated with bronchiolitis obliterans syndrome. 


26. Jaramillo, A., Smith, M. A., Phelan, D., et al. (1999) Development of ELISAdetected 

anti-HLA antibodies precedes the development of bronchiolitis obliterans 

syndrome and correlates with progressive decline in pulmonary function after 

lung transplantation. Transplantation 67, 1155–1161. 

27. Worthington, J. E., Martin, S., Al Husseini, D. M., Dyer, P. A., and Johnson, R. 

W. (2003) Posttransplantation production of donor HLA-specific antibodies as a 

predictor of renal transplant outcome. Transplantation 75, 1034–1040.


28. Pelletier, R. P., Hennessy, P. K., Adams, P. W., VanBuskirk, A. M., Ferguson, R. 

M., and Orosz, C. G. (2002) Clinical significance of MHC-reactive alloantibodies 

that develop after kidney or kidney-pancreas transplantation. Am. J. Transplant. 

2, 134–141. 

29. Bas-Bernardet, S., Hourmant, M., Valentin, N., et al. (2003) Identification of the 

antibodies involved in B-cell crossmatch positivity in renal transplantation. Transplantation 

75, 477–482. 

30. Moraes, J. R. and Stastny, P. (1977) Human endothelial cell antigens: molecular 

independence from HLA and expression in blood monocytes. Transplant. Proc. 9, 

605–607. 

31. Perrey, C., Brenchley, P. E., Johnson, R. W., and Martin, S. (1998) An association 

between antibodies specific for endothelial cells and renal transplant failure. 


32. Sumitran-Karuppan, S., Tyden, G., Reinholt, F., Berg, U., and Moller, E. (1997) 

Hyperacute rejections of two consecutive renal allografts and early loss of the 

third transplant caused by non-HLA antibodies specific for endothelial cells. 


33. Faulk, W. P., Rose, M., Meroni, P. L., et al. (1999) Antibodies to endothelial cells 

identify myocardial damage and predict development of coronary artery disease 

in patients with transplanted hearts. Hum. Immunol. 60, 826–832. 

34. Fredrich, R., Toyoda, M., Czer, L. S., et al. (1999) The clinical significance of 

antibodies to human vascular endothelial cells after cardiac transplantation. Transplantation 

67, 385–391. 

35. Magro, C. M., Deng, A., Pope-Harman, A., et al. (2002) Humorally mediated 

posttransplantation septal capillary injury syndrome as a common form of pulmonary 

allograft rejection: a hypothesis. Transplantation 74, 1273–1280. 

36. Bas-Bernardet, S., Hourmant, M., Coupel, S., et al. (2003) Non-HLA-type endothelial 

cell reactive alloantibodies in pre-transplant sera of kidney recipients trigger 

apoptosis. Am. J. Transplant 3, 167–177. 

37. Wheeler, C. H., Collins, A., Dunn, M. J., Crisp, S. J., Yacoub, M. H., and Rose, 

M. L. (1995) Characterization of endothelial antigens associated with transplant-associated 

coronary artery disease. J. Heart Lung Transplant. 14, S188– 

S197. 

38. Danskine, A. J., Smith, J. D., Stanford, R. E., Newell, H., and Rose, M. L. (2002) 

Correlation of anti-vimentin antibodies with acute and chronic rejection following 

cardiac transplantation. Hum. Immunol. 63, S30–S31. 

39. Miller, L. W., Granville, D. J., Narula, J., and McManus, B. M. (2001) Apoptosis 

in cardiac transplant rejection. Cardiol. Clin. 19, 141–154. 

40. Propato, A., Cutrona, G., Francavilla, V., et al. (2001) Apoptotic cells overexpress 

vinculin and induce vinculin-specific cytotoxic T-cell cross-priming. Nat. Med. 7, 

807–813. 

41. Barber, L. D., Whitelegg, A.. Madrigal, J. A.. Banner, N. R., and Rose, M. L. 

(2004) Detection of vimentin-specific autoreactive CD8+ T cells in cardiac transplant 

patients. Transplantation 77, 1604–1609.


42. Fedoseyeva, E. V., Tam, R. C., Popov, I. A, Orr, P. L., Garovoy, M. R., and 

Benichou, G. (1996) Induction of T cell responses to a self-antigen following 

allotransplantation. Transplantation 61, 679–683. 

43. Dunn, M. J., Rose, M. L., Latif, N., et al. (1991) Demonstration by western blotting 

of antiheart antibodies before and after cardiac transplantation. Transplantation 

51, 806–812. 

44. Warraich, R. S., Pomerance, A., Stanley, A., Banner, N. R., Dunn, M. J., and 

Yacoub, M. H. (2000) Cardiac myosin autoantibodies and acute rejection after 

heart transplantation in patients with dilated cardiomyopathy. Transplantation 69, 

1609–1617. 

45. Laguens, R. P., Argel, M. I., Chambo, J. G., et al. (1996) Anti-skeletal muscle 

glycolipid antibodies in human heart transplantation as markers of acute rejection. 

Correlation with endomyocardial biopsy. Transplantation 62, 211–216. 

46. Fang, J. C., Kinlay, S., Behrendt, D., et al. (2002) Circulating autoantibodies to 

oxidized LDL correlate with impaired coronary endothelial function after cardiac 

transplantation. Arterioscler.Thromb. Vasc. Biol. 22, 2044–2048. 

47. Haque, M. A., Mizobuchi, T., Yasufuku, K., et al. (2002) Evidence for immune 

responses to a self-antigen in lung transplantation: role of type V collagen-specific 

T cells in the pathogenesis of lung allograft rejection. J. Immunol. 169, 1542– 

1549. 

48. Yasufuku, K., Heidler, K. M., Woods, K. A., et al. (2002) Prevention of bronchiolitis 

obliterans in rat lung allografts by type V collagen-induced oral tolerance. 


49. Bates, R. L., Frampton, G., Rose, M. L., and Murphy, J. J. (2003) High diversity 

of non-human leukocyte antigens in transplant-associated coronary artery disease. 


50. Linke, A. T., Marchant, B., Marsh, P., Frampton, G., Murphy, J., and Rose, M. L. 

(2001) Screening of a HUVEC cDNA library with transplant-associated coronary 

artery disease sera identifies RPL7 as a candidate autoantigen associated with this 

disease. Clin. Exp. Immunol. 126, 173–179. 

51. Rosen, A. and Casciola-Rosen, L. A. (1999) Autoantigen as substrates for 

apoptopic proteases: implications for the pathogenesis of systemic autoimmune 

diseases. Cell Death Diff. 6, 6–12. 

52. Casciola-Rosen, L. A., Anhalt, G., and Rosen, A. (1994) Autoantigens targeted in 

systemic lupus erythematosus are clustered in two populations of surface structures 

on apoptotic keratinocytes. J. Exp. Med. 179, 1317–1330. 

53. Mevorach, D., Zhou, J. L., Song, X., and Elkon, K. B. (1998) Systemic exposure 

to irradiated apoptotic cells induces autoantibody production. J. Exp. Med 188, 

387–392. 

54. Baker, R. J., Hernandez-Fuentes, M. P., Brookes, P. A., Chaudhry, A. N., Cook, 

H. T., and Lechler, R. I. (2001) Loss of direct and maintenance of indirect 

alloresponses in renal allograft recipients: implications for the pathogenesis of 

chronic allograft nephropathy. J. Immunol. 167, 7199–7206. 

55. Bahram, S. (2000) MIC genes: from genetics to biology. Adv. Immunol. 76, 1–60.


56. Zwirner, N. W., Fernandez-Vina, M. A., and Stastny, P. (1998) MICA, a new 

polymorphic HLA-related antigen, is expressed mainly by keratinocytes, endothelial 

cells, and monocytes. Immunogenetics 47, 139–148. 

57. Meguro, M., Nishimura, F., Ohyama, H., Takashiba, S., Murayama, Y., and 

Matsushita, S. (2003) Ligation of IFN-[gamma]-induced HLA-DR molecules on 

fibroblasts induces RANTES expression via c-Jun N-terminal kinase (JNK) pathway. 

Cytokine 22, 107–115. 

58. Podor, T. J., Singh, D., Chindemi, P., et al. (2002) Vimentin exposed on activated 

platelets and platelet microparticles localizes vitronectin and plasminogen activator 

inhibitor complexes on their surface. J. Biol. Chem. 277, 7529–7539. 

59. Grunebaum, E., Blank, M., Cohen, S., et al. (2002) The role of anti-endothelial 

cell antibodies in Kawasaki disease—in vitro and in vivo studies. Clin. Exp. 

Immunol. 130, 233–240. 

60. Diujvestijn, A. M., Derhaag, J. G., and Breda Vriesman, P. J. (2000) Complement 

activation by anti-endothelial cell antibodies in MHC-mismatched and MHCmatched 

heart allograft rejection: anti-MHC-, but not anti non-MHC alloantibodies 

are effective in complement activation. Transplant. Int. 13, 363–371. 

61. Wu, G. D., Jin, Y. S., Salazar, R., et al. (2002) Vascular endothelial cell apoptosis 

induced by anti-donor non-MHC antibodies: a possible injury pathway contributing 

to chronic allograft rejection. J. Heart Lung Transplant. 21, 1174–1187. 

62. Xu, H., Yin, D., Naziruddin, B., et al. (2003) The in vitro and in vivo effects of 

anti-galactose antibodies on endothelial cell activation and xenograft rejection. J. 

Immunol. 170, 1531–1539.

Using Abs to Reprogram the Immune System 247 

11 

Reprogramming the Immune System Using Antibodies 

Luis Graca and Herman Waldmann 

Summary 

Tolerance induction induced by monoclonal antibodies or co-receptor blockade is 

robust enough to resist breakdown by adoptive transfer of lymphocytes. Such resistance, 

the hallmark of dominant tolerance, is mediated by CD4 + regulatory T cells. CD4 + CD25 + 

T cells inhibit lymphopenia-mediated accumulation of T cells in vivo, but caution should 

be exerted when investigating antigen-specific regulation in replete mice. A number of 

different deletional and tolerogenic processes following antibody-induced tolerance are 

discussed in this chapter, including activation-induced cell death, immunosuppressive 

cytokines, and immunopriveleged sites. The possibility of spreading tolerance to other 

cells, including parenchymal cells, is also discussed. This chapter emphasizes recent 

evidence that shows that self-tolerance does not rely on several mechanisms running 

independently, but rather a continuum of synergistic and overlapping mechanisms. 

Key Words: Transplantation; tolerance; regulatory T cells; antibodies; immuno-regulation; 

CD4; CD25. 


The immune system has evolved as a mechanism to protect the body against 

foreign pathogens while being harmless to self-constituents of the body. As a 

consequence, the exquisite ability the immune system has developed to react 

against foreign antigens has become the major hurdle for clinical transplantation. 

In current clinical practice, alloresponses are prevented by use of immunosuppressive 

drugs that penalize the whole of the immune system. There is a 

need for strategies that, by reprogramming the immune system, can lead to longterm 

tolerance or, at least, to the minimization of immunosuppression. The use 

of monoclonal antibodies (MAbs) has proved promising in reprogramming the 

immune system toward transplantation tolerance in experimental animals. 



247

248 Graca and Waldmann 

2. The Use of Monoclonal Antibodies in Transplantation 

The emergence of clinically useful MAbs has been slower than many have 

anticipated. During the more than 25 yr since their discovery, only a small number 

of MAbs have been licensed for clinical use as immunosuppressive agents. 

One important reason has been the realization that the inherent immunogenicity 

of MAbs can limit their efficacy. As a consequence, the use of MAbs as agents 

to reprogram the immune system in the context of transplantation cannot be 

uncoupled from the problem of eliminating their own immunogenicity. 

The first MAbs routinely used in clinical transplantation have been administered 

with the aim, at least in part, of eliminating T-cell populations. The idea 

of eliminating lymphocytes in transplant patients is not new, as demonstrated 

by old experimental methods such as the placement of a catheter collecting 

lymph from the thoracic duct or the use of polyclonal antilymphocyte sera 

(1,2). The specificity of MAbs has allowed better control of the targeted cell 

populations. Such is the case for CD3, CD25, or CAMPATH-1H MAbs. The 

anti-CD3 MAb OKT3, also known as muromab, was the first MAb licensed to 

be used to prevent rejection episodes (3). However, its own immunogenicity 

and the triggering of a cytokine release syndrome have limited its use. A MAb 

targeting CD25, the α-chain of the interleukin (IL)-2 receptor (IL-2R), offered 

the perspective of specific elimination of only the activated T cells (4). However, 

recent evidence suggests that such MAbs may be also targeting a population 

of T cells with known regulatory function (5,6). More recently, there is 

evidence that by targeting the most abundant surface antigen on the T-cell surface, 

namely the CD52 antigen with the humanized MAb CAMPATH-1H, one 

can prevent graft rejection with minimal maintenance immunosuppressive 

drugs (7,8). 

In addition to the usefulness of MAbs in eliminating cell populations in vivo, 

there is compelling evidence that some MAbs can reprogram the immune system 

towards tolerance. Such MAbs, when given short term following transplantation 

in experimental animals, frequently allow indefinite survival of the 

transplanted tissues (9,10). Among these are MAbs that target co-receptor molecules, 

such as CD4, CD3 or CD45; co-stimulatory molecules, such as CD40ligand 

(CD40L or CD154) or CD28; or adhesion molecules, such as leukocyte 

function antigen (LFA)-1 or intercellular adhesion molecule (ICAM)-1 (Table 1). 

3. Antibody-Induced Transplantation Tolerance 

The initial demonstrations that peripheral tolerance can be induced following 

short-term treatment with MAbs were published in the mid-1980s (11,12). It was 

demonstrated that immune responses toward foreign immunoglobulins could be 

prevented by a short course of anti-CD4 MAbs. Shortly thereafter, it was proven 

that depletion of CD4 + cells was not required, because similar results could be


Table 1 

Monoclonal Antibodies Effective in Prolonging 

Allograft Survival or Inducing Transplantation Tolerance 

Antibody Comments 

CD4 + CD8 + CD154 Tolerance to MHC-mismatched skin 

CD4 + CD8 (nondepleting) Tolerance to MHC-mismatched heart 

CD154 + hCTLA-4-Ig Long-term survival of MHC-mismatched skin 

CD154 + CD8 depletion Dominant tolerance to minor antigen-mismatched skin 

CD3 (nonmitogenic) Tolerance to minor antigen-mismatched skin 

CD4 Tolerance to MHC-mismatched heart 

hCTLA-4-Ig Tolerance to MHC-mismatched heart 

CD45 Tolerance to MHC-mismatched islets 

LFA1 + ICAM1 Tolerance to MHC-mismatched hearts 

CTLA, cytotoxic T-lymphocyte-associated antigen; LFA, leukocyte function antigen; ICAM, 

intercellular adhesion molecule; MHC, major histocompatability complex. (Adapted from ref. 10.) 

observed using F(ab')2 fragments (13–15), nondepleting isotypes (16), or 

nondepleting doses of synergistic pairs of anti-CD4 MAbs (17). 

A short treatment with nondepleting anti-CD4 MAbs was also shown to 

generate long-term acceptance of skin grafts differing in multiple minor transplantation 

antigens (16), even in presensitized recipients (18). The same outcome 

was seen for heart grafts across major histocompatibility complex 

barriers (19,20) or concordant xenografts (19). The treated animals accepted 

the transplanted tissues indefinitely without the need for prolonged immunosuppression 

and remained fully competent to reject unrelated (third-party) 

grafts. Clearly, antibody treatment had rendered them tolerant of antigens of 

the transplanted tissue (Fig. 1). 

Following these observations, it became clear that MAbs other than anti- 

CD4 could be used to impose peripheral transplantation tolerance. Transplantation 

tolerance or long-term graft survival were reported following treatment 

with anti-LFA1 MAbs alone (13) or in combination with anti-ICAM1 (21); with 

anti-CD2 and anti-CD3 MAbs (22); with anti-CD45RB (23); or with co-stimulation 

blockade of CD28 (24), CD40L (25,26), or both in combination (27). 

These findings have recently been extended to nonhuman primates (28,29). 

Transplantation tolerance induced with co-receptor blockade (nondepleting 

anti-CD4 and anti-CD8 MAbs) or co-stimulation blockade (nondepleting anti- 

CD154 MAbs) can be robust enough to resist breakdown by the adoptive transfer 

of lymphocytes from a nontolerant donor (16,30,31). Such “resistance” that 

is, the capacity to prevent transfused cells to mediate graft rejection, is the hallmark 

of dominant tolerance and is mediated by CD4 + regulatory T cells (31–


Fig. 1. Induction of transplantation tolerance with antibody treatment. Mice accept 

a second challenge with a graft of the same type, but readily reject third-party grafts. 

Although some alloreactive cells are likely to undergo apoptosis, some cells reactive 

to transplantation antigens, as demonstrated by proliferation assays, are present at any 

time point. 

Fig. 2. Infectious transplantation tolerance. When nontolerant lymphocytes are allowed 

to coexist with the regulatory cells in a tolerant host, with time, regulatory 

properties emerge in the initially nontolerant population. 

33). When nontolerant (naive) T cells are allowed to coexist with regulatory 

CD4 + T cells, the naive cells can themselves acquire regulatory properties, a 

process that we have named “infectious tolerance” (31–33) (Fig. 2).


4. Dominant Transplantation Tolerance 

Almost two decades have passed since the initial demonstrations that longterm 

tolerance can be induced following a brief treatment with MAbs (for a 

historical perspective, see ref. 34). However, the mechanisms by which tolerance 

is induced and maintained are not yet fully understood. The development 

of human therapies based on antibody-induced tolerance will be greatly facilitated 

by a better characterization of the mechanisms involved and may lead to 

the development of much-needed diagnostic tests for tolerance. 

4.1. Regulatory T Cells 

Since the early 1990s, it has been known that CD4 + regulatory T cells are 

necessary to achieve dominant transplantation tolerance. However, studies of 

specific subpopulations have been delayed by the lack of adequate reagents and 

in vitro assays. Recently, the field of T-cell regulation has acquired respectability 

following the identification of cell-surface markers that allow the isolation 

of CD4 + T-cell populations enriched in regulatory T cells. Initially, an isoform 

of CD45 (CD45RClow in rats or CD45RBlow in mice) (35) and, more recently, 

CD25 have been used to purify regulatory T cells (36). Not only can cells with 

this phenotype prevent in vitro T-cell proliferation, but they are also capable of 

preventing autoimmunity, inflammatory pathology, and transplant rejection 

when co-injected into lymphopenic hosts together with nonregulatory T cells 

(37–39). These same cells have also been shown to have a deleterious effect on 

the development of protective immunity in the context of infectious disease 

(Leishmania and Pneumocystis) and tumor immunity (40,41). 

The α chain of the IL-2R—the CD25 molecule—is not an exclusive marker 

for regulatory T cells. It has been known to be present on the surface of activated 

lymphocytes and is targeted by therapeutic MAbs aiming for the depletion 

of activated cells, as discussed earlier. An attempt has been made by several 

groups to define more useful markers that uniquely identify the regulatory cells 

from within the CD4 + CD25 + lymphocytes (42–46). Several have been found to 

be associated with, but not exclusive to, regulatory cells. These include cytotoxic 

T-lymphocyte-associated antigen 4 (CTLA-4) (47,48), glucocorticoidinduced 

tumor necrosis factor receptor (GITR) (43,44,49), L-selectin (CD62L) 

(50–52), and αEβ7 integrin (CD103) (43,45,53,54). Recently, much interest 

has been generated by the identification of the gene Foxp3, which encodes a 

forkhead-winged-helix transcription factor, which seems to be present exclusively 

on regulatory T cells (55–57). Viral transfection of nonregulatory T cells 

with Foxp3 renders them functionally and phenotypically identical to CD4 + CD25 + 

regulatory T cells (55). In humans a Foxp3 mutation is associated with immune 

dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome or X-linked 

autoimmunity-allergic dysregulation syndrome (55).


Despite this knowledge, we still lack incontrovertible proof that dominant 

transplantation tolerance is the responsibility of CD4 + CD25 + regulatory T cells 

alone. In fact, there is evidence suggesting this is not the case. When the regulatory 

potency of the CD4 + CD25 + and CD4 + CD25 - T-cell populations was investigated, 

it became apparent that both populations have a similar regulatory 

potency in relation to their physiological proportions (i.e., the average regulatory 

potency of one CD4 + CD25 + T cell is similar to that of 10 CD4 + CD25 - cells) 

(58). 

It is clear that CD4 + CD25 + regulatory T cells can suppress transplant rejection 

when co-transferred with effector cells into lymphopenic mice (reviewed 

in ref. 6). What is not so clear is whether strategies to induce dominant tolerance 

(mediated by regulatory T cells) lead to the expansion of CD4 + CD25 + 

regulatory cells specific for the alloantigen or rather to the expansion of other 

types of donor antigen-specific regulatory cells, probably similar to the Tr1 

cells (59), or indeed both. 

4.2. Antigen Specificity of Regulatory T Cells 

Recent reports have claimed that CD4 + CD25 + T cells from mice tolerized to 

transplants acquire the ability to mediate antigen-specific regulation (60–62). 

This issue has to remain open because none of these studies was conducted with 

a criss-cross analysis. Furthermore, where titration of (regulatory to naive) cell 

ratios was performed, “specific” suppression was seen only at a single ratio of 

effectors to regulators (62). In the absence of criss-cross studies, apparent specificity 

may be a consequence of the higher “rejectability” of the third-party tissues 

when compared with the tolerated ones. Small titration effects may simply 

reflect a reduction of aggressive cells by activation-induced cell death (AICD) 

from within the CD25 + population. 

Our own results suggest that, at least under lymphopenic conditions, 

CD4 + CD25 + regulatory T cells from tolerized mice do not behave differently 

from cells with the same phenotype obtained from naive mice or mice whose 

tolerance was induced through mixed hematopoietic chimerism, where dominant 

regulation cannot be demonstrated (63). The apparent alloantigen 

nonspecificity of CD4 + CD25 + T cells may be a consequence of their thymic 

lineage and commitment to prevention of self-reactivity. Any expansion of 

donor-alloantigen-specific CD4 + CD25 + T cells may be masked by the large 

proportion of the cells preoccupied with self-antigens shared by the allograft. 

Alternatively, one can envisage that natural regulatory T cells can collaborate 

with induced regulators, possibly with both a CD25 + and a CD25- phenotype, 

leading to the antigen-specific dominant regulation that is characteristic of lymphocyte-replete 

mice tolerized with MAbs (Fig. 3). We have recently published 

our findings that, in addition to the thymic lineage of CD4 + CD25 +


Fig. 3. The antigen-specificity problem. The current mainstream view postulates 

that CD4 + CD25 + regulatory T cells directly mediate antigen-specific suppression (A). 

However, alternative hypotheses cannot at the present be excluded. First, it is possible 

that antigen-specific suppression is an exclusive property of CD25 - regulatory T cells, 

whereas CD4 + CD25 + regulatory T cells are involved in nonspecific suppression that 

may be irrelevant in transplantation tolerance in nonlymphopenic conditions (B). Second, 

CD4 + CD25 + regulatory T cells may modulate, in an antigen-nonspecific manner, 

both effector T cells and CD25 - regulatory T cells. In this case, although specificity 

would come from the CD25 - cells, both populations acting in concert would be required 

for the overall specificity (C). 

regulatory T cells, regulatory T cells with the same phenotype can be induced 

in the periphery following CD4 MAb tolerization (64). 

An alternative hypothesis has been suggested by Stockinger and colleagues 

(65) based on their observation that T-cell competition under lymphopenic 

conditions may appear as T-cell regulation (66). In their experiments nonregulatory 

T cells, which under lymphopenic conditions are pathogenic, become 

harmless when co-injected with regulatory T cells, with T-cell clones having a 

proliferative advantage, or when injected in larger numbers. Given the striking 

capacity of CD4 + CD25 + T cells to inhibit lymphopenia-driven accumulation of 

T cells in vivo (67, 69) and the propensity of lymphopenic environments to 

promote rejection (69), one should be careful in comparing antigen-specific 

regulation in a T-cell-replete animal with homeostatic effects under lymphopenic 

conditions. 

Other CD4 + T-cell populations, distinct from the CD4 + CD25 + regulatory T 

cells, have also been shown to have suppressive properties in vitro and in vivo. 

Such is the case for IL-10-secreting Tr1 cells (70) and the Th3 cells that secrete


transforming growth factor (TGF)- β in addition to IL-10 and IL-4 (71). Whereas 

Th1 and Th2 T-cell clones can mediate transplant rejection when transfused into 

lymphopenic hosts (72), rejection can be prevented by prior transfer of Tr1 cell 

clones with the same antigen specificity (43). The antigen specificity of these 

cell populations is also poorly characterized in the context of transplantation, 

although a recent report has suggested that cells with a Tr1 phenotype may be 

antigen-specific regulators in the context of human diabetes (73). 

CD4- regulatory T cells have also been described (74–76). However, although 

such cells may be important for the regulation of certain immune responses, it is 

unlikely that they will have a major role in antibody-induced transplantation 

tolerance, in which tolerance can be broken by removal of CD4 + T cells. 

5. Control of Alloreactive Clones in Antibody-Induced Tolerance 

There is now strong evidence suggesting that alloreactive T-cell clones are 

controlled in three different ways in the course of antibody-induced tolerance: 

they can be deleted, or survive and become anergic, or become subject to regulation. 

Deletion of alloreactive clones may occur in the initial days following 

the tolerogenic treatment and results from AICD and in some instances the 

direct effect of the MAb, as appears to be the case with anti-CD40L (77,78). 

Tolerance induction can be abrogated in mice where AICD is prevented (79,80). 

It is important to note that AICD of alloreactive clones requires IL-2 signaling, 

being abrogated when cyclosporine is administered (80). This observation raises 

the concern that when anti-CD25 MAbs are given peri-transplantation to investigate 

the role of CD4 + CD25 + regulatory T cells in tolerance induction, the anti- 

CD25 MAbs may contribute to rejection by interfering with IL-2-dependent 

AICD of alloreactive clones. 

However, even when tolerance is successfully induced, it has been shown 

that some alloreactive cells escape AICD and are prevented from rejecting 

grafts through dominant regulation mediated by regulatory T cells, as evidenced 

by restoration of rejection after deletion of CD4 + T cells (containing 

the regulatory cells) (31). Such regulatory cells are likely to have a reduced 

susceptibility to AICD, perhaps through expression of antiapoptotic genes such 

as Bag-1 (81). 

Other alloreactive cells may escape deletion and become anergic cells refractory 

to further antigenic stimulation in transplanted mice treated with anti-CD4 

MAbs (82,83). It is possible that such anergic cells may functionally behave as 

active regulators simply by co-localizing with other alloreactive cells and competing 

for elements in the microenvironment (e.g., cytokines or adhesion molecules). 

As a consequence, by preventing adequate “help” from being generated, 

the anergic cells could suppress the proliferation and effector function of naive 

T cells, a model known as the “civil service model” (84).


Much has recently been published on the difficulty of inducing transplantation 

tolerance in situations where memory cells are present (85) or where host T 

cells experience lymphopenic-driven proliferation (69). Although it is clear that 

the presence of donor-antigen-reactive memory cells increases the stringency 

of the system, it is still possible, using co-receptor blockade with nondepleting 

CD4 and CD8 MAbs, to tolerize mice previously primed to alloantigens (18). 

Furthermore, although lymphopenia creates a hurdle to tolerance induction with 

MAbs that target co-stimulatory molecules, it has already been shown that Tcell-depleting 

MAbs can facilitate tolerance induction to fully mismatched skin 

allografts (86). 

6. Suppressive Mechanisms 

The manner in which regulatory T cells keep effector cells under control is 

also an issue awaiting clarification. There is evidence that inhibition of proliferation, 

one of the favorite in vitro readouts for regulatory function, may not be the 

key mechanism of regulation. Allospecific CD8 + T cells, once adoptively transferred, 

can proliferate and accumulate in tolerant mice to the same extent as in 

naïve controls (87). Yet, in tolerant mice they do not lead to graft rejection. This 

effect seems to be owing to “disarming” of the effector cells: they do not produce 

interferon (IFN)-γ or generate cytotoxic T lymphocytes (CTLs). Another example 

of differences between in vitro and in vivo conditions is the observation that 

inhibition of CD4 + proliferation and IFN-γ secretion can be observed following 

co-culture with alloantigen-specific T helper (Th)1, Th2, or Tr1 clones (88). 

Although suppression mediated by Th1 clones could be abrogated by addition of 

nitric oxide synthase (NOS), in vitro suppression mediated by Th2 and Tr1 clones 

was NOS independent. Interestingly, when the suppressive capacity of the same 

clones was assessed by in vivo capacity to prevent transplant rejection, only the 

Tr1 clone was found to have regulatory properties (43). 

Many different cytokines have been implicated as having a key role in dominant 

tolerance. Yet consensus has not been achieved. The contribution of IL-4 

and IL-10 has been extensively studied, and, although in some circumstances 

neutralization of such molecules can abrogate tolerance, albeit partially in some 

cases (89–91), other studies have described no effect (58,92), even when IL-4 

and IL-10 are simultaneously neutralized (58). TGF-β has been considered to 

be a suppressive mediator essential for in vivo prevention of inflammatory 

bowel disease (47,93), but other assays have shown regulation to be independent 

of TGF- β (94). Recently, TGF-β-dependent mechanisms were shown to 

be important for the restoration of self-tolerance in autoimmune diabetic mice 

treated with anti-CD3 MAbs (95,96). We have also found that blockade of 

TGF-β with MAbs prevents the induction of transplantation tolerance with anti- 

CD4 MAbs in T-cell receptor (TCR) transgenic mice (63).


The role of surface molecules such as CTLA-4 or GITR in antibody-induced 

tolerance still requires confirmation. Following reports that CTLA-4 blockade 

could inhibit regulation mediated by CD4 + CD25 + T cells (47,48), two studies 

have shown that CTLA-4 blockade with MAbs could prevent transplantation 

tolerance (60,97). However, our own results have failed to confirm a role for 

CTLA-4 blockade in preventing dominant transplantation tolerance (58). Similarly, 

antibodies to GITR blocked the suppressive function of CD4 + CD25 + T 

cells both in vitro and in vivo in autoimmunity models (44,49). However, the 

role of GITR in dominant transplantation tolerance remains to be clarified. 

Two reports suggested that T-cell regulation may involve contact-dependent 

mechanisms, as well as contact-independent ones (98,99). In these reports, 

CD4 + CD25 + T cells can render co-cultured CD4 + CD25 - cells anergic through a 

contact-dependent, yet-unidentified mechanism. The anergized CD4 + CD25 - T 

cells acquire suppressive function, working in a contact-independent way 

through the production of cytokines. The two reports disagree, however, on the 

nature of the cytokine that mediates the secondary suppression: one claims it is 

IL-10 and not TGF- β (98), whereas the other claims the opposite (99). It is 

important to note that the experimental systems do not depend on antigen-presenting 

cells (APCs) and use polyclonal T-cell populations. Yet tolerance in 

vivo is clearly antigen-specific and dependent on how antigen is presented. Until 

we fully understand the microenvironment basis of dominant tolerance, we cannot 

assume that any current in vitro model will provide meaningful data on the 

behavior of regulatory T cells. 

7. Induction of Immunoprivilege in Tolerated Tissues 

The observation that a regulatory T-cell population can suppress T cells in 

vivo can be explained without the need to propose direct T-cell–T-cell interaction. 

One can imagine that the regulatory effect may be mediated, at least in 

part, by third-party cells that need not even be hematopoietic. The demonstration 

that tolerated allografts harbor T cells with regulatory properties and that 

express Foxp3 is compatible with this view (63,100). It is possible that such 

regulatory T cells empower the local microenvironment with a time-limited 

capacity to prevent T-cell aggression. It is conceivable that the spreading of 

tolerance to other T cells through linked suppression or infectious tolerance 

can operate through this indirect route (Fig. 4). 

Perhaps it is time to stop considering the transplanted tissue as a passive 

participant in rejection and tolerance and to acknowledge that it may have an 

active role in these processes (101,102). 

There are now many examples of how local tissue (i.e., not lymphocytes) 

contributes to its own defense. For example, endothelial expression of heme 

oxygenase-1 is induced in accommodated rat heart grafts, leading to local pro-


Fig. 4. Regulatory T cells conferring immunoprivilege. Regulatory T cells may 

exert their suppressive activity indirectly by inducing the deployment of protective 

mechanisms by peripheral tissues. APC, antigen-presenting cell; IL, interleukin; TGF, 

transforming growth factor; IDO, indoleamine 2,3-dioxygenase. 

duction of carbon monoxide, which protects the transplant from being rejected 

(103). Moreover, tolerance induced with nondepleting anti-CD4 MAbs in rats 

is associated with changes in the matrix components that may contribute to a 

rejection-resistant environment (104). Other studies have suggested that expression 

of suppressor of cytokine-signaling 1 or indoleamine 2,3-dioxygenase by 

APCs may promote a tolerogenic environment (105–108). 

It has been reported that a close relationship between immunoprivilege and 

dominant regulation can occur in the context of the anterior chamber-associated 

immune deviation (109). Antigens placed in the anterior chamber of the eye are 

transported by APCs into the marginal zone of the spleen, where they drive the 

emergence of antigen-specific CD4 + and CD8 + regulatory T cells. The CD4 + 

regulatory cells can then exert their suppressive effect in secondary lymphoid 

organs, whereas the CD8 + regulatory cells act in the periphery (110,111). It is 

also important to consider the impact of regulatory cells within the graft on the 

components of the innate immune system that might contribute to or dampen an 

immune response. Recent reports suggest that interactions between regulatory 

T cells and the innate immune system do occur (112–114). It is particularly 

relevant to note that by secreting IL-5, T cells may recruit eosinophils to the 

graft, with these cells themselves contributing to graft rejection (115,116). It is 

not inconceivable that other cell types may be recruited or even excluded by 

regulatory lymphocytes as part of a self-defense mechanism. Consistent with 

this is the intriguing association of mast cells with regulatory T cells mediating 

skin graft tolerance (88). In this respect, gene expression studies of transplanted 

tissue may prove informative (117,118).


Fig. 5. A revised view of tolerance mechanisms. Classically different tolerance 

mechanisms have been studied as distinct phenomena (A). It is becoming clear that 

these mechanisms are a continuum of interrelated processes (B). 

The interactions established between T cells and APCs, dendritic cells (DCs) 

in particular, may be important not only for a better understanding of how tolerance 

operates, but also for therapeutic modulation of the immune response 

(119,120). Host DCs, through indirect presentation, are critical both for rejection 

and for dominant regulation (121). This phenomenon may provide an explanation 

for infectious tolerance in that continuous presentation of donor antigens 

by host DCs in a tolerogenic environment may drive the recruitment of additional 

regulatory T cells. As a consequence, it may become possible to explore 

the tolerogenic properties of DCs, for example, with genetically modified DCs 

derived from embryonic stem cells (122,123). 

8. A Revised View of Tolerance Mechanisms 

Over the years, immunologists have neatly created discrete categories of 

mechanisms that mediate self-tolerance: deletion, anergy, dominant regulation, 

immune privilege, and ignorance (Fig. 5). As discussed in a recent review 

(124), it is becoming evident that self-tolerance does not rely on several mechanisms 

running independently, but rather on a continuum of synergistic and 

overlapping mechanisms, e.g., cells that regulate may be capable of creating 

immunoprivileged sites (109), an immunoprivileged environment may promote 

the development of regulatory or anergic cells or even cell deletion (125), anergic 

cells may be able to regulate (126,127), and so on.


We all need to be increasingly aware that tolerance is maintained by several 

mechanisms operating in concert. Reductionist approaches may be useful in 

identifying components but will necessarily miss the overall picture. 


Current immunosuppressive agents, although the best option available, are 

far from ideal drugs. However, their known efficacy in preventing acute allograft 

rejection makes it ethically difficult to displace them in clinical trials of 

potential tolerogenic drugs. Safe clinical trials of experimental tolerogenic regimens 

will be greatly facilitated when tolerance can be monitored in vitro, allowing 

the use of conventional immunosuppressive drugs as soon as there is 

evidence of tolerance failure and before irreversible damage occurs. We therefore 

anticipate that some of the most important advances in the field of antibody-induced 

transplantation tolerance will be in the identification of diagnostic 

tests for the tolerant state. In this respect, the study of cellular and molecular 

characteristics of therapeutic-induced tolerance may identify cell populations, 

molecules, or gene transcripts whose presence or absence correlates with the 

maintenance of tolerance. 

Furthermore, it may be in the patient’s best interest not to aim for full tolerance 

but rather near tolerance (7,8). If a low-impact reprogramming with 

tolerizing MAbs allows long-term graft survival with low doses of immunosuppressive 

drugs, it may prove to be an effective way to prevent transplant 

rejection with few side effects and good clinician and patient compliance. A 

recent uncontrolled study has shown that cadaveric kidney recipients treated 

with two doses of 20 mg of CAMPATH-1H could be maintained on a low dose 

of cyclosporine in the absence of other immunosuppressive agents such as steroids 

(7). These patients have maintained good renal function with a low incidence 

of rejection episodes. 

It is likely that the use of tolerogenic MAbs, such as those targeting CD4, 

will prove useful in extending graft survival in the absence of side effects, even 

if small doses of immunosuppressive drugs are also administered in a neartolerance 

protocol. 

References 

1. Woodruff, M. F. and Anderson, N. A. (1963) Effect of lymphocyte depletion by 

thoracic duct fistula and administration of antilymphocytic serum on the survival 

of skin homografts in rats. Nature 200,702. 

2. Franksson, C., Lundgren, G., Magnusson, G., and Ringden, O. (1976) Drainage 

of thoracic duct lymph in renal transplant patients. Transplantation 21, 133–140. 

3. Cosimi, A. B., Colvin, R. B., Burton, R. C., et al. (1981) Use of monoclonal 

antibodies to T-cell subsets for immunologic monitoring and treatment in recipients 

of renal allografts. N. Engl. J. Med. 305, 308–314.


4. Kahan, B. D., Rajagopalan, P. R., and Hall, M. (1999) Reduction of the occurrence 

of acute cellular rejection among renal allograft recipients treated with 

basiliximab, a chimeric anti-interleukin-2-receptor monoclonal antibody. United 

States Simulect Renal Study Group. Transplantation 67, 276–284. 

5. Graca, L., Le Moine, A., Cobbold, S. P., and Waldmann, H. (2003) Antibodyinduced 

transplantation tolerance: the role of dominant regulation. Immunol. Res. 

28, 181–191. 

6. Wood, K. J., Ushigome, H., Karim, M., Bushell, A., Hori, S., and Sakaguchi, S. 

(2003) Regulatory cells in transplantation. Novartis Found. Symp. 252, 177–188. 

7. Calne, R., Moffatt, S. D., Friend, P. J., et al. (1999) Campath IH allows low-dose 

cyclosporine monotherapy in 31 cadaveric renal allograft recipients. Transplantation 

68, 1613–1616. 

8. Waldmann, H., Cobbold, S. P., Fairchild, P., and Adams, E. (2001) Therapeutic 

aspects of tolerance. Curr. Opin. Pharmacol. 1, 392–397. 

9. Waldmann, H. and Cobbold, S. (1998) How do monoclonal antibodies induce 

tolerance? A role for infectious tolerance? Annu. Rev. Immunol. 16, 619–644. 

10. Waldmann, H. and Cobbold, S. (2001) Regulating the immune response to transplants: 

a role for CD4+ regulatory cells? Immunity 14, 399–406. 

11. Benjamin, R. J. and Waldmann, H. (1986) Induction of tolerance by monoclonal 

antibody therapy. Nature 320, 449–451. 

12. Gutstein, N. L., Seaman, W. E., Scott, J. H., and Wofsy, D. (1986) Induction of 

immune tolerance by administration of monoclonal antibody to L3T4. J. 

Immunol. 137, 1127–1132. 

13. Benjamin, R. J., Qin, S. X., Wise, M. P., Cobbold, S. P,. and Waldmann, H. 

(1988) Mechanisms of monoclonal antibody-facilitated tolerance induction: a 

possible role for the CD4 (L3T4) and CD11a (LFA-1) molecules in self-non-self 

discrimination. Eur. J. Immunol. 18, 1079–1088. 

14. Carteron, N. L., Wofsy, D., and Seaman, W. E. (1988) Induction of immune tolerance 

during administration of monoclonal antibody to L3T4 does not depend on 

depletion of L3T4+ cells. J. Immunol. 140, 713–716. 

15. Carteron, N. L., Schimenti, C. L., and Wofsy, D. (1989) Treatment of murine 

lupus with F(ab’)2 fragments of monoclonal antibody to L3T4. Suppression of 

autoimmunity does not depend on T helper cell depletion. J. Immunol. 142, 1470– 

1475. 

16. Qin, S. X., Wise, M., Cobbold, S. P., et al. (1990) Induction of tolerance in peripheral 

T cells with monoclonal antibodies. Eur. J. Immunol. 20, 2737–2745. 

17. Qin, S., Cobbold, S., Tighe, H., Benjamin, R., and Waldmann, H. (1987) CD4 

monoclonal antibody pairs for immunosuppression and tolerance induction. Eur. 

J. Immunol. 17, 1159–1165. 

18. Marshall, S. E., Cobbold, S. P., Davies, J. D., Martin, G. M., Phillips, J. M., and 

Waldmann, H. (1996) Tolerance and suppression in a primed immune system. 


19. Chen, Z., Cobbold, S., Metcalfe, S., and Waldmann, H. (1992) Tolerance in the 

mouse to major histocompatibility complex-mismatched heart allografts, and to


rat heart xenografts, using monoclonal antibodies to CD4 and CD8. Eur. J. 

Immunol. 22, 805–810. 

20. Onodera, K., Lehmann, M., Akalin, E., Volk, H. D., Sayegh, M. H., and Kupiec- 

Weglinski, J. W. (1996) Induction of infectious tolerance to MHC-incompatible 

cardiac allografts in CD4 monoclonal antibody-treated sensitized rat recipients. 

J. Immunol. 157, 1944–1950. 

21. Isobe, M., Yagita, H., Okumura, K., and Ihara, A. (1992) Specific acceptance of 

cardiac allograft after treatment with antibodies to ICAM-1 and LFA-1. Science 

255, 1125–1127. 

22. Chavin, K. D., Qin, L., Lin, J., Yagita, H., and Bromberg, J. S. (1993) Combined 

anti-CD2 and anti-CD3 receptor monoclonal antibodies induce donor-specific 

tolerance in a cardiac transplant model. J. Immunol. 151, 7249–7259. 

23. Basadonna, G. P., Auersvald, L., Khuong, C. Q., et al. (1998) Antibody-mediated 

targeting of CD45 isoforms: a novel immunotherapeutic strategy. Proc. Natl. 

Acad. Sci. USA 95, 3821–3826. 

24. Lenschow, D. J., Zeng, Y., Thistlethwaite, J. R., et al. (1992) Long-term survival of 

xenogeneic pancreatic islet grafts induced by CTLA4lg. Science 257, 789–792. 

25. Parker, D. C., Greiner, D. L., Phillips, N. E., et al. (1995) Survival of mouse 

pancreatic islet allografts in recipients treated with allogeneic small lymphocytes 

and antibody to CD40 ligand. Proc. Natl. Acad. Sci. USA 92, 9560–9564. 

26. Honey, K., Cobbold, S. P., and Waldmann, H. (1999) CD40 ligand blockade 

induces CD4+ T cell tolerance and linked suppression. J. Immunol. 163, 4805–4810. 

27. Larsen, C. P., Elwood, E. T., Alexander, D. Z., et al. (1996) Long-term acceptance 

of skin and cardiac allografts after blocking CD40 and CD28 pathways. 

Nature 381, 434–438. 

28. Kirk, A. D., Burkly, L. C., Batty, D. S., et al. (1999) Treatment with humanized 

monoclonal antibody against CD154 prevents acute renal allograft rejection in 

nonhuman primates. Nat. Med. 5, 686–693. 

29. Kenyon, N. S., Chatzipetrou, M., Masetti, M., et al. (1999) Long-term survival and 

function of intrahepatic islet allografts in rhesus monkeys treated with humanized 

anti-CD154. Proc. Natl. Acad. Sci. USA 96, 8132–8137. 

30. Scully, R., Qin, S., Cobbold, S., and Waldmann, H. (1994) Mechanisms in CD4 

antibody-mediated transplantation tolerance: kinetics of induction, antigen dependency 

and role of regulatory T cells. Eur. J. Immunol. 24, 2383–2392. 

31. Graca, L., Honey, K., Adams, E., Cobbold, S. P., and Waldmann, H. (2000) Cutting 

edge: anti-CD154 therapeutic antibodies induce infectious transplantation 

tolerance. J. Immunol. 165, 4783–4786. 

32. Chen, Z. K., Cobbold, S. P., Waldmann, H., and Metcalfe, S. (1996) Amplification 

of natural regulatory immune mechanisms for transplantation tolerance. 


33. Qin, S., Cobbold, S. P., Pope, H., et al. (1993) Infectious transplantation tolerance. 

Science 259, 974–977. 

34. Waldmann, H. (2002) Reprogramming the immune system. Immunol. Rev. 185, 

227–235.


35. Powrie, F. and Mason, D. (1990) OX-22high CD4+ T cells induce wasting disease 

with multiple organ pathology: prevention by the OX-22low subset. J. Exp. 

Med. 172, 1701–1708. 

36. Sakaguchi, S., Sakaguchi, N., Asano, M., Itoh, M., and Toda, M. (1995) Immunologic 

self-tolerance maintained by activated T cells expressing IL-2 receptor 

alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes 

various autoimmune diseases. J. Immunol. 155, 1151–1164. 

37. Sakaguchi, S. (2000) Regulatory T cells: key controllers of immunologic selftolerance. 

Cell 101, 455–458. 

38. Shevach, E. M. (2002) CD4+ CD25+ suppressor T cells: more questions than 

answers. Nat. Rev. Immunol. 2, 389–400. 

39. Cobbold, S. P., Graca, L., Lin, C. Y., Adams, E., and Waldmann, H. (2003) Regulatory 

T cells in the induction and maintenance of peripheral transplantation tolerance. 

Transplant. Int. 16, 66–75. 

40. Gallimore, A. and Sakaguchi, S. (2002) Regulation of tumour immunity by 

CD25+ T cells. Immunology 107, 5–9. 

41. Mittrucker, H. W. and Kaufmann, S. H. (2004) Mini-review: regulatory T cells 

and infection: suppression revisited. Eur. J. Immunol. 34, 306–312. 

42. Lechner, O., Lauber, J., Franzke, A., Sarukhan, A., von Boehmer, H., and Buer, 

J. (2001) Fingerprints of anergic T cells. Curr. Biol. 11, 587–595. 

43. Zelenika, D., Adams, E., Humm, S., et al. (2002) Regulatory T cells over-express 

a subset of Th2 gene transcripts. J. Immunol. 168, 1069–1079. 

44. McHugh, R. S., Whitters, M. J., Piccirillo, C. A., et al. (2002) CD4(+)CD25(+) 

Immunoregulatory T cells. Gene expression analysis reveals a functional role for 

the glucocorticoid-induced TNF receptor. Immunity 16, 311–323. 

45. Gavin, M. A., Clarke, S. R., Negrou, E., Gallegos, A., and Rudensky, A. (2002) 

Homeostasis and anergy of CD4(+)CD25(+) suppressor T cells in vivo. Nat. 

Immunol. 3, 33–41. 

46. Cobbold, S. P., Adams, E., Graca, L. M., and Waldmann, H. (2003) Serial analysis 

of gene expression provides new insights into regulatory T cells. Semin. 

Immunol. 15, 209–214. 

47. Read, S., Malmstrom, V., and Powrie, F. (2000) Cytotoxic T lymphocyteassociated 

antigen 4 plays an essential role in the function of CD25(+)CD4(+) 

regulatory cells that control intestinal inflammation. J. Exp. Med. 192, 295– 

302. 

48. Takahashi, T., Tagami, T., Yamazaki, S., et al. (2000) Immunologic self-tolerance 

maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing 

cytotoxic T lymphocyte-associated antigen 4. J. Exp. Med. 192, 303–310. 

49. Shimizu, J., Yamazaki, S., Takahashi, T., Ishida, Y., and Sakaguchi, S. (2002) 

Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological 

self-tolerance. Nat. Immunol. 3, 135–142. 

50. Chatenoud, L., Salomon, B., and Bluestone, J. A. (2001) Suppressor T cells— 

they’re back and critical for regulation of autoimmunity! Immunol. Rev. 182, 

149–163.


51. Szanya, V., Ermann, J., Taylor, C., Holness, C., and Fathman, C. G. (2002) The 

subpopulation of CD4+CD25+ splenocytes that delays adoptive transfer of diabetes 

expresses L-selectin and high levels of CCR7. J. Immunol. 169, 2461–2465. 

52. Fu, S., Yopp, A. C., Mao, X., et al. (2004) CD4+ CD25+ CD62+ T-regulatory 

cell subset has optimal suppressive and proliferative potential. Am. J. Transplant. 

4, 65–78. 

53. McHugh, R. S. and Shevach, E. M. (2002) Cutting edge: depletion of CD4+CD25+ 

regulatory T cells is necessary, but not sufficient, for induction of organ-specific 

autoimmune disease. J. Immunol. 168, 5979–5983. 

54. Banz, A., Peixoto, A., Pontoux, C., Cordier, C., Rocha, B., and Papiernik, M. 

(2003) A unique subpopulation of CD4+ regulatory T cells controls wasting disease, 

IL-10 secretion and T cell homeostasis. Eur. J. Immunol. 33, 2419–2428. 

55. Hori, S., Nomura, T., and Sakaguchi, S. (2003) Control of regulatory T cell 

development by the transcription factor FOXP3. Science 299, 1057–1061. 

56. Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Foxp3 programs the 

development and function of CD4(+)CD25(+) regulatory T cells. Nat. Immunol. 

4, 330–336. 

57. Khattri, R., Cox, T., Yasayko, S. A., and Ramsdell, F. (2003) An essential role 

for Scurfin in CD4(+)CD25(+) T regulatory cells. Nat. Immunol. 4, 337–342. 

58. Graca, L., Thompson, S., Lin, C.-Y., Adams, E., Cobbold, S. P., and Waldmann, 

H. (2002) Both CD4+CD25+ and CD4+CD25- regulatory cells mediate dominant 

transplantation tolerance. J. Immunol. 168, 5558–5567. 

59. Roncarolo, M. G., Bacchetta, R., Bordignon, C., Narula, S., and Levings, M. K. 

(2001) Type 1 T regulatory cells. Immunol. Rev. 182, 68–79. 

60. Kingsley, C. I., Karim, M., Bushell, A. R., and Wood, K. J. (2002) CD25+CD4+ 

regulatory T cells prevent graft rejection: CTLA-4- and IL-10- dependent immunoregulation 

of alloresponses. J. Immunol. 168, 1080–1086. 

61. van Maurik, A., Herber, M., Wood, K. J., and Jones, N. D. (2002) Cutting edge: 

CD4(+)CD25(+) alloantigen-specific immunoregulatory cells that can prevent 

CD8(+) T cell-mediated graft rejection: implications for anti-CD154 immunotherapy. 

J. Immunol. 169, 5401–5404. 

62. Sanchez-Fueyo, A., Tian, J., Picarella, D., et al. (2003) Tim-3 inhibits T helper 

type 1-mediated auto- and alloimmune responses and promotes immunological 

tolerance. Nat. Immunol. 4, 1093–1101. 

63. Graca, L., Le Moine, A., Lin, C. Y., Fairchild, P. J., Cobbold, S. P., and 

Waldmann, H. (2004) Donor-specific transplantation tolerance: the paradoxical 

behavior of CD4+CD25+ T cells. Pro.c Natl. Acad. Sci. USA 101, 10,122–10,126. 

64. Cobbold, S. P., Castejon, R., Adams, E., et al. (2004) Induction of foxP3+ regulatory 

T cells in the periphery of T cell receptor transgenic mice tolerized to 

transplants. J. Immunol. 172, 6003–6010. 

65. Stockinger, B., Barthlott, T., and Kassiotis, G. (2001) T cell regulation: a special 

job or everyone’s responsibility? Nat. Immunol. 2, 757–758. 

66. Barthlott, T., Kassiotis, G., and Stockinger, B. (2003) T cell regulation as a side 

effect of homeostasis and competition. J. Exp. Med. 197, 451–460.


67. Annacker, O., Pimenta-Araujo, R., Burlen-Defranoux, O., Barbosa, T. C., 

Cumano, A., and Bandeira, A. (2001) CD25+ CD4+ T cells regulate the expansion 

of peripheral CD4 T cells through the production of IL-10. J. Immunol. 166, 

3008–3018. 

68. Almeida, A. R., Legrand, N., Papiernik, M., and Freitas, A. A. (2002) Homeostasis 

of peripheral CD4+ T cells: IL-2R alpha and IL-2 shape a population of regulatory 

cells that controls CD4+ T cell numbers. J. Immunol. 169, 4850–4860. 

69. Wu, Z., Bensinger, S. J., Zhang, J., et al. (2004) Homeostatic proliferation is a 

barrier to transplantation tolerance. Nat. Med. 10, 87–92. 

70. Groux, H., Bigler, M., de Vries, J. E., and Roncarolo, M. G. (1996) Interleukin- 

10 induces a long-term antigen-specific anergic state in human CD4+ T cells. J. 

Exp. Med. 184, 19–29. 

71. Chen, Y., Kuchroo, V. K., Inobe, J., Hafler, D. A., and Weiner, H. L. (1994) 

Regulatory T cell clones induced by oral tolerance: suppression of autoimmune 

encephalomyelitis. Science 265, 1237–1240. 

72. Zelenika, D., Adams, E., Mellor, A., et al. (1998) Rejection of H-Y disparate skin 

grafts by monospecific CD4+ Th1 and Th2 cells: no requirement for CD8+ T 

cells or B cells. J. Immunol. 161, 1868–1874. 

73. Arif, S., Tree, T. I., Astill, T. P., et al. (2004) Autoreactive T cell responses show 

proinflammatory polarization in diabetes but a regulatory phenotype in health. J. 

Clin. Invest. 113, 451–463. 

74. Ciubotariu, R., Colovai, A. I., Pennesi, G., et al. (1998) Specific suppression of 

human CD4+ Th cell responses to pig MHC antigens by CD8+CD28- regulatory 

T cells. J. Immunol. 161, 5193–5202. 

75. Gilliet, M. and Liu, Y. J. (2002) Generation of human CD8 T regulatory cells by 

CD40 ligand-activated plasmacytoid dendritic cells. J. Exp. Med. 195, 695–704. 

76. Zhang, Z. X., Yang, L., Young, K. J., DuTemple, B., and Zhang, L. (2000) Identification 

of a previously unknown antigen-specific regulatory T cell and its 

mechanism of suppression. Nat. Med. 6, 782–789. 

77. Sanchez-Fueyo, A., Domenig, C., Strom, T. B., and Zheng, X. X. (2002) The 

complement dependent cytotoxicity (CDC) immune effector mechanism contributes 

to anti-CD154 induced immunosuppression. Transplantation 74, 898–900. 

78. Monk, N. J., Hargreaves, R. E., Marsh, J. E., et al. (2003) Fc-dependent depletion 

of activated T cells occurs through CD40L-specific antibody rather than 

costimulation blockade. Nat. Med. 9, 1275–1280. 

79. Wells, A. D., Li, X. C., Li, Y., et al. (1999) Requirement for T-cell apoptosis in 

the induction of peripheral transplantation tolerance. Nat. Med. 5, 1303–1307. 

80. Li, Y., Li, X. C., Zheng, X. X., Wells, A. D., Turka, L. A., and Strom, T. B. 

(1999) Blocking both signal 1 and signal 2 of T-cell activation prevents apoptosis 

of alloreactive T cells and induction of peripheral allograft tolerance. Nat. 

Med. 5, 1298–1302. 

81. Sawitzki, B., Lehmann, M., Vogt, K., et al. (2002) Bag-1 up-regulation in anti- 

CD4 mAb treated allo-activated T cells confers resistance to apoptosis. Eur. J. 

Immunol. 32, 800–809.


82. Qin, S. X., Cobbold, S., Benjamin, R., and Waldmann, H. (1989) Induction of 

classical transplantation tolerance in the adult. J. Exp. Med. 169, 779–794. 

83. Alters, S. E., Shizuru, J. A., Ackerman, J., Grossman, D., Seydel, K. B. and 

Fathman, C. G. (1991) Anti-CD4 mediates clonal anergy during transplantation 

tolerance induction. J. Exp. Med. 173, 491–494. 

84. Waldmann, H., Qin, S., and Cobbold, S. (1992) Monoclonal antibodies as agents 

to reinduce tolerance in autoimmunity. J. Autoimmun. 5(Suppl. A), 93–102. 

85. Adams, A. B., Williams, M. A., Jones, T. R., et al. (2003) Heterologous immunity 

provides a potent barrier to transplantation tolerance. J. Clin. Invest. 111, 

1887–1895. 

86. Cobbold, S. P., Martin, G., and Waldmann, H. (1990) The induction of skin graft 

tolerance in major histocompatibility complex-mismatched or primed recipients: 

primed T cells can be tolerized in the periphery with anti-CD4 and anti-CD8 

antibodies. Eur. J. Immunol. 20, 2747–2755. 

87. Lin, C. Y., Graca, L., Cobbold, S. P., and Waldmann, H. (2002) Dominant transplantation 

tolerance impairs CD8(+) T cell function but not expansion. Nat. 

Immunol. 3, 1208–1213. 

88. Zelenika, D., Adams, E., Humm, S., Lin, C.-Y., Waldmann, H., and Cobbold, S. 

P. (2001) The role of CD4+ T cell subsets in determining transplantation rejection 

and tolerance. Immunol. Rev. 182, 164–179. 

89. Davies, J. D., Martin, G., Phillips, J., Marshall, S. E., Cobbold, S. P., and 

Waldmann, H. (1996) T cell regulation in adult transplantation tolerance. J. 

Immunol. 157, 529–533. 

90. Onodera, K., Hancock, W. W., Graser, E., et al. (1997) Type 2 helper T cell-type 

cytokines and the development of “infectious” tolerance in rat cardiac allograft 

recipients. J. Immunol. 158, 1572–1581. 

91. Hara, M., Kingsley, C. I., Niimi, M., et al. (2001) IL-10 is required for regulatory 

T cells to mediate tolerance to alloantigens in vivo. J. Immunol. 166, 3789–3796. 

92. Hall, B. M., Fava, L., Chen, J., et al. (1998) Anti-CD4 monoclonal antibodyinduced 

tolerance to MHC-incompatible cardiac allografts maintained by CD4+ 

suppressor T cells that are not dependent upon IL-4. J. Immunol. 161, 5147– 

5156. 

93. Powrie, F., Carlino, J., Leach, M. W., Mauze, S., and Coffman, R. L. (1996) A 

critical role for transforming growth factor-beta but not interleukin 4 in the suppression 

of T helper type 1-mediated colitis by CD45RB(low) CD4+ T cells. J. 

Exp. Med. 183, 2669–2674. 

94. Piccirillo, C. A., Letterio, J. J., Thornton, A. M., et al. (2002) CD4(+)CD25(+) 

regulatory T cells can mediate suppressor function in the absence of transforming 

growth factor beta1 production and responsiveness. J. Exp. Med. 196, 237– 

246. 

95. Belghith, M., Bluestone, J. A., Barriot, S., Megret, J., Bach, J. F., and Chatenoud, 

L. (2003) TGF-beta-dependent mechanisms mediate restoration of self-tolerance 

induced by antibodies to CD3 in overt autoimmune diabetes. Nat. Med. 9, 1202– 

1208.


96. Bommireddy, R. and Doetschman, T. (2004) TGF-beta, T-cell tolerance and anti- 

CD3 therapy. Trends Mol. Med. 10, 3–9. 

97. Sanchez-Fueyo, A., Weber, M., Domenig, C., Strom, T. B., and Zheng, X. X. 

(2002) Tracking the immunoregulatory mechanisms active during allograft tolerance. 

J. Immunol. 168, 2274–2281. 

98. Dieckmann, D., Bruett, C. H., Ploettner, H., Lutz, M. B., and Schuler, G. (2002) 

Human CD4(+)CD25(+) regulatory, contact-dependent T cells induce interleukin 

10-producing, contact-independent type 1-like regulatory T cells. J. Exp. Med. 

196, 247–253. 

99. Jonuleit, H., Schmitt, E., Kakirman, H., Stassen, M., Knop, J., and Enk, A. H. 

(2002) Infectious tolerance: human CD25(+) regulatory T cells convey suppressor 

activity to conventional CD4(+) T helper cells. J. Exp. Med. 196, 255–260. 

100. Graca, L., Cobbold, S. P., and Waldmann, H. (2002) Identification of regulatory 

T cells in tolerated allografts. J. Exp. Med. 195, 1641–1646. 

101. Pratt, J. R., Basheer, S. A., and Sacks, S. H. (2002) Local synthesis of complement 

component C3 regulates acute renal transplant rejection. Nat. Med. 8, 582–587. 

102. Hancock, W. W., Wang, L., Ye, Q., Han, R., and Lee, I. (2003) Chemokines and 

their receptors as markers of allograft rejection and targets for immunosuppression. 

Curr. Opin. Immunol. 15, 479–486. 

103. Soares, M. P., Brouard, S., Smith, R. N., and Bach, F. H. (2001) Heme oxygenase-1, 

a protective gene that prevents the rejection of transplanted organs. 

Immunol. Rev. 184, 275–285. 

104. Coito, A. J. and Kupiec-Weglinski, J. W. (2000) Extracellular matrix proteins in 

organ transplantation. Transplantation 69, 2465–2473. 

105. Nakagawa, R., Naka, T., Tsutsui, H., et al. (2002) SOCS-1 participates in negative 

regulation of LPS responses. Immunity 17, 677–687. 

106. Munn, D. H., Sharma, M. D., Lee, J. R., et al. (2002) Potential regulatory function 

of human dendritic cells expressing indoleamine 2,3-dioxygenase. Science 

297, 1867–1870. 

107. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., and Munn, D. H. (2002) 

Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. J. Immunol. 

168, 3771–3776. 

108. Kinjyo, I., Hanada, T., Inagaki-Ohara, K., et al. (2002) SOCS1/JAB is a negative 

regulator of LPS-induced macrophage activation. Immunity 17, 583–591. 

109. Streilein, J. W. (2003) Ocular immune privilege: therapeutic opportunities from 

an experiment of nature. Nat. Rev. Immunol. 3, 879–889. 

110. Stein-Streilein, J. and Streilein, J. W. (2002) Anterior chamber associated immune 

deviation (ACAID): regulation, biological relevance, and implications for 

therapy. Int. Rev. Immunol. 21, 123–152. 

111. Streilein, J. W., Masli, S., Takeuchi, M., and Kezuka, T. (2002) The eye’s view 

of antigen presentation. Hum. Immunol. 63, 435–443. 

112. Maloy, K. J., Salaun, L., Cahill, R., Dougan, G., Saunders, N. J., and Powrie, F. 

(2003) CD4+CD25+ T(R) cells suppress innate immune pathology through 

cytokine-dependent mechanisms. J. Exp. Med. 197, 111–119.


113. Pasare, C. and Medzhitov, R. (2003) Toll pathway-dependent blockade of 

CD4+CD25+ T cell-mediated suppression by dendritic cells. Science 299, 1033– 

1036. 

114. Caramalho, I., Lopes-Carvalho, T., Ostler, D., Zelenay, S., Haury, M., and 

Demengeot, J. (2003) Regulatory T cells selectively express toll-like receptors 

and are activated by lipopolysaccharide. J. Exp. Med. 197, 403–411. 

115. Le Moine, A., Surquin, M., Demoor, F. X., et al. (1999) IL-5 mediates eosinophilic 

rejection of MHC class II-disparate skin allografts in mice. J. Immunol. 

163, 3778–3784. 

116. Le Moine, A., Flamand, V., Demoor, F. X., et al. (1999) Critical roles for IL-4, 

IL-5, and eosinophils in chronic skin allograft rejection. J. Clin. Invest. 103, 

1659–1667. 

117. Saiura, A., Mataki, C., Murakami, T., et al. (2001) A comparison of gene expression 

in murine cardiac allografts and isografts by means DNA microarray analysis. 


118. Christopher, K., Mueller, T. F., Ma, C., Liang, Y., and Perkins, D. L. (2002) 

Analysis of the innate and adaptive phases of allograft rejection by cluster analysis 

of transcriptional profiles. J. Immunol. 169, 522–530. 

119. Fairchild, P. J. and Waldmann, H. (2000) Dendritic cells and prospects for transplantation 

tolerance. Curr. Opin. Immunol. 12, 528–535. 

120. Jonuleit, H., Schmitt, E., Steinbrink, K., and Enk, A. H. (2001) Dendritic cells as 

a tool to induce anergic and regulatory T cells. Trends Immunol. 22, 394–400. 

121. Wise, M. P., Bemelman, F., Cobbold, S. P., and Waldmann, H. (1998) Linked 

suppression of skin graft rejection can operate through indirect recognition. J. 

Immunol. 161, 5813–5816. 

122. Fairchild, P. J., Brook, F. A., Gardner, R. L., et al. (2000) Directed differentiation 

of dendritic cells from mouse embryonic stem cells. Curr. Biol. 10, 1515– 

1518. 

123. Fairchild, P. J., Nolan, K. F., Cartland, S., Graca, L., and Waldmann, H. (2003) 

Stable lines of genetically modified dendritic cells from mouse embryonic stem 

cells. Transplantation 76, 606–608. 

124. Waldmann, H., Graca, L., Cobbold, S., Adams, E., Tone, M., and Tone, Y. (2004) 

Regulatory T cells and organ transplantation. Semin. Immunol. 16, 119–126. 

125. Arnold, B. (2003) Parenchymal cells in immune and tolerance induction. 

Immunol. Lett. 89, 225–228. 

126. Lombardi, G., Sidhu, S., Batchelor, R., and Lechler, R. (1994) Anergic T cells as 

suppressor cells in vitro. Science 264, 1587–1589. 

127. Chai, J. G., Bartok, I., Chandler, P., et al. (1999) Anergic T cells act as suppressor 

cells in vitro and in vivo. Eur. J. Immunol. 29, 686–692.

Immune Monitoring in Transplantation 269 

12 

In Vitro Assays for Immune Monitoring 

in Transplantation 

Maria P. Hernandez-Fuentes and Alan Salama 

Summary 

Because immune responses to transplant allografts are the main drivers of rejection, the 

ability to accurately quantitate antidonor immunity is an important goal in clinical transplantation. 

These allow for the prediction of presensitization to the transplanted tissue and 

the identification of rejection without needing more invasive tests. 

In this chapter, we will review three methods currently used in transplantation research. 

Limiting dilution assays are a traditional tool. The evolution of these assays has brought 

about the ELISpot. Developments in flow cytometry are also contributing to the understanding 

of the composition of the cells involved in these immune responses. 

We can therefore obtain a deeper understanding of the process of rejection and tolerance 

and their evolution with time. This chapter reviews in vitro assays in the context of 

transplantation, but the scientific applications of sensitive, accurate, and specific immunemonitoring 

reach well beyond this field of research. 

Key Words: Immune monitoring; mixed lymphocyte reaction; limiting dilution assays 

(LDAs); ELISpot; carboxyfluorescein succinimidyl ester (CFSE); lymphocyte division; 

cytokine secretion assay; regulatory T cells; immunological tolerance; T-cell responses; 

allogeneic responses; transplant monitoring; alloreactivity; direct and indirect pathways of 

allorecognition. 


The development of assays that would allow monitoring of the current state of 

an alloimmune response is of interest for several reasons. They would have the 

potential to identify rejection without resorting to invasive tests. More importantly, 

a reliable index of the immune status could allow immunosuppressive 

drug prescribing to be individualized. In some cases the identification of immu- 



269

270 Hernandez-Fuentes and Salama 

nological tolerance could allow the partial or complete cessation of immunosuppressants, 

a highly desirable goal given the morbidity and mortality associated 

with long-term administration of such therapy. It is also clear that such assays 

will bring with them a more complete understanding of the mechanisms underlying 

the generation of tolerance and rejection, which will open the door to new 

and better targeted therapeutic interventions. 

1.1. Managing the Transplant Recipient 

Monitoring the allogeneic effector response may help us understand the 

mechanisms that result in graft rejection. Assays that are able to identify key 

steps in the process might ultimately be used as predictors of potentially detrimental 

events, prior to their clinical manifestation. This would allow intervention 

at a much earlier stage in the rejection process. Increased antidonor 

responses have been measured in association with rejection in solid organ transplantation 

(1–3), but these results have not been consistent (4,5). No large prospective 

studies have been conducted that evaluate clinically useful antidonor 

responses, probably the result of the lack of definition of an assay that can be 

easily conducted in a large number of patients, requires acceptably small volumes 

of blood, and can be repeated on several occasions. 

The efficacy of immunosuppression over the past two decades have led to a 

considerable improvement in the short-term survival of organ transplants. Notwithstanding 

this, almost all transplanted patients have to endure immunosuppression 

for the rest of their lives. Long-term immunosuppressive drug treatment 

is associated with significant morbidity and mortality, mainly due to cardiovascular 

disease, opportunistic infections, and an increased incidence of malignancy. 

The ultimate goal in the management of transplanted patients is the induction of 

donor-specific tolerance—antigen-specific immunological unresponsiveness 

that is sustained in the absence of chronic immunosuppression. Immunological 

monitoring could contribute by quantitating pro-inflammatory and anti-inflammatory 

components of the antidonor response. If reliable assays were available, 

it would be possible to monitor the evolution of antidonor responses in individual 

patients and to determine the effectiveness of potentially tolerogenic 

therapeutic strategies. As new drugs and biological agents are introduced, such 

assays are vitally important in determining whether they are tolerance promoting 

or whether they impede the development of immune tolerance. In patients 

who have already received a transplant, the assays would be used to identify 

those in whom tolerance had developed and, therefore, whose immunosuppression 

could be weaned, avoiding much of its detrimental effects. 

We can define immunological monitoring as the ex vivo measurement of proinflammatory 

and anti-inflammatory responses with clinical utility. Examples of 

such assays that conform to this definition will be the subject of this review.


Although monitoring immune responses in transplant recipients could be 

through analysis of genes or proteins in the urine, blood, or within the graft, 

traditional methods were limited to the study of lymphocytes. It can be argued 

that the responses of cells from the peripheral blood do not necessarily mirror 

what happens in the tissue, as this is regulated by infiltrating lymphocytes. To 

address this question, Orosz et al. used an elegant model of an allograft made 

of polyurethane sponges bearing allogeneic splenocytes (6). Donor-reactive 

cytotoxic T cells represented up to 0.2% of the cells recovered from these allografts, 

which are similar to the frequencies found in limiting dilution assays 

(LDAs) on peripheral blood using completely mismatched human samples 

(7). While acknowledging that peripheral blood is not the ideal source of information 

reflecting the situation in the graft, these data argue that there are reasons 

to believe it is good enough. Most of the assays described relate to 

studying T-lymphocyte responses, as these are the orchestrators of the allogeneic 

immune response. It is important to note that, almost certainly, no single assay 

will provide all the answers; rather, each will analyze the immune response in a 

subtly different fashion. Combining the results of several assays should allow 

the determination of the fingerprint of the immune response at any given time 

in a given individual. 

1.2. Animal Transplantation 

Although individual kinetic assessment of alloreactivity by different methods 

is feasible in human peripheral blood, in murine systems peripheral blood is a 

poor source of cells, and, thus, individual kinetic assessment of alloreactivity in 

the same individual can be challenging. The advantage is that transplantation 

groups can be bigger and the variation from one individual to the next in littermates 

is so small that the kinetic studies can be performed on different individuals. 

Moreover, graft-infiltrating lymphocytes are available for study, arguably 

providing the most interesting source of information. Most of the assays 

described here can be applied in rodents using the appropriate reagents. However, 

many reports using animal models of transplantation assess alloreactivity 

simply by graft survival, and accurate quantitation of responses to donor antigens 

is surprisingly scarce in the literature. Where in vitro assays have been 

informative in rodent systems, we have added them in their section. 

2. Biological Basis for Immune Assays to Monitor Responses to Grafts 

To understand the basis of assays to monitor antidonor T-cell immunity, several 

concepts have to be considered. First, the molecules responsible for the 

immune response to allogeneic tissues are encoded by genes found in the major 

histocompatibility complex (MHC) locus on the short arm of chromosome 6 in 

humans (chromosome 17 in mice). The protein products of MHC genes have


Fig. 1. Direct and indirect pathways of allorecognition. In direct allorecognition, T 

cells recognize and are activated by intact allogeneic MHC molecules on the donor cells. 

CD8 + T cells are activated by recognition of class I molecules of the MHC complex, 

whereas CD4 + cells are activated by the recognition of class II molecules. In the indirect 

pathway allogeneic MHC molecules are shed from the graft, taken up, processed by the 

recipient APCs, and presented as allo-peptides on the surface of recipient’s MHC molecules. 

MHC, major histocompatibility complex; APC, antigen-presenting cell. 

been divided into two major groups: class I and class II molecules. The class I 

molecules are human leukocyte antigens (HLAs)-A, -B, and -C in humans and 

H2-K, -D, and -L in mice, and they are expressed by all nucleated cells in an 

organism. The class II molecules are HLA-DR, -DP, and -DQ in humans and 

H2-A and -E in mice. These are constitutively expressed only by bone-marrowderived 

antigen-presenting, such as macrophages, dendritic cells, and B lymphocytes, 

and by thymic epithelial cells (8). 

Second, there are two pathways of T-cell alloreactivity (Fig. 1). The direct 

pathway requires the recognition of intact donor MHC alloantigens on the sur-


face of donor cells by recipient T cells. The cells stimulating the direct pathway 

most efficiently are passenger dendritic cells from the donor that migrate to 

draining lymphoid tissues shortly after transplantation. Thereafter, the direct 

pathway is stimulated mainly by allogeneic MHC molecules on the graft cells 

themselves. The second pathway of MHC allorecognition, the indirect pathway, 

involves the internalization, processing, and presentation of alloantigens 

as peptides bound to recipient MHC molecules. There is sufficient evidence 

now to support that indirect allorecognition is an important driver of transplant 

rejection (7,9–12) and that the induction of tolerance in this pathway is a requirement 

for long-term transplant survival (13,14). 

Third, regulatory T cells may be vital in holding the antidonor immune response 

in check. The evidence for such cells is long-standing and comes from adoptive 

transfer studies in which tolerance can be transferred to a naïve recipient 

by CD4 + T cells. Although the mechanisms of this regulation remain incompletely 

understood, some progress has been made in defining the phenotype of 

this regulatory population. A group of these cells have the same phenotype, 

CD4 + CD25 + , as the spontaneously arising population that plays a vital role in 

the prevention of autoimmune disease. Depletion of these CD4 + CD25 + prevents 

the transfer of tolerance by CD4 + T cells from a transplant-bearing animal 

(15). Over the past decade, an ever-increasing body of data in both human 

and animal models has established the role of these and other naturally occurring 

regulatory cells (e.g., natural killer cells) in transplantation. Several authors 

have recently reviewed this phenomenon (16–18). The picture of the mechanisms 

underlying the regulatory function of these cells is far from completely 

defined, but it does appear that this population of T cells plays an important 

role in the maintenance of experimental (17) and possibly clinical (19) transplantation 

tolerance. 

The assays here described attempt to quantify the frequencies of lymphocytes 

recognizing donor antigen. Frequently, only the direct pathway has been considered 

when measuring these responses. The primary in vitro response to the direct 

recognition of allogeneic molecules occurs in the mixed lymphocyte reaction 

(MLR) where mixtures of allogeneic lymphocytes are placed in culture. This 

reaction was first described in the 1960s and has been extensively used to study 

antidonor responses. However, in its conventional form, proliferative MLR bulk 

cultures have very little predictive value in the context of transplantation (20). 

For this reason, alternative assays have been developed to obtain information 

regarding immunological responses that are of greater clinical utility. 

To measure indirect pathway responses, some modifications in the culture 

conditions have to be set in place for almost all the assays. This requires the 

presentation of alloantigen as protein preparations rather than whole cells. Several 

preparations have been used, namely freeze–thawed donor cells (21), mem-


brane protein preparations of donor cells (7), or peptides derived from the 

hypervariable regions of MHC molecules (22). The special challenge that measuring 

indirect pathway responses poses is caused by the low frequency of T 

cells with this specificity. In many instances these responses are near the limit of 

detection of the assays described. Therefore, it is essential that steps are taken to 

increase the sensitivity of the assays, as this will help in the ability to accurately 

measure such responses and any subtle variations that may occur. It is important 

to note that in allogeneic mixed lymphocyte reactions, where the donor and the 

recipient share HLA molecules (e.g., siblings), the assumption is that both direct 

and indirect responses are being detected simultaneously in these cultures. To be 

able to measure one or the other, purified populations are required in the culture. 

3. Limiting Dilution Assays 

LDAs allow the estimation of frequencies of antigen-specific cells participating 

in an immune response (23,24). They have become a standard experimental 

tool for estimating frequencies of cells with defined function within a 

population of cells (Fig. 2). 

Traditionally, measuring frequencies of proliferating or cytokine-secreting 

cells has been considered to measure helper T-lymphocyte precursor frequencies 

(HTLps), whereas when measuring cytotoxicity we describe them as cytotoxic 

T lymphocyte precursor frequencies (CTLps). LDA assays have been 

shown to be specific and reproducible as a measurement of alloreactivity (25). 

A number of refinements have been described to increase the specificity and 

sensitivity in the measurement of interleukin (IL)-2-secreting HTLps (26–28), 

as well as for CTLp frequencies (29). Different cytokines derived from both 

Th1 and Th2 polarized cells can be detected in these cultures; the most frequently 

found are interferon (IFN)-γ, IL-5, IL-4, or even IL-10 (30–32). The 

clinical utility of antidonor frequency measurement has been extensively demonstrated 

for IL-2 (33,34) and CTLp in bone marrow transplant recipients (35– 

39). However, in solid organ transplants the picture is less clear, and conflicting 

data have been reported regarding the ability of CTLp measurements to predict 

rejection (40–42). Further development in the detection of cytokines may help 

in dissecting mechanisms of tolerance and rejection. 

Recent data have emphasized the critical role of regulatory cells and the 

complex interactions between them and effector cells in the generation of an 

immune response. It has therefore become very important to include the study 

of such regulatory cells. The absence of a clear phenotypic marker for these 

cells further complicates the issue. LDAs have a unique advantage in that they 

allow the study of complex responses at a population level. When the responder 

population contains cells (such as regulatory cells) that affect the response of 

other cells, LDAs can reveal their presence. These complex responses usually


Fig. 2. Limiting dilution analysis: general protocol for use in allotransplantation 

assays. At least 24 replicates of responder cells (peripheral blood mononuclear cells, 

CD4+, CD8+, etc.) at no fewer than seven doubling dilutions are aliquoted in U-bottom 

sterile plates. Culture medium alone is added to the 24 control wells (C). Stimulation can 

be in the form of allogeneic cells (direct pathway) or antigen-presenting cells (APCs) 

pulsed with different preparations of allogeneic antigen (peptides, cell lysates, sonicated 

cells, etc.—this is the indirect pathway). Stimulator cells are irradiated (30 Gy) prior to 

addition to all the wells. After optimal culture conditions, supernatants can be collected 

for the detection of cytokines (determined by ELISA or a bioassay), proliferation, and 

measured by adding thymidine-H 3 12–18 h before the end of culture. A special situation 

arises if cytotoxic precursors are to be measured. Stimulator and responders are cultured 

for 9 d, and wells are supplemented with interleukin-2 after 3 and 6 d. On day 9 51 chromium-labeled 

stimulator cells are added to each well followed by 4-h incubation; γradiation 

is then measured in the supernatant. For all of the measurable outcomes, wells 

are scored positive when the measure of choice is higher than the mean + 3 standard 

deviations of the control wells, in which only stimulators are added. As the concentration 

of the responder cells increases, the proportion of negative wells will tend to be less; 

the relation between the number of negative wells and the mean number of precursors 

can be plotted and a frequency obtained (24, 78). The ability of an limiting dilution 

assay assay to predict the frequency of precursors depends on the number of replicates 

and the number of responder cells added per dilution (79). An important issue concerns 

the statistical method used to estimate the unknown frequency. A number of methods are 

available to estimate the effector frequency from the experimental data: least-squares, 

weighted means, minimum c-square, and maximum likelihood. Extensive evaluation of 

the methods using artificial data concluded that the last three were useful (80). We have 

favored a maximum likelihood-based method that introduces bias reduction (81). 

manifest themselves as deviations from the single-hit kinetics and graphically 

give rise to the zigzag curves when cell dose is plotted against fraction of negative 

cultures (43) (see Fig. 3 for further explanation of this concept).


Fig. 3. Single-hit and multiple kinetics in limiting dilution assays (LDAs). Singleand 

multiple-hit LDA curves are represented. An experiment with only one population 

of cells responding results in a straight line when cell number and the fraction of negative 

wells are plotted (single-hit kinetics, dark grey thin line). In contrast, an experiment 

in which the population of responding cells is mixed results in a classic “humped” 

curve (thick black line) (adapted from ref. 43). In this model, several assumptions are 

made when deriving a curve. The most important is that one of the populations acts 

only as responders, while another can act as a regulatory population at low cell number 

and as an effector at high cell numbers. This model has been found to best fit the 

experimental data (45). 

In isolation the responder population would be represented by LPC1 (light grey 

dotted line), which follows single-hit kinetics. At low cell numbers there is a sharp 

decrease in the number of responding wells. In contrast, the regulatory population is 

represented by LPC2 (light grey broken line), where at low cell numbers, cells remain 

unresponsive but as the number increases those cells begin to proliferate, thus producing 

a curve. If the populations are mixed (thick black line), at a low frequency the 

responders predominate, but as the number of cells per well increases, the regulatory 

cells can exert their suppressive effect and inhibit the responders proliferating, resulting 

in more wells scoring negative, hence the “hump.” The wells will not score positive 

again until there are both enough regulators to start proliferating and an excess of 

responders to prevent suppression. Once this happens, the “hump” is overcome and 

the line tends towards a straight line. The actual frequency of the two populations can 

be derived from the gradients of LPC1 and LPC2. 

Indeed, in LDA experiments, if one of these regulatory populations, namely 

CD4 + CD25 + cells, is added back to a culture with the effector CD4 + CD25 - fraction, 

there is a dose-dependent effect between the percentage of CD4 + CD25 + 

cells and the deviation of the data from single-hit kinetics (44). Dozmorov et 

al. have developed mathematical models for the accurate estimation of the frequencies 

of two separate interacting cells types in such mixed populations (45).


More recently, a French group has proposed a novel theoretical approach for 

quantifying the frequency of suppressor cells in a responding population. This 

method allows the simultaneous estimation of the frequencies of both proliferating 

and suppressor cells and is based on LDA data modeling (46). 

Several aspects support LDA as a valuable tool to monitor donor-specific 

responses, particularly if aided by computerized calculations. No other assay 

to date has surpassed their specificity and relationship to clinical outcome. It is 

the only assay so far that allows measurement of regulatory cell frequencies. 

Furthermore, the range of readouts that can be measured will ensure its ongoing 

usefulness in the near future. Notwithstanding, they are labor-intensive and 

require complex data analysis. 

4. ELISpot 

The ELISpot assay allows the detection of soluble products from single 

cells after stimulation with mitogens or antigens (47,48). The secreted product 

is detected by specific monoclonal antibodies, and the cells producing it 

are revealed by the generation of discrete spots. The number of spots reflects 

the number of product-secreting cells (49) (Fig. 4). Automated video image 

analysis has helped develop the potential use of this assay (50) by reducing its 

labor-intensiveness. The main use of this assay at the moment is to study the 

production of signature Th1 and Th2 cytokines (IFN-γ and IL-4) after stimulation 

in samples from targeted patients. Presently it is widely used in monitoring 

antigen-specific responses in the context of vaccine development for 

infectious diseases (51), cancer (52), and autoimmunity (53,54). In the context 

of transplantation, it has been used to identify the presence of donorspecific 

T cells in patients prior to surgery (55) and to assess the indirect 

pathway in patients with evidence of chronic rejection (22). 

ELISpot frequencies have been found to correlate with LDA precursor frequencies 

of varied effector functions (56,57). ELISpot has also been used to 

assess direct and indirect allogeneic responses in murine models (10) and in 

renal transplant recipients (19). Recently a modification of the ELISpot, 

namely the Lysispot, has been published to assess antigen-specific perforindependent 

cytotoxicity (58). ELISpot results, unlike those of LDA, are not 

dependent on clonal expansion. The assay is less labor-intensive, and results 

can be analyzed after 48 h (vs 7 d for LDA) in conjunction with an image 

analyzer. This assay has great potential for clinical application. However, disadvantages 

include the need to invest in an image analyzer and the chance of 

error due to subjectivity in the interpretation of results, because a threshold for 

the size, intensity, and gradient of the spots is user-defined. The near future 

may bring about a comparison of results using different ELISpot readers. Standardization 

across laboratories and readers of parameters that define a positive


Fig. 4. ELISpot general protocol. Special plates should be used with high-proteinbinding 

membranes, such as Immobilon P (Millipore, Bedford, MA). Paired antibodies 

developed for ELISpot or ELISA can be used. (A) Capture antibody (4–15 mg/mL) 

diluted in sterile buffer (phosphate-buffered saline [PBS] or NaHCO 3, pH = 8.0–9.6) is 

added to the wells. To allow binding, incubate antibody for 4–6 h at room temperature or 

overnight at 4°C. Under sterile conditions wash the plate with PBS, then add cells and 

stimuli (see below for culture conditions). (B) Cultures are incubated for 24–48 h while 

the cytokine is produced by the cells. Cells are then removed from the plate and washed 

extensively with PBS. The cytokine will remain bound to the antibody. (C) A detection 

biotinylated antibody is then added (1 mg/mL) diluted in PBS containing 0.5–1% protein 

(albumin or bovine serum). Another extensive washing step is followed by the addition 

of a conjugate of an enzyme (horseradish peroxidase or alkaline phosphatase) and 

streptavidin. In the final step, the substrate is added (BCIP/NBT or AEC), which precipitates 

where the secondary antibody was bound, forming spots that correspond to cells 

producing the cytokine. Spots can be counted manually with magnifying microscope or 

using an automatic counter in conjuctions with video image analysis. Culture conditions: 

the concept of measurement is different from standard tissue culture plates as the 

outcome is the number of cytokine-producing cells or frequency of responders. The 

researcher must ensure that the number and/or concentration of stimulators is well in 

excess for the number of cells added in each well. Different dilutions of responder cells 

should be used to accurately confirm the frequency of spot-forming cells. 

spot will be required for reproducibility as well. The increasing use of this 

assay to monitor immune responses in different clinical situations is generating 

a wealth of literature, and it will be interesting to find out if this assay 

meets the expectations it is generating.


Fig. 5. Flow cytometry analysis of cell division: carboxyfluorescein succinimidyl 

sster (CFSE) labeling. Lymphocytes are labeled with a 1- to 5-mM solution of CFSE 

(green fluorochrome) in PBS and then washed prior to setting up the culture. Following 

lymphocyte activation and proliferation, each cell division results in a halving of 

the fluorescence intensity. Green fluorescence intensity of the population can be measured 

using a flow cytometer. A histogram plot produces the classical image of groups 

of cells that have divided a certain number of times. In T lymphocytes, up to eight cell 

divisions can accurately be distinguished. Accurate quantitation of dividing cells can 

be achieved by the use of internal standards such as microspheres that allow enumeration 

of absolute cell numbers as opposed to percentages (82). This way we can calculate 

the number of precursors that have undergone division. By relating precursors to 

the number of cells seeded, a frequency of proliferating precursors can be obtained. 

5. Flow Cytometry and Immunological Monitoring 

A recent development for studying cell division following antigen encounter 

involves the use of fluorescent dyes, which also allows tracking of cellular migration. 

The most widely used dye, carboxyfluorescein succinimidyl ester (CFSE), 

is an intracellular fluorescent label that divides equally between daughter cells 

following cellular division (59,60) (Fig. 5). Recently, a method was developed


using this dye to quantify alloreactive T-cell responses (61). A combination of 

LDA and CFSE labeling has also been described to measure alloactivation in 

CD8 + cells (62). Using this enumeration method, antigen-specific frequencies 

have been measured with high sensitivity and reproducibility (Hernandez- 

Fuentes, manuscript in preparation). The advantage of this method, as with other 

flow-cytometric methods, is that different phenotypically defined subsets of cells 

can be studied simultaneously (63). In combination with intracellular staining, 

the quantity of secreted cytokine or other cytoplasmic proteins can be measured. 

It also allows for the study of individual cell populations within mixed cultures, 

such as dendritic cells and T lymphocytes or regulatory and effector cells. 

The use of CFSE labeling to assess allogeneic responses in vivo has been 

widely used in murine systems, chiefly bcause the CFSE-labeled cells remain 

identifiable for a prolonged period of time. The limit of detection of the dividing 

cells is the number of divisions they have undergone, which dilutes out the 

fluorescent dye. Through the adoptive transfer of CFSE-labeled cells, the number 

of responding cells can be calculated (61) and the mechanisms of rejection 

and tolerance in vivo studied (64). It has proven invaluable in understanding 

issues related to cell migration, such as localization of sites of lymphocyte 

activation and antigen presentation. Moreover, this technique can also be used 

to determine the kinetics of immune responses, track proliferation in minor 

subsets of cells and follow the acquisition of differentiation markers or internal 

proteins linked to cell division (65). 

We have compared different methods of calculating CD4 + antigen-specific 

T-cell frequencies in healthy human controls and have found them to be reproducible 

over time. In addition, using a mouse model specifically designed to 

compare the accuracy of these alternative approaches, ELISpot was found to 

be marginally superior to LDA or CFSE labeling and flow cytometry in accurately 

calculating alloreactive T-cell frequencies (Hernandez-Fuentes, manuscript 

in preparation). Given the speed and relative ease of performing ELISpot 

assays, this clearly makes it an attractive option for translation into the clinic. 

5.1. Flow-Cytometric Detection of Cytokines 

Two flow cytometry methods for detection and measurement of lymphocyte 

cytokine production have been used in relation to immunological monitoring. 

The first is the cytokine secretion assay, in which an artificial affinity matrix on 

the cell surface specific for the secreted product of interest is created (Fig. 6). 

This method has been shown to correlate with the number of tetramer-binding 

CD8 + T cells, reacting to a melanoma-associated peptide, Melan-A (66). However, 

measuring responses to influenza peptides in healthy volunteers, this 

method did not correlate with results obtained with either ELISpot or intracellular 

cytokine staining (67). This method was initially designed to isolate func-


Fig. 6. Cytokine secretion assay (Miltenyi ® ). Step 1: T cells are stimulated for 16– 

20 h in normal culture conditions with the antigen of choice. Step 2: A cell affinity 

matrix is generated by attaching a bispecific antibody to the cell surface. This means 

that an antibody that binds CD45 on lymphocytes will cover the surface of the cell and 

the second specificity will detect a cytokine, such as IFN-γ or IL-4. By binding CD45 

on the surface, the second specificity of the antibody localizes secreted IFN-γ to the 

surface of secreting cells. Step 3: Once the matrix is added, the cells are allowed to 

secrete the cytokine for a defined time period, and the secreted product is then “captured” 

in the matrix. The incubation time is short, usually 45 min, with cell mixing 

required. This ensures that cells are not aggregating and cytokines secreted originate 

only from the stimulated cell. Step 4: The cells are subsequently labeled with specific 

fluorescent antibody. This allows them to be identified using a flow cytometer. Cells 

can also be isolated using magnetic bead separation and a magnetic column (68). 

tional cytokine-producing T cells specific for a target antigen, and in this respect 

it has been successful, even when the frequency of antigen-specific cells was low 

(68). For measuring frequencies of antigen-specific T cells, our experience and 

that of Asemissen et al. (67) is that this assay shows some nonspecific binding of 

the secondary anti-IFN-γ antibody, hence, background staining is often a problem 

and the noise-to-signal ratio leads to a lack of sensitivity. 

An alternative flow-cytometry-based cytokine-detection method involves 

intracellular cytokine staining (69). Specific activation procedures are required 

to allow the detection of cytokines, notably with phorbol esters (such as phorbol 

myristate acetate) and ionomycin; moreover, it generally involves the addition 

of inhibitors of intracellular transport (such as brefeldin or monensin) (70). 

This method allows the characterization of large numbers of cells. With multiparameter 

staining it can demonstrate exclusive or mutual co-expression of different 

cytokines within individual cells. It therefore allows for the categorization 

of T-cell subsets, such as Th1 or Th2, rather than relying only on cell-surface 

markers, which can also be achieved with ELISpot. Frequencies calculated by


this method have been shown to correlate with the number of tetramer-binding 

cells in patients infected with the HIV (57), although in patients with metastatic 

melanoma, such a correlation was not found (71). Moreover, it appears to correlate 

with ELISpot frequencies when using influenza-specific T cells (67) and to 

exceed the frequency obtained by LDA using cytotoxicity as a readout for 

Epstein-Barr virus and allogeneic responses (72). 

6. Past Experience and the Future of Immune Monitoring 

Traditionally, donor-specific immunity or tolerance has been monitored in 

vitro using LDAs with different readouts (proliferation, cytokine production, 

or cytotoxicity). The largest clinically useful experience in immune monitoring 

has been carried out in the context of hematopoietic cell transplantation 

from unrelated donors with a view to predicting graft-vs-host disease as well 

as for donor selection. There is vast experience in the usefulness of CTLp calculated 

by LDA for these purposes (25,35–37,39). Furthermore, IL-2 HTLp 

frequencies have been shown to correlate with graft outcome in bone marrow 

transplant recipients (33,36,39,73,74). Functional assays will have a lasting 

role in bone marrow transplantation even in the era of high-resolution typing in 

that these assays can define permissible mismatches and identify less immunogenic 

donors in the absence of a perfectly matched donor (a comparison can be 

found in Table 1). 

The experience in solid organ transplantation is less extensive, although a 

renewed effort is underway to dissect mechanisms of tolerance and rejection 

(reviewed in ref. 75). Generally, monitoring has demonstrated that the 

hyporesponsiveness of direct-pathway donor-specific responses ensues shortly 

after transplantation (5,41,76), whereas raised indirect-pathway antidonor reactivity 

appears to correlate with the presence of chronic transplant rejection. 

The implications are that abolition of only the direct pathway will not achieve 

allograft tolerance, while strategies that promote tolerance in the indirect pathway 

should improve allograft survival, as has been demonstrated in animal 

models (77). 

As we develop a deeper understanding of how our immune system works and 

how to specifically stimulate effector functions within subsets of cells, immunological 

monitoring is gaining increasing importance. Innovative immunotherapies 

are being tested in targeted groups of patients, in particular, in the 

study of immune responses to new vaccines or T-cell therapies in infectious 

diseases and the boosting of immune responses in response to malignant tumors 

(e.g., melanoma). 

The goal yet to be achieved is the identification and perhaps even quantification 

of tolerance. The crucial point here will be to differentiate in vitro tolerance 

from a lack of response or assay insensitivity. So far a single or a small

283 

Table 1 

Current and Potential Future Assays for Clinical Alloimmune Monitoring 

Measured in blood/serum Using 

Direct and indirect T-cell alloreactivity • Proliferation (LDA)* 

• Cytokine analysis (LDA, ELISPOT, CSA)* 

• Cell division (CFSE)* 

• Trans-vivo delayed type hypersensitivity 

Expression profiling using lymphocyte activation markers • Real-time PCR* 

• Microarrays 

Humoral immune responses • Cytotoxic or flow cytometric antibody detection * 

Soluble lymphocyte activation markers • ELISA for soluble factors (e.g., sCD30)* 

Measured in transplant Using 

Graft damage, inflammation (biopsy required) • Histology * 

• Immunohistochemistry (e.g., C4d staining)* 

Expression profiling • PCR 

(in graft or draining from graft; e.g., urine) • Microarrays defining immune gene polymorphisms, 

(biopsy may be required) • Proteomics “tolerance genes or proteins” 

Note: Assays marked with an * indicate the currently most practical for clinical use. 

Immune Monitoring in Transplantation 283


group of assays of definitive clinical usefulness has not been identified or standardized. 

Collaborative research initiatives are being set up in Europe and the 

United States in order to find the “fingerprint” of tolerance. Their results will 

provide very useful information both for the design of tolerance-promoting 

protocols and for guiding decisions about immunosuppression withdrawal. 

There is now reason to be optimistic about the possibility of quantitating the 

effectiveness of immune interventions of clinical utility. 

References 

1. Reader, J. A., Burke, M. M., Counihan, P., et al. (1990) Noninvasive monitoring 

of human cardiac allograft rejection. Transplantation 50, 29–33. 

2. Fisher, P. E., Suciu-Foca, N., Ho, E., Michler, R. E., Rose, E. A., and Mancini, D. 

(1995) Additive value of immunologic monitoring to histologic grading of heart 

allograft biopsy specimens: implications for therapy. J. Heart Lung Transplant. 

14, 1156–1161. 

3. Beik, A. I., Higgins, R. M., Lam, F. T., and Morris, A. G. (1997) Clinical significance 

of selective decline of donor-reactive IL-2-producing T lymphocytes after 

renal transplantation. Transplant. Immunol. 5, 89–96. 

4. Weston, L. E., Sullivan, J. S., Keogh, A. M., and Geczy, A. F. (2000) Interleukin- 

2-producing helper T lymphocyte precursor frequency and rejection: a longitudinal 

cellular study after cardiac transplantation. Immunol. Cell Biol. 78, 272–279. 

5. de Haan, A., van der Gun, I., Hepkema, B. G., et al. (2000) Decreased donorspecific 

cytotoxic T cell precursor frequencies one year after clinical lung transplantation 

do not reflect transplantation tolerance: a comparison of lung transplant 

recipients with or without bronchiolitis obliterans syndrome. Transplantation 69, 

1434–1439. 

6. Orosz, C. G., Zinn, N. E., Sirinek, L. P., and Ferguson, R. M. (1986) In vivo 

mechanisms of alloreactivity. II. Allospecificity of cytotoxic T lymphocytes in 

sponge matrix allografts as determined by limiting dilution analysis. Transplantation 

41, 84–92. 

7. Baker, R. J., Hernandez-Fuentes, M. P., Brookes, P. A., Chaudhry, A. N., Cook, 

H. T., and Lechler, R. I. (2001) Loss of direct and maintenance of indirect alloresponses 

in renal allograft recipients: implications for the pathogenesis of chronic 

allograft nephropathy. J. Immunol. 167, 7199–7206. 

8. Abbas, A., Lichtman, A., and Pober, J. (1995) The Major Histocompatibility Complex. 

Cellular and Molecular Immunology, Vol. 3, McGraw-Hill, New York, pp. 

96–114. 

9. Vella, J. P., Spadafora-Ferreira, M., Murphy, B., et al. (1997) Indirect 

allorecognition of major histocompatibility complex allopeptides in human renal 

transplant recipients with chronic graft dysfunction. Transplantation 64, 795–800. 

10. Benichou, G., Valujskikh, A., and Heeger, P. S. (1999) Contributions of direct 

and indirect T cell alloreactivity during allograft rejection in mice. J. Immunol. 

162, 352–358.


11. SivaSai, K. S., Smith, M. A., Poindexter, N. J., et al. (1999) Indirect recognition 

of donor HLA class I peptides in lung transplant recipients with bronchiolitis obliterans 

syndrome. Transplantation 67, 1094–1098. 

12. Hornick, P. I., Mason, P. D., Baker, R. J., et al. (2000) Significant frequencies of 

T cells with indirect anti-donor specificity in heart graft recipients with chronic 

rejection. Circulation 101, 2405–2410. 

13. Azuma, H., Chandraker, A., Nadeau, K., et al. (1996) Blockade of T-cell 

costimulation prevents development of experimental chronic renal allograft rejection. 

Proc. Natl. Acad. Sci. USA 93, 12,439–12,444. 

14. Yamada, A., Chandraker, A., Laufer, T. M., Gerth, A. J., Sayegh, M. H., and 

Auchincloss, H., Jr. (2001) Recipient MHC class II expression is required to 

achieve long-term survival of murine cardiac allografts after costimulatory blockade. 

J. Immunol. 167, 5522–5526. 

15. Hall, B. M., Pearce, N. W., Gurley, K. E., and Dorsch, S. E. (1990) Specific unresponsiveness 

in rats with prolonged cardiac allograft survival after treatment with 

cyclosporine. III. Further characterization of the CD4+ suppressor cell and its 

mechanisms of action. J. Exp. Med. 171, 141–157. 

16. Lechler, R. I., Garden, O. A., and Turka, L. A. (2003) The complementary roles of 

deletion and regulation in transplantation tolerance. Nat. Rev. Immunol. 3, 147–158. 

17. Wood, K. J. and Sakaguchi, S. (2003) Regulatory T cells in transplantation tolerance. 

Nat. Rev. Immunol. 3, 199–210. 

18. Garin, M. I. and Lechler, R. I. (2003) Regulatory T cells. Curr. Opin. Organ 


19. Salama, A. D., Najafian, N., Clarkson, M. R., Harmon, W. E., and Sayegh, M. H. 

(2003) Regulatory CD25(+) T cells in human kidney transplant recipients. J. Am. 

Soc. Nephrol. 14, 1643–1651. 

20. Segall, M., Noreen, H., Edwins, L., Haake, R., Shu, X. O., and Kersey, J. (1996) 

Lack of correlation of MLC reactivity with acute graft-versus-host disease and 

mortality in unrelated donor bone marrow transplantation. Hum. Immunol. 49, 

49–55. 

21. Yamada, K., Sachs, D. H., and DerSimonian, H. (1995) Human anti-porcine xenogeneic 

T cell response. Evidence for allelic specificity of mixed leukocyte reaction 

and for both direct and indirect pathways of recognition. J. Immunol. 155, 5249– 

5256. 

22. Najafian, N., Salama, A. D., Fedoseyeva, E. V., Benichou, G., and Sayegh, M. H. 

(2002) Enzyme-linked immunosorbent spot assay analysis of peripheral blood 

lymphocyte reactivity to donor HLA-DR peptides: potential novel assay for prediction 

of outcomes for renal transplant recipients. J. Am. Soc. Nephrol. 13, 252– 

259. 

23. Lefkovits, I. (1972) Induction of antibody-forming cell clones in microcultures. 

Eur J. Immunol. 2, 360–366. 

24. Lefkovits, I., and Waldmann, H. (1984) Limiting dilution analysis of the cells of 

immune system I. The clonal basis of the immune response. Immunol. Today 5, 

265–268


25. Sharrock, C. E., Kaminski, E., and Man, S. (1990) Limiting dilution analysis of 

human T cells: a useful clinical tool. Immunol. Today 11, 281–286. 

26. Orosz, C. G., Adams, P. W., and Ferguson, R. M. (1987) Frequency of human 

alloantigen-reactive T lymphocytes. II. Method for limiting dilution analysis of 

alloantigen-reactive helper T cells in human peripheral blood. Transplantation 

43, 718–724. 

27. Moretti, L., Giuliodori, L., Stramigioli, S., Luchetti, F., Baldi, A., and Sparaventi, 

G. (1992) Limiting dilution analysis of IL-2 producing cells: I. Studies of normal 

human peripheral blood. Haematologica 77, 463–469. 

28. Hornick, P. I., Brookes, P. A., Mason, P. D., et al. (1997) Optimizing a limiting 

dilution culture system for quantifying the frequency of interleukin-2-producing 

alloreactive T helper lymphocytes. Transplantation 64, 472–479. 

29. Kaminski, E., Hows, J., Goldman, J., and Batchelor, R. (1991) Optimising a limiting 

dilution culture system for quantitating frequencies of alloreactive cytotoxic 

T lymphocyte precursors. Cell Immunol 137, 88–95. 

30. Kelso, A. and Macdonald, H. R. (1982) Precursor frequency analysis of lymphokine-secreting 

alloreactive T lymphocytes. Dissociation of subsets producing 

interleukin 2, macrophage-activating factor, and granulocyte-macrophage colonystimulating 

factor on the basis of Lyt-2 phenotype. J. Exp. Med. 156, 1366–1379. 

31. Kelso, A. (1990) Frequency analysis of lymphokine-secreting CD4+ and CD8+ T 

cells activated in a graft-versus-host reaction. J. Immunol. 145, 2167–2176. 

32. Jordan, W. J. and Ritter, M. A. (2002) Optimal analysis of composite cytokine 

responses during alloreactivity. J. Immunol. Methods 260, 1–14. 

33. Schwarer, A. P., Jiang, Y. Z., Brookes, P. A., Bet al. (1993) Frequency of antirecipient 

alloreactive helper T-cell precursors in donor blood and graft-versushost 

disease after HLA-identical sibling bone-marrow transplantation. Lancet 341, 

203–205. 

34. Theobald, M., Hoffmann, T., Bunjes, D., and Heit, W. (1990) Frequency, specificity, 

and phenotype of clonally growing human alloreactive interleukin-2-secreting 

helper T lymphocyte precursors. Transplantation 50, 850–856. 

35. Kaminski, E., Hows, J., Man, S., et al. (1989) Prediction of graft versus host disease 

by frequency analysis of cytotoxic T cells after unrelated donor bone marrow 

transplantation. Transplantation 48, 608–613. 

36. Schwarer, A. P., Jiang, Y. Z., Deacock, S., et al. (1994) Comparison of helper and 

cytotoxic antirecipient T cell frequencies in unrelated bone marrow transplantation. 


37. Spencer, A., Brookes, P. A., Kaminski, E., et al. (1995) Cytotoxic T lymphocyte 

precursor frequency analyses in bone marrow transplantation with volunteer unrelated 

donors. Value in donor selection. Transplantation 59, 1302–1308. 

38. Speiser, D. E., Loliger, C. C., Siren, M. K., and Jeannet, M. (1996) Pretransplant 

cytotoxic donor T-cell activity specific to patient HLA class I antigens correlating 

with mortality after unrelated BMT. Br. J. Haematol. 93, 935–939. 

39. Keever-Taylor, C. A., Passweg, J., Kawanishi, Y., Casper, J., Flomenberg, N., and 

Baxter-Lowe, L. A. (1997) Association of donor-derived host-reactive cytolytic


and helper T cells with outcome following alternative donor T cell-depleted bone 

marrow transplantation. Bone Marrow Transplant. 19, 1001–1009. 

40. Hu, H., Robertus, M., de Jonge, N., et al. (1994) Reduction of donor-specific 

cytotoxic T lymphocyte precursors in peripheral blood of allografted heart recipients. 


41. Mestre, M., Massip, E., Bas, J., et al. (1996) Longitudinal study of the frequency 

of cytotoxic T cell precursors in kidney allograft recipients. Clin. Exp. Immunol. 

104, 108–114. 

42. Steinmann, J., Kaden, J., May, G., Schroder, K., Herwartz, C., and Muller- 

Ruchholtz, W. (1994) Failure of in vitro T-cell assays to predict clinical outcome 

after human kidney transplantation. J. Clin. Lab. Anal. 8, 157–162. 

43. Dozmorov, I., Eisenbraun, M. D., and Lefkovits, I. (2000) Limiting dilution 

analysis: from frequencies to cellular interactions. Immunol. Today 21, 15–18. 

44. Game, D. S., Hernandez-Fuentes, M. P., Chaudhry, A. N., and Lechler, R. I. 

(2003) CD4(+)CD25(+) Regulatory T cells do not significantly contribute to 

direct pathway hyporesponsiveness in stable renal transplant patients. J. Am. 

Soc. Nephrol. 14, 1652–1661. 

45. Dozmorov, I. M., Lutsenko, G. V., Sidorov, L. A., and Miller, R. A. (1996) Analysis 

of cellular interactions in limiting dilution cultures. J. Immunol. Methods 189, 

183–196. 

46. Bonnefoix, T., Bonnefoix, P., Mi, J. Q., Lawrence, J. J., Sotto, J. J., and Leroux, 

D. (2003) Detection of suppressor T lymphocytes and estimation of their frequency 

in limiting dilution assays by generalized linear regression modeling. J. 

Immunol. 170, 2884–2894. 

47. Taguchi, T., McGhee, J. R., Coffman, R. L., et al. (1990) Detection of individual 

mouse splenic T cells producing IFN-gamma and IL-5 using the enzyme-linked 

immunospot (ELISPOT) assay. J. Immunol. Methods 128, 65–73. 

48. Miyahira, Y., Murata, K., Rodriguez, D., et al. (1995) Quantification of antigen 

specific CD8+ T cells using an ELISpot assay. J. Immunol. Methods 181, 45– 

54. 

49. Czerkinsky, C., Andersson, G., Ekre, H. P., Nilsson, L. A., Klareskog, L., and 

Ouchterlony, O. (1988) Reverse ELISpot assay for clonal analysis of cytokine 

production. I. Enumeration of gamma-interferon-secreting cells. J. Immunol. 

Methods 110, 29–36. 

50. Herr, W., Linn, B., Leister, N., Wandel, E., Meyer zum Buschenfelde, K. H., and 

Wolfel, T. (1997) The use of computer-assisted video image analysis for the quantification 

of CD8+ T lymphocytes producing tumor necrosis factor alpha spots in 

response to peptide antigens. J. Immunol. Methods 203, 141–152. 

51. Smith, J. G., Levin, M., Vessey, R., et al. (2003) Measurement of cell-mediated 

immunity with a Varicella-Zoster Virus- specific interferon-gamma ELISPOT 

assay: responses in an elderly population receiving a booster immunization. J. 

Med. Virol. 70, S38–41. 

52. Asai, T., Storkus, W. J., Mueller-Berghaus, J., et al. (2002) In vitro generated 

cytolytic T lymphocytes reactive against head and neck cancer recognize multiple


epitopes presented by HLA-A2, including peptides derived from the p53 and 

MDM-2 proteins. Cancer Immun. 2, 3. 

53. Pelfrey, C. M., Rudick, R. A., Cotleur, A. C., Lee, J. C., Tary-Lehmann, M., and 

Lehmann, P. V. (2000) Quantification of self-recognition in multiple sclerosis by 

single-cell analysis of cytokine production. J. Immunol. 165, 1641–1651. 

54. Salama, A. D., Chaudhry, A. N., Holthaus, K. A., et al. (2003) Regulation by 

CD25 + lymphocytes of autoantigen-specific T-cell responses in Goodpasture’s 

(anti-GBM) disease. Kidney Int. 64, 1685–1694. 

55. Heeger, P. S., Greenspan, N. S., Kuhlenschmidt, S., et al. (1999) Pretransplant 

frequency of donor-specific, IFN-gamma-producing lymphocytes is a manifestation 

of immunologic memory and correlates with the risk of posttransplant rejection 

episodes. J. Immunol. 163, 2267–2275. 

56. Scheibenbogen, C., Romero, P., Rivoltini, L., et al. (2000) Quantitation of antigenreactive 

T cells in peripheral blood by IFNgamma-ELISPOT assay and chromiumrelease 

assay: a four-centre comparative trial. J. Immunol. Methods 244, 81–89. 

57. Goulder, P. J., Tang, Y., Brander, C., et al. (2000) Functionally inert HIV-specific 

cytotoxic T lymphocytes do not play a major role in chronically infected adults 

and children. J. Exp.Med. 192, 1819–1832. 

58. Snyder, J. E., Bowers, W. J., Livingstone, A. M., Lee, F. E., Federoff, H. J., and 

Mosmann, T. R. (2003) Measuring the frequency of mouse and human cytotoxic 

T cells by the Lysispot assay: independent regulation of cytokine secretion and 

short-term killing. Nat. Med. 9, 231–235. 

59. Lyons, A. B., and Parish, C. R. (1994) Determination of lymphocyte division by 

flow cytometry. J. Immunol. Methods 171, 131–137. 

60. Wells, A. D., Gudmundsdottir, H., and Turka, L. A. (1997) Following the fate of 

individual T cells throughout activation and clonal expansion. Signals from T cell 

receptor and CD28 differentially regulate the induction and duration of a proliferative 

response. J. Clin. Invest. 100, 3173–3183. 

61. Suchin, E. J., Langmuir, P. B., Palmer, E., Sayegh, M. H., Wells, A. D., and Turka, 

L. A. (2001) Quantifying the frequency of alloreactive T cells in vivo: new answers 

to an old question. J. Immunol. 166, 973–981. 

62. Dengler, T. J., Johnson, D. R., and Pober, J. S. (2001) Human vascular endothelial 

cells stimulate a lower frequency of alloreactive CD8+ pre-CTL and induce less 

clonal expansion than matching B lymphoblastoid cells: development of a novel 

limiting dilution analysis method based on CFSE labeling of lymphocytes. J. 

Immunol. 166, 3846–3854. 

63. Allez, M., Brimnes, J., Dotan, I., and Mayer, L. (2002) Expansion of CD8+ T 

cells with regulatory function after interaction with intestinal epithelial cells. Gastroenterology 

123, 1516–1526. 

64. Sanchez-Fueyo, A., Weber, M., Domenig, C., Strom, T. B., and Zheng, X. X. 

(2002) Tracking the immunoregulatory mechanisms active during allograft tolerance. 

J. Immunol. 168, 2274–2281. 

65. Lyons, A. B. (2000) Analysing cell division in vivo and in vitro using flow 

cytometric measurement of CFSE dye dilution. J. Immunol. Methods 243, 147–154.


66. Oelke, M., Kurokawa, T., Hentrich, I., et al. (2000) Functional characterization of 

CD8(+) antigen-specific cytotoxic T lymphocytes after enrichment based on 

cytokine secretion: comparison with the MHC-tetramer technology. Scand J. 

Immunol. 52, 544–549. 

67. Asemissen, A. M., Nagorsen, D., Keilholz, U., et al. (2001) Flow cytometric determination 

of intracellular or secreted IFNgamma for the quantification of antigen 

reactive T cells. J. Immunol. Methods 251, 101–108. 

68. Manz, R., Assenmacher, M., Pfluger, E., Miltenyi, S., and Radbruch, A. (1995) 

Analysis and sorting of live cells according to secreted molecules, relocated to a 

cell-surface affinity matrix. Proc. Natl. Acad. Sci. USA 92, 1921–1925. 

69. Pala, P., Hussell, T., and Openshaw, P. J. (2000) Flow cytometric measurement of 

intracellular cytokines. J. Immunol. Methods 243, 107–124. 

70. Dinter, A. and Berger, E. G. (1998) Golgi-disturbing agents. Histochem. Cell Biol. 

109, 571–590. 

71. Whiteside, T. L., Zhao, Y., Tsukishiro, T., Elder, E. M., Gooding, W., and Baar, J. 

(2003) Enzyme-linked immunospot, cytokine flow cytometry, and tetramers in 

the detection of T-cell responses to a dendritic cell-based multipeptide vaccine in 

patients with melanoma. Clin. Cancer Res. 9, 641–649. 

72. Koehne, G., Smith, K. M., Ferguson, T. L., et al. (2002) Quantitation, selection, 

and functional characterization of Epstein- Barr virus-specific and alloreactive T 

cells detected by intracellular interferon-gamma production and growth of cytotoxic 

precursors. Blood 99, 1730–1740. 

73. Theobald, M., Nierle, T., Bunjes, D., Arnold, R., and Heimpel, H. (1992) Hostspecific 

interleukin-2-secreting donor T-cell precursors as predictors of acute 

graft-versus-host disease in bone marrow transplantation between HLA-identical 

siblings. N. Engl. J. Med. 327, 1613–1617. 

74. Winandy, M., Lewalle, P., Deneys, V., Ferrant, A., and De Bruyere, M. (1999) 

Pretransplant helper T-lymphocyte determination in bone marrow donors: acute 

graft-versus-host disease prediction and relation with long-term survival. B.r J. 

Haematol. 105, 288–294. 

75. Hernandez-Fuentes, M. P., Warrens, A. N., and Lechler, R. I. (2003) Immunologic 

monitoring. Immunol. Rev. 196, 247–264. 

76. Hornick, P. I., Mason, P. D., Yacoub, M. H., Rose, M. L., Batchelor, R., and 

Lechler, R. I. (1998) Assessment of the contribution that direct allorecognition 

makes to the progression of chronic cardiac transplant rejection in humans. Circulation 

97, 1257–1263. 

77. Sayegh, M. H., Perico, N., Gallon, L., et al. (1994) Mechanisms of acquired thymic 

unresponsiveness to renal allografts. Thymic recognition of immunodominant allo- 

MHC peptides induces peripheral T cell anergy. Transplantation 58, 125–132. 

78. Taswell, C. (1981) Limiting dilution assays for the determination of immunocompetent 

cell frequencies. I. Data analysis. J. Immunol. 126, 1614–1619. 

79. Strijbosch, L. W., Buurman, W. A., Does, R. J., Zinken, P. H., and Groenewegen, 

G. (1987) Limiting dilution assays. Experimental design and statistical analysis. 

J. Immunol. Methods 97, 133–140.


80. Strijbosch, L. W., Does, R. J., and Buurman, W. A. (1988) Computer aided design 

and evaluation of limiting and serial dilution experiments. Int. J. Biomed. Comput. 

23, 279–290. 

81. Mehrabi, Y. and Matthews, J. N. S. (1995) Likelihood-based methods for bias 

reduction in limiting dilution assays. Biometrics 51, 1543–1549 

82. Prieto, A., Reyes, E., Diaz, D., et al. (2000) A new method for the simultaneous 

analysis of growth and death of immunophenotypically defined cells in culture. 

Cytometry 39, 56–66.

Proteomics and Laser Microdissection 291 

13 

Proteomics and Laser Microdissection 

Emma McGregor and Ayesha De Souza 

Summary 

Two-dimensional gel electrophoresis (2-DE) combined with protein identification by 

mass spectrometry (MS) is currently the method of choice in the majority of proteomic 

projects. Novel gel-free technologies have been developed but 2-DE remains the technique 

of choice for quantitative expression profiling of large sets of complex protein 

mixtures such as whole cell/tissue lysates. 

Solubilized proteins are separated in the first dimension according to their charge 

properties (isoelectric point, pI) by isoelectric focusing (IEF) under denaturing conditions, 

followed by their separation in the second dimension by sodium dodecyl sulfatepolyacrylamide 

gel electrophoresis (SDS-PAGE), according to their relative molecular 

mass (M r). 2-DE can resolve more than 5000 proteins simultaneously (~2000 proteins 

routinely) and can detect less than 1 ng of protein per spot. Furthermore, it delivers a 

map of intact proteins, which reflects changes in protein expression level, isoforms or 

posttranslational modifications. 

In this chapter we describe the various steps in the 2-DE proteomics workflow, 

namely sample preparation, solubilization, 2-D gel electrophoresis, protein detection and 

visualization, and protein identification by mass spectrometry. The use of 2-DE in conjunction 

with laser microdissection microscopy is presented and discussed. 

Key Words: Laser microdissection; two-dimensional gel electrophoresis (2-DE); isoelectric 

focusing; cardiovascular research; blood vessels; cardiac myocytes; left ventricle. 


In 2001, a major milestone was reached with the publication of the draft 

sequence of the human genome (1,2). The human genome contains fewer open 

reading frames (~30,000 open reading frames) encoding functional proteins than 

was generally predicted and, like all other completed genomes, contains many 



291

292 McGregor and De Souza 

novel genes with no ascribed functions. It is now widely known and accepted 

that one gene does not encode a single protein, as a result of alternative mRNA 

splicing, RNA editing and posttranslational protein modification (e.g., phosphorylation, 

sulfation, glycosylation, hydroxylation, N-methylation, carboxymethylation, 

acetylation, prenylation and N-myristolation). As a result of these 

processes, the functional complexity of an organism far exceeds that indicated 

by its genome sequence alone. The global study of the products of gene expression, 

including transcriptomics, proteomics and metabolomics, plays a major 

role in elucidating the functional role of the many novel genes and their products 

and in understanding their involvement in biologically relevant phenotypes 

in health and disease. Despite this, tissue heterogeneity and the need for specific 

cell enrichment prior to sample analysis represents a major barrier in the study 

of normal vs diseased tissue. 

In this chapter, we describe how we have used laser microdissection in conjunction 

with proteomics to investigate cardiac proteins. 

2. Proteomics 

The concept of mapping the human complement of protein expression was 

first proposed more than 25 yr ago (3,4) with the development of a technique in 

which large numbers of proteins could be separated simultaneously by twodimensional 

polyacrylamide gel electrophoresis (2-DE) (5,6). However, it was 

not until 1995, that the term proteome, defined as the protein complement of a 

genome, was first coined by Wilkins working as part of a collaborative team at 

Macquarie (Australia) and Sydney Universities (Australia) (7,8). Since then, 

the term proteomics has evolved to include alternative gel-free techniques based 

on mass spectrometry (MS) or protein arrays for high-throughput proteomics. 

2.1. Sample Preparation 

The most important step in a proteomics experiment is sample preparation. 

Any artifacts introduced during sample preparation can often be magnified 

with the potential to impair the validity of the results. No single method for 

sample preparation can be applied universally owing to the diverse nature of 

samples that are analyzed by 2-DE (9), but some general considerations can be 

mentioned. Detection of subtle posttranslational modifications such as phosphorylation 

is possible because of the high resolution capacity of 2-DE. 2-DE 

will also readily reveal artefactual modifications such as protein carbamylation 

that can be induced by heating of samples in the presence of urea. Additionally, 

proteases present within samples can readily result in artifactual spots, so 

that samples should be subjected to minimal handling and kept cold at all 

times. It is possible to add cocktails of protease inhibitors during sample preparation.


2.2. Protein Solubilization 

Ideally, solubilization of proteins prior to 2-DE would result in the disruption 

of all non-covalently bound protein complexes and aggregates into a solution 

of individual polypeptides (9). If this is not successfully achieved, 

persistent protein complexes in the sample are likely to result in new spots in 

the 2-D profile, with a concomitant reduction in the intensity of those spots 

representing the single polypeptides. In addition, the solubilization method 

must permit the removal of substances such as salts, lipids, polysaccharides 

and nucleic acids that can interfere with the 2-DE separation. Finally, the 

sample proteins must remain soluble during the 2-DE process. For the foregoing 

reasons sample solubility is one of the most critical factors for successful 

protein separation by 2-DE. 

The original and still the most popular method for protein solubilization 

prior to 2-DE remains that described by O’Farrell (6) using a mixture of 9.5 M 

urea, 4% w/v of the nonionic detergent NP-40 or the zwitterionic detergent 3- 

[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate (CHAPS), 1% 

w/v of the reducing agent dithiothreitol (DTT) and 2% w/v of synthetic carrier 

ampholyte in the appropriate pH range (“lysis buffer”). This method can be 

applied to many sample types, but it is not universally applicable, with membrane 

proteins representing a particular challenge (10). Protein solubilization 

can be improved by varying solubilization buffer constituents. Newly developed 

detergents such as sulfobetaines (11), additional denaturing agents such 

as thiourea (12), and alternative reducing agents such as trubutyl phosphine 

(13), can help to improve protein solubilization and hence the concentration of 

extracted protein for certain sample types. It is of paramount importance that 

the choice of solubilization buffer be optimized for each sample type to be 

analyzed by 2-DE (see ref. 14 for an example of optimizing the solubilization 

of human myocardium). 

2.3. Two-Dimensional Gel Electrophoresis 

2-DE involves the separation of solubilized proteins by isoelectric focusing 

(IEF) according to their charge properties (isoelectric point, pI), under denaturing 

conditions, in the first dimension, followed by separation in the second 

dimension according to relative molecular mass (Mr) by sodium dodecyl sulphate 

(SDS)-PAGE. Charge and mass properties of proteins are effectively 

independent parameters, thus, an orthogonal combination of charge (pI) and 

size (Mr) separations results in the sample proteins being distributed across the 

two-dimensional gel profile (Fig. 1). 

The recent introduction of immobilized pH gradients (IPGs) (Amersham Biosciences), 

used in the first dimension, has served to increase the resolution of 

2-DE and improve the reproducibility of protein separations (15,16). IPGs are


Fig. 1. A two-dimensional electrophoretic separation of heart (ventricle) proteins. 

The first dimension comprised an 18-cm nonlinear pH 3.0–10.0 immobilized pH gradient 

(IPG) subjected to isoelectric focusing. The second dimension was a 21-cm 12% 

sodium dodecylsulphate polyacrylamide gel electrophoresis (SDS-PAGE) gel. Proteins 

were detected by silver staining. The non-linear pH range of the first-dimension IPG 

strip is indicated along the top of the gel, acidic pH to the left. The M r (relative molecular 

mass) scale can be used to estimate the molecular weights of the separated proteins. 

generated using immobiline reagents (17) to replace the synthetic carrier 

ampholytes (SCAs) previously used to generate the pH gradients required for 

IEF. As a result IPGs are immune to the effects of electroendosmosis which 

results in cathodic drift with the consequent loss of basic proteins from 2-D gel 

profiles generated using SCA IEF. IPGs are commercially available as a range of 

different pH gradients. Standard gradients include pH 3.0–10.0, 4.0–7.0 and 6.0– 

9.0, but if increasing proteomic coverage of a sample is required (i.e., “pulling 

apart” protein profiles), protein samples can be separated using narrow-range 

IPGs (e.g., pH 4.0–5.0, 4.5–5.5, 5.0–6.0, 5.5–6.7), thus increasing resolution. 

First-dimension IEF of protein samples is carried out on individual gel strips 

(IPGs), 3–5mm wide, cast on a plastic support. This can be done using either 

the IPGphor (Amersham Biosciences) or Multiphor (Amersham Biosciences). 

For the purpose of the experiments described in this chapter, first-dimension 

IEF was performed on a Multiphor (Amersham Biosciences) using 180-mm, 

pH 3.0–10.0 nonlinear (NL) IPGs. 

Following steady-state IEF, strips are equilibrated and then applied to the 

surface of either vertical or horizontal slab SDS-PAGE gels (18). It is possible


to routinely separate up to 2000 proteins from whole-cell and tissue extracts 

using 18-cm IPG strips with standard format SDS gels (20 × 20 cm). Resolution 

can be significantly enhanced (separation of 5000–10,000 proteins) using 

large-format (40 × 30 cm) 2D gels (19). However, gels of this size are very 

rarely used due to the handling problems associated with such large gels. The 

longest commercial IPG IEF gels have a length of 24 cm (20). Mini-gels (7 × 7 

cm) can be run using 7-cm IPG strips. These gels will only separate a few 

hundred proteins but can be very useful for rapid screening purposes. Seconddimension 

SDS-PAGE is usually carried out using apparatus capable of running 

simultaneously multiple large-format 2-D gels (e.g., Ettan DALT 2, 12 

gels, Amersham Biosciences; Protean Plus Dodeca Cell, 12 gels, Bio-Rad). 

Large numbers of 2-D protein separations can be performed using this type of 

apparatus, but the procedure is very time-consuming and labor-intensive. 

2.4. Protein Detection and Visualization 

Proteins must be visualized at high sensitivity following separation by electrophoresis. 

Ideally detection methods should combine properties of a high dynamic 

range (i.e., the ability to detect proteins present in the gel at a wide range of 

relative abundance), linearity of staining response (to facilitate rigorous quantitative 

analysis), and if possible compatibility with subsequent protein identification 

by MS. Coomassie brilliant blue (CBB) has for many years been a standard 

staining method for protein detection following gel electrophoresis. However its 

limited sensitivity (~100 ng protein) motivated the development of a more sensitive 

(~10 ng protein) method utilizing CBB in a colloidal form (21). Since its 

first description in 1979 (22), silver staining has often been the method of choice 

for protein detection on 2-D gels because of its high sensitivity (~0.1 ng protein). 

However, silver staining suffers from significant inherent disadvantages; it has 

a limited dynamic range, it is susceptible to saturation and negative staining 

effects that compromise quantitation, and most protocols are not compatible 

with subsequent protein identification by MS. This is because glutaraldehyde, 

included in many protocols as a sensitizing reagent, causes extensive crosslinking 

through reaction with both ε- and α-amino groups. To achieve compatibility 

with MS, glutaraldehyde must be omitted (23,24), but at the expense of 

increased background and reduced sensitivity. In the study presented here we 

have utilized the silver-staining method of Yan (24). 

Detection methods based on the postelectrophoretic staining of proteins with 

fluorescent compounds have the potential of increased sensitivity combined 

with an extended dynamic range for improved quantitation. The most commonly 

used reagents are the SYPRO series of dyes from Molecular Probes (25). 

In addition to these the development of 2-D difference gel electrophoresis by 

Unlu (26) using fluorescent Cy dyes (Cy3, Cy5, and Cy2) has made it possible


to detect and quantitate differences between experimentally paired protein 

samples resolved on the same 2-D gel. Fluorescent staining methods do not 

interfere with subsequent protein identification by MS (25,27). 

2.5. Protein Identification 

MS is currently the technique of choice for protein identification as the methods 

involved are very sensitive, require small amounts of sample (femtomole 

to attomole concentrations) and have the capacity for high sample throughput 

(28–30). Peptide mass fingerprinting (PMF) is typically the primary tool for 

protein identification. It is based on the finding that a set of peptide masses 

obtained by MS analysis of a protein digest (usually trypsin) provides a characteristic 

mass fingerprint of that protein. The protein is then identified by 

comparison of the experimental mass fingerprint with theoretical peptide 

masses generated in silico using protein and nucleotide sequence databases. 

PMF can be very effective when trying to identify proteins from species whose 

genomes are completely sequenced, but is not so reliable for organisms whose 

genomes have not been completed. This difficulty can be overcome effectively 

by improving PMF by adopting an orthogonal approach combined with amino 

acid compositional analysis (31). 

If identification of a protein becomes impossible based on PMF alone, amino 

acid sequence information is then key to obtaining identification. Conventional 

automated chemical Edman microsequencing is capable of generating this information 

but this is most readily accomplished using tandem MS (MS/MS). MS/ 

MS takes advantage of two-stage MS instruments, either MALDI-MS with 

postsource decay (PSD), MALDI-TOF-TOF-MS/MS or ESI-MS/MS triplequadropole, 

ion-trap, or Q-TOF machines, to induce fragmentation of peptide 

bonds. One approach is to generate a short partial sequence or tag which is used 

in combination with the mass of the intact parent peptide ion to provide significant 

additional information for the homology search (32). A second approach 

uses the database-searching algorithm SEQUEST (33) to match uninterpreted 

experimental MS/MS spectra with predicted fragment patterns generated in 

silico from sequences in protein and nucleotide databases. 

3. Laser Microdissection 

Laser microdissection represents a breakthrough technology that allows rapid 

one-step procurement of selected homogeneous populations of intact cells from 

a section of complex, heterogeneous tissue, thus focusing on individual genes 

or proteins from a particular subset. In 1996 Emmert-Buck first described laser 

capture microdissection (LCM) (34), and this technique has since become 

widely used in the world of both genomics (35–38) and proteomics (39–43). 

Laser microdissection is an easy, extremely fast and versatile method for the


isolation of morphologically or immunohistochemically defined cell populations. 

This combined with the ability to readily confirm the nature of the captured 

material is a great advantage of this technique. 

There are three commercially available microscopes on the market for laser 

microdissection. The first LCM setup was developed at the National Cancer 

Institute of the National Institutes of Health and is commercially available from 

Arcturus Engineering (Mountain View, CA). To date, this is the most widely 

used system. The Arcturus system uses a laser beam and a special thermoplastic 

transfer film which is bound to the underside of a transfer cap. The cap is 

placed on the surface of the tissue and a laser pulse is sent through the transparent 

cap, which expands the thermoplastic film. The adherence of the tissue to 

the activated film exceeds the adhesion to the glass slide and thus allows the 

removal of the specified cells. The selected material is then collected by lifting 

the cap, which is then transferred to a tube containing the solubilization/lysis 

buffer required for the isolation of the desired proteins. 

The second is the PALM laser-microbeam system (P.A.L.M, Wolfratshausen, 

Germany). Using the PALM, selected cells can be isolated from the surrounding 

tissue using a focused nitrogen laser. To collect the selected cells of interest, 

the energy of the laser is increased and the microdissected area is catapulted by 

a single laser shot. The detached material is then collected in a microcentrifuge 

cap containing lysis buffer, which is mounted above the slide. The efficiency of 

this procedure is verified by visualizing the collected samples under a second 

microscope. 

We are currently using the Leica AS LMD (Leica Microsystems, UK). The 

Leica uses a maintenance-free, pulsed, nitrogen laser at a wavelength of 337 

nm. In order to excise the structure of interest, the pulsed laser follows a predrawn 

line, ablating the material only in the region of the defined line. This 

method of dissection ensures that the specimen is not heated and endures no 

mechanical contact; therefore the risk of contamination is eliminated. After 

dissection, the sample falls by gravity into a precisely positioned polymerase 

chain reaction tube cap. Following capture, the cap can be automatically examined 

to visualize the excised material. Figure 2 shows an example of the microdissection 

of a blood vessel and a group of cardiac myocytes from an 8-µm 

section of left ventricular tissue using the Leica AS LMD. 

The precision of microdissection depends on the ability to distinguish specific 

cell types. Unfortunately, one of the major disadvantages of laser microdissection 

is that it is necessary to use dehydrated sections in the absence of a 

coverslip. This leads to a significant decrease in the optical resolution, which 

may alter the ease of this technique and may require various staining techniques 

to be employed. Another disadvantage is the initial cost of the microscope and 

accompanying computer hardware and software (~£75,000–100,000), with the


Fig. 2. Laser microdissection of left ventricular section. The appearance of a hematoxylin-and-eosin 

stained left ventricular section (×400 magnification) is illustrated 

prior to dissection and following dissection, and the dissected material is present in the 

cap. (A) Microdissection of a blood vessel; (B) dissection of a group of cardiac myocytes. 

The horizontal bar represents 100 µm. 

additional cost of specially designed consumables, (e.g., slides, caps) depending 

on the microdissection system used. Finally, although LCM is extremely fast at 

excising the cell or group of cells of interest, depending on the downstream 

processing of the captured material, this technique can be considerably timeconsuming. 

The amount of material needed for protein analysis is much greater 

than that for RNA analysis, because protein, unlike RNA, cannot be amplified. 

For this reason, days to weeks may be spent at the microscope in order to excise 

enough material for the extraction of a sufficient amount of protein. Even though 

this is the case, there are several important reasons for focusing on the analysis 

of proteins. mRNA expression may not correlate with the amount of active protein 

in a cell, the gene sequence does not describe posttranslational modifications 

that may be essential for protein function and activity, and the study of the 

genome does not provide information on dynamic cellular processes. The application 

of proteomics can be expected to provide an integrated view of an individual 

disease process at the protein level. Proteomics can be expected to show 

changes in the protein-expression profile occurring during both the development 

and the progression of disease, thus leading to the identification of new 

protein markers of disease and potential therapeutic targets. 

3.1. Proteomics and Laser Microdissection 

We are using laser microdissection to isolate myocytes and blood vessels 

from human cardiac tissue for proteomic analysis. We have performed a feasibility 

study to investigate the effects of fixation and staining on cardiac proteins 

separated by 2-DE. In brief, 20 8-µm sections of control ventricles were 

used in six groups (n = 4).


• Group 1: sections cut and placed into lysis buffer (7 M urea, 2 M thiourea, 2% (w/v) 

CHAPS, 1% (w/v) DTT, 0.8 % (v/v) Pharmalyte pH 3.0–10.0, 1 complete protease 

inhibitor cocktail tablet per 10 mL). 

• Groups 2–6: sections cut onto glass slides and scraped into lysis buffer following 

fixation and staining. Group 2—unfixed and unstained. Groups 3 and 4—ethanol 

fixed followed by hematoxylin and eosin (H&E) staining with and without xylene 

respectively. Groups 5 and 6—ethanol and acetone fixed, respectively, followed 

by antibody staining for smooth muscle α-actin. Proteins (50 µg) were separated 

by two-dimensional gel electrophoresis using (18-cm) IPG pH 3–10 NL strips in 

the first dimension, followed by 12% SDS-PAGE in the second dimension. Protein 

spots were visualized by silver staining and the number of detected spots evaluated 

using Progenesis, a specialized 2-DE image analysis software package (Nonlinear 

Dynamics). 

Analysis by 2-DE showed that contractile proteins were preserved in all 

groups. All methods resulted in some loss of soluble proteins, although no significant 

differences were found. However, there were differences in the visual 

quality of the gel patterns. These findings are similar to those found by Craven 

(41), who found that all staining protocols investigated were compatible with 

protein analysis although there was variation in the quality of the protein profiles 

obtained. In contrast to these studies, Mouledous (44) found that H&E staining 

greatly reduced protein recovery when compared with unstained material and 

this was seriously detrimental to the protein profile. Although our group and 

Craven et al. (41) found no changes in protein profiles under varying staining 

protocols, it is important to investigate each tissue type individually, because a 

staining protocol that works with one tissue, may not necessarily be compatible 

with another. 

H&E staining without xylene provided the best morphology for our tissue 

and thus this staining method was used for further investigations. This staining 

method was performed using a modified rapid protocol for LCM (40). In brief, 

sections were fixed (70% ethanol for 1 min), H&E stained (Mayer’s hematoxylin 

for 30 s, MQ water for 20 s, eosin for 20 s, [MQ] water for 20 s), and dehydrated 

(70% ethanol for 30 s, 100% ethanol for 1 min). H&E solutions contained 

complete protease inhibitor cocktail tablets. We have shown that the electrophoretic 

profiles of proteins from human cardiac tissue showed little change 

following the laser microdissection procedure. Figure 3 shows 2-D gels for 

two left ventricle sections stained with H&E in the absence of xylene, then 

either scrapped or excised using laser microdissection and protein-extracted in 

lysis buffer (45). Using Progenesis, 346 protein spots were detected in the 

scrapped group compared with 361 in the laser-microdissected group. Using 

this staining protocol in conjunction with laser microdissection, we have successfully 

isolated enough blood vessels and cardiac myocytes to run large-format 

(18 × 24 cm) 2-D gels (45). Figure 4 shows the protein profiles for proteins


Fig. 3. Two-dimensional electrophoretic separation of control sections taken from 

human left ventricle. Proteins were separated by isoelectric focusing in the first dimension 

using a pH 3.0–10.0 NL, 18-cm, IPG DryStrip (Amersham Biosciences). The pH 

gradient of the strip is illustrated across the top of the two-dimensional gel with the 

most acidic pH to the left and the most basic pH to the right of the gel image. Proteins 

were then separated in the second dimension by SDS-PAGE through a 12% acrylamide 

gel (large format, 18 × 24 cm). Standard molecular weight markers (Amersham Biosciences), 

ranging from 14.3 to 97.4 kDa were run on the same gel and are annotated 

in the figure. Visualization of proteins was achieved using silver staining. Twodimensional 

gel separations from hematoxylin and eosin-stained sections either 

scrapped (A) or laser microdissected (B). 

extracted from cardiac myocytes and blood vessels. Collection of this material 

took 70 h, and represented approx 2800 blood vessels and 17,000 cardiac 

myocytes. In order to prevent protein degradation it is important when extracting 

protein that either the slides with the sections are kept on dry ice and thawed 

prior to fixing or that sections are cut onto slides as they are needed. Using 

Progenesis, 481 spots were found in the myocyte group and 206 in the blood 

vessel group. By comparing protein profiles between the two groups, it is clear 

that there was no contamination when microdissection was carried out. This is 

confirmed by the absence of the proteins cardiac tropomyosin and the cardiac 

light chains I and II from the blood vessel profile, which are clearly visible in 

the protein profile from cardiac myocytes (labeled 1, 2, and 3, respectively). 

In conclusion, laser microdissection is a practical method for the rapid and 

efficient isolation of specific populations of cells. This technique however, 

may be extremely time-consuming depending on the desired downstream 

sample processing. The combination of laser microdissection and proteomics 

provides a powerful tool in studying the underlying changes in normal and


Fig. 4. Two-dimensional electrophoretic separation of isolated cells and blood vessels. 

Proteins were separated by isoelectric focusing in the first dimension using a pH 

3.0–10.0 NL, 18-cm, IPG DryStrip (Amersham Biosciences). The pH gradient of 

the strip is illustrated across the top of the two-dimensional gel with the most acidic 

pH to the left and the most basic pH to the right of the gel image. Proteins were then 

separated in the second dimension by SDS-PAGE through a 12% acrylamide gel (large 

format, 18 × 24 cm). Standard molecular weight markers (Amersham Biosciences) 

ranging from 14.3 to 97.4 kDa were run on the same gel and are annotated on the far 

left of the figure. Visualization of proteins was achieved using silver staining. (A) 

Cardiac myocytes: (B) blood vessels isolated from human ventricular tissue by laser 

microdissection. 1, Cardiac tropomyosin; 2, cardiac light chain I; 3, cardiac light 

chain II. 

diseased states. It has the potential to isolate and identify new protein markers 

and potential therapeutic targets of disease. 

References 

1. Lander, E. S. (2001) Initial sequencing and analysis of the human genome. Nature 

409, 860–921. 

2. Venter, J. C. (2001) The sequence of the human genome. Science 291, 1304–1351. 

3. Anderson, N. G., Matheson, A., and Anderson N. L. (2001) Back to the future: the 

human protein index (HPI) and the agenda for post-proteomic biology. Proteomics 

1, 3–12. 

4. Anderson, N. G. and Anderson, L. (1982) The human protein index. Clin. Chem. 

28, 739–748. 

5. Klose, J. (1975) Protein mapping by combined isoelectric focusing and electrophoresis 

of mouse tissues. A novel approach to testing for induced point mutations 

in mammals. Humangenetik 26, 231–243. 

6. O’Farrell, P. H. (1975) High resolution two-dimensional electrophoresis of proteins. 

J. Biol. Chem. 250, 4007–4021.


7. Wasinger, V. C., Cordwell, S. J., Cerpa-Poljak, A., et al. (1995) Progress with 

gene-product mapping of the Mollicutes: Mycoplasma genitalium. Electrophoresis 

16, 1090–1094. 

8. Wilkins, M. R., Sanchez, J. C., Gooley, A. A., R. et al. (1996) Progress with 

proteome projects: why all proteins expressed by a genome should be identified 

and how to do it. Biotechnol. Genet. Eng. Rev. 13, 19–50. 

9. Dunn, M. J., and Gorg, A. (2001) Two-dimensional polyacrylamide gel electrophoresis 

for proteome analysis, in Proteomics, From Protein Sequence to Function 

(Pennington, S. R., and Dunn, M. J., eds.), BIOS Scientific Publishers Ltd, 

pp. 43–63. 

10. Santoni, V., Kieffer, S., Desclaux, D., Masson, F., and Rabilloud, T. (2000) Membrane 

proteomics: use of additive main effects with multiplicative interaction 

model to classify plasma membrane proteins according to their solubility and electrophoretic 

properties. Electrophoresis 21, 3329–3344. 

11. Luche, S., Santoni, V., and Rabilloud, T. (2003) Evaluation of nonionic and zwitterionic 

detergents as membrane protein solubilizers in two-dimensional electrophoresis. 

Proteomics 3, 249–253. 

12. Rabilloud, T. (1998) Use of thiourea to increase the solubility of membrane proteins 

in two-dimensional electrophoresis. Electrophoresis 19, 758–760. 

13. Herbert, B. R., Molloy, M. P., Gooley, A. A., Walsh, B. J., Bryson, W. G., and 

Williams, K. L. (1998) Improved protein solubility in two-dimensional electrophoresis 

using tributyl phosphine as reducing agent. Electrophoresis 19, 845– 

851. 

14. Stanley, B. A., Neverova, I., Brown, H. A., and Van Eyk, J. E. (2003) Optimizing 

protein solubility for two-dimensional gel electrophoresis analysis of human myocardium. 


15. Blomberg, A., Blomberg, L., Norbeck, J., et al. (1995) Interlaboratory reproducibility 

of yeast protein patterns analyzed by immobilized pH gradient two-dimensional 

gel electrophoresis. Electrophoresis 16, 1935–1945. 

16. Corbett, J. M., Dunn, M. J., Posch, A., and Gorg, A. (1994) Positional reproducibility 

of protein spots in two-dimensional polyacrylamide gel electrophoresis 

using immobilised pH gradient isoelectric focusing in the first dimension: an 

interlaboratory comparison. Electrophoresis 15, 1205–1211. 

17. Bjellqvist, B., Ek, K., Righetti, P. G., et al. (1982) Isoelectric focusing in immobilized 

pH gradients: principle, methodology and some applications. J. Biochem. 

Biophys. Methods 6, 317–339. 

18. Gorg, A., Obermaier, C., Boguth, G., et al. (2000) The current state of two-dimensional 

electrophoresis with immobilized pH gradients. Electrophoresis 21, 1037– 

1053. 

19. Klose, J. and Kobalz, U. (1995) Two-dimensional electrophoresis of proteins: an 

updated protocol and implications for a functional analysis of the genome. Electrophoresis 

16, 1034–1059. 

20. Gorg, A., Obermaier, C., Boguth, G., and Weiss, W. (1999) Recent developments 

in two-dimensional gel electrophoresis with immobilized pH gradients: wide pH


gradients up to pH 12, longer separation distances and simplified procedures. Electrophoresis 

20, 712–717. 

21. Neuhoff, V., Arold, N., Taube, D., and Ehrhardt, W. (1988) Improved staining 

of proteins in polyacrylamide gels including isoelectric focusing gels with clear 

background at nanogram sensitivity using Coomassie brilliant blue G-250 and 

R-250. Electrophoresis 9, 255–262. 

22. Switzer, R. C., III, Merril, C. R., and Shifrin, S. (1979) A highly sensitive silver 

stain for detecting proteins and peptides in polyacrylamide gels. Anal. Biochem. 

98, 231–237. 

23. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Mass spectrometric 

sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, 850–858. 

24. Yan, J. X., Wait, R., Berkelman, T., et al. (2002) A modified silver staining protocol 

for visualization of proteins compatible with matrix-assisted laser desorption/ 

ionization and electrospray ionization-mass spectrometry. Electrophoresis 21, 

3666–3672. 

25. Patton, W. F. (2000) A thousand points of light: the application of fluorescence 

detection technologies to two-dimensional gel electrophoresis and proteomics. 

Electrophoresis 21, 1123–1144. 

26. Unlu, M., Morgan, M. E., and Minden, J. S. (1997) Difference gel electrophoresis: 

a single gel method for detecting changes in protein extracts. Electrophoresis 

18, 2071–2077. 

27. Lauber, W. M., Carroll, J. A., Dufield, D. R., Kiesel, J. R., Radabaugh, M. R., and 

Malone, J. P. (2001) Mass spectrometry compatibility of two-dimensional gel protein 

stains. Electrophoresis 22, 906–918. 

28. Patterson, S. D. and Aebersold, R. (1995) Mass spectrometric approaches for the 

identification of gel-separated proteins. Electrophoresis 16, 1791–1814. 

29. Yates, J. R., III (1998) Mass spectrometry and the age of the proteome. J. Mass 

Spectrom. 33, 1–19. 

30. Byers,H. L. and Ward, M. A. (2003) Mass spectrometry—a powerful analytical 

tool, in Proteomic and Genomic Analysis of Cardiovascular Disease (Van Eyk, 

J. E. and Dunn, M. J. eds.), Wiley-VCH GmbH & Co., KGaA, pp. 195–211. 

31. Wheeler, C. H., Berry, S. L., Wilkins, M. R., et al. (1996) Characterisation of proteins 

from two-dimensional electrophoresis gels by matrix-assisted laser desorption 

mass spectrometry and amino acid compositional analysis. Electrophoresis 17, 580– 

587. 

32. Mann, M. and Wilm, M. (1994) Error-tolerant identification of peptides in sequence 

databases by peptide sequence tags. Anal. Chem. 66, 4390–4399. 

33. Eng, J. K. (1994) An approach to correlate tandem mass spectral data of peptides 

with amino acid sequences in a protein database. J. Am. Soc. Mass Spec. 5, 976–989. 

34. Emmert-Buck, M. R., Bonner, R. F., Smith, P. D., et al. (1996) Laser capture 

microdissection. Science 274, 998–1001. 

35. Fend, F., Emmert-Buck, M. R., Chuaqui, R. F., Cole, K., Lee, J., Liotta, L. A., and 

Raffeld, M. (1999) Immuno-LCM: laser capture microdissection of 

immunostained frozen sections for mRNA analysis. Am. J. Pathol. 154, 61–66.


36. Goldsworthy, S. M., Stockton, P. S., Trempus, C. S., Foley, J. F., and Maronpot, 

R. R. (1999) Effects of fixation on RNA extraction and amplification from laser 

capture microdissected tissue. Mol. Carcinog. 25, 86–91. 

37. Stagliano, N. E., Carpino, A. J., Ross, J. S., and Donovan, M. (2001) Vascular 

gene discovery using laser capture microdissection of human blood vessels and 

quantitative PCR. Ann. NY Acad. Sci. 947, 334–349. 

38. Parlato, R., Rosica, A., Cuccurullo, V., et al. (2002) A preservation method that 

allows recovery of intact RNA from tissues dissected by laser capture microdissection. 

Anal. Biochem. 300, 139–145. 

39. Craven, R. A. and Banks, R. E. (2001) Laser capture microdissection and 

proteomics: Possibilities and limitation. Proteomics 1, 1200–1204. 

40. Banks, R. E., Dunn, M. J., Forbes, M. A., et al. (1999) The potential use of laser 

capture microdissection to selectively obtain distinct populations of cells for 

proteomic analysis–preliminary findings. Electrophoresis 20, 689–700. 

41. Craven, R. A., Totty, N., Harden, P., Selby, P. J., and Banks, R. E. (2002) Laser 

capture microdissection and two-dimensional polyacrylamide gel electrophoresis. 

Am. J. Pathol. 160, 815–822. 

42. Brown Jones, M., Krutzsch, H., Shu, H., et al. (2002) Proteomic analysis and 

identification of new biomarkers and therapeutic targets for invasive ovarian cancer. 


43. Lawrie, L. C., Curran, S., McLeod, H. L., Fothergill, J. E., and Murray, G. I. 

(2001) Application of laser capture microdissection and proteomics in colon cancer. 

J. Clin. Pathol. Mol. Pathol. 54, 253–258. 

44. Mouledous, L., Hunt, S., Harcourt, R., Harry, J. L., Williams, K. L., and Gutstein, 

H. B. (2002) Lack of compatibility of histological staining methods with 

proteomic analysis of laser-captured microdissected brain samples. J. Biomol. 

Tech. 13, 288–264. 

45. De Souza, A. I., McGregor, E., Dunn, M. J., and Rose, M. L. (2004) Preparation 

of human heart for laser microdissection and proteomics. Proteomics 4, 578–586.

Real-Time PCR 305 

14 

Real-Time Quantitative Polymerase Chain Reaction 

in Cardiac Transplant Research 

Leanne E. Felkin, Anne B. Taegtmeyer, and Paul J. R. Barton 

Summary 

The real-time quantitative polymerase chain reaction (PCR), an increasingly popular 

technique for the detection of DNA, combines a high degree of accuracy with extreme 

sensitivity. In this chapter we describe the use of real-time quantitative PCR in transplantation 

research in two areas in which this method is commonly applied: the accurate 

quantification of mRNA in tissue samples and genotyping of DNA. These are described 

in the context of cardiac transplantation, but they are of equal relevance to other areas of 

transplant biology. 

Key Words: Real-time PCR; quantitative PCR; mRNA quantification; TaqMan; 

RiboGreen; RNA degradation; genotyping; single-nucleotide polymorphism (SNP); 

polymorphism; myocardial biopsy. 


Since the first description of the principles of the 5'-nuclease assay (1) and 

the consequent development of the method to include increasingly sophisticated 

chemistries and detection systems (2–4), real-time polymerase chain 

reaction (PCR) has offered exceptionally high accuracy and sensitivity. The 

general principles of real-time PCR have been described in a number of excellent 

reviews (5–7) and an especially useful source of information is www. 

gene-quantification.com). A number of platforms and chemistries for realtime 

PCR are available. We describe here the use of TaqMan real-time PCR 

for measuring mRNA abundance in human myocardial samples and for singlenucleotide 

polymorphism (SNP) genotyping of cardiac transplant patients and 

their donors. 



305

306 Felkin et al. 

2. Real-Time PCR and mRNA Quantification 

2.1. Overview 

The accurate measurement of mRNA abundance remains an important prerequisite 

for analyzing gene expression (8). Traditional methods such as Northern 

blotting and ribonuclease protection assay offer reasonable accuracy and 

specificity but consume significant quantities of RNA. Methods based on PCR 

offer the distinct advantage of requiring only small amounts of starting material. 

While this may be less important when considering research on organs 

removed at the time of transplantation where tissue is readily available, it offers 

a significant advantage when considering analysis where tissue is limited, as is 

the case with surgical samples (9), endomyocardial biopsies (10), fetal heart 

samples (11), or material derived by laser microdissection. Initial PCR-based 

methods were “final-product” methods derived from the ability to establish retrospectively 

the point at which amplification was exponential. However, these 

were complicated by the need for complex and often time-consuming validation 

in order to achieve conditions of accurate quantification. Typically, this 

would involve serial dilution experiments to determine a linear working range, 

the use of a titrated exogenous RNA standard, or construction of artificial DNA 

constructs to act as internal competition reference targets. More recently, the 

approach of analyzing PCR products cycle-by-cycle in real time has led to the 

development of a variety of instruments with a range of analysis speeds, sample 

throughput, and cost (Table 1). Useful sources of information comparing 

currently available instruments can be found at www.biocom pare.com and 

www.gene-quantification.com. 

2.2. Principles of Real-Time PCR 

As with the detection instruments, a number of chemistries are available for 

real-time PCR, each of which offers distinct advantages and disadvantages (for 

a review see www.gene-quantification.com). Two of the more commonly used 

chemistries are Applied Biosystems’ TaqMan assay (2,3), described in more 

detail below, and SYBR Green detection, which uses a double-stranded DNAbinding 

dye (12,13). Whatever the system used, the general principles are 

largely the same. During real-time PCR, a fluorescent signal is generated that is 

directly proportional to the amount of accumulating PCR product. This signal is 

detected, calibrated, and used to provide a measure of initial target abundance. 

In the case of the ABI Prism 7700, fluorescent signal is collected from each 

reaction every 7 s. Thus, over the course of a 40-cycle PCR lasting 1 h and 56 

min, a total of 994 measurements will be made for every reaction. When the 

data are plotted against time, a picture of how the fluorescence accumulates in 

real time during the PCR emerges (Fig. 1). Displaying the kinetics of the real-


Table 1 

Real-Time PCR Instrumentation 

Number 

of available 

Supplier instruments Features 

Applied Biosystems 5 96- and 384-well formats available, 

www.appliedbiosystems.com single or multicolor detection, 

SNP autocalling, facility automation 

possible 

Roche Diagnostics 3 32-, 96-, and 384-well formats, 

www.roche-applied-science.com multicolor detection, SNP autocalling 

facility, high-speed cycling 

Corbett Research 1 36- and 72-well formats available, 

www.corbettresearch.com multicolor detection, SNP autocalling 

facility, high-speed cycling 

Cepheid 2 96 independently programmable 

www.cepheid.com wells, multicolor detection 

Biorad 3 96- and 384-well formats available, 

www.bio-rad.com single or multicolor detection, SNP 

autocalling facility 

Stratagene 3 96- well and 384-formats, multicolor 

www.stratagene.com detection, SNP autocalling facility 

MJ Research 4 96-well format, single or multicolor 

www.mjr.com detection, SNP autocalling facility 

time PCR reaction in this way clearly identifies the exponential, linear, and 

plateau phases of the reaction. 

2.2.1. PCR Kinetics 

PCR amplification is only truly exponential in the early phases of the reaction. 

As the reaction progresses, reagents are depleted and become limiting. By 

the time the product becomes readily detectable by gel electrophoresis, its 

abundance is often affected not only by the amount of initial starting template, 

but also by the increasingly impaired PCR efficiency. The principal advantage 

of real-time PCR analysis over all other PCR-based quantification techniques 

is the ability to reveal all phases of PCR for every sample, making possible 

quantification of the product early during the exponential phase.


Fig. 1. Detection of amplification product by real-time PCR. The graph shows the 

fluorescence signal (∆Rn) detected during the course of a series of PCR reactions 

loaded with increasing quantities of target sequence. At the start of PCR, signal is 

below detectable level (baseline). Initial detection above threshold shows doubling of 

product with each cycle (exponential phase). As PCR progresses, reagents become 

limiting (linear phase), resulting eventually in depletion (plateau phase). Note that 

each reaction will go to completion and the amount of product near the plateau phase 

is not proportional to input starting template. In real-time PCR, data is collected 

throughout the entire reaction, allowing the operator to select data from the exponential 

phase of each reaction. The C T value is the cycle at which signal first becomes 

detected over background. 

2.2.2. The Cycle Threshold 

The basic measurement in real-time PCR is the cycle threshold (C T), also 

known as the crossing point in some systems. The C T is the cycle at which 

fluorescence generated by the accumulating PCR product exceeds a fixed 

threshold (Fig. 1). The threshold is placed in the exponential phase of the amplification 

curve and may be set automatically or by the user. In this way the C T 

value indicates the number of cycles required to detect appearance of product 

above background. The greater the abundance of target mRNA in the starting 

material, the sooner the threshold fluorescence level is reached; in other words,


Fig. 2. Determination of real-time PCR efficiency. (A) Efficiency analysis. A threefold 

dilution series of cDNA prepared from human bone marrow RNA was analyzed 

by real-time PCR using TaqMan probes and primer sets for matrix metalloproteinase 9 

(MMP9) and 18S rRNA. Mean C T values are plotted against log input amount of 

cDNA. The slope of the graph is determined by linear regression and can be used to 

calculate the efficiency of the amplification: PCR efficiency = 100 × (10 (–1/slope) –1). 

Note the similarity in the slope of the lines for MMP9 and 18S, which indicates similar 

PCR efficiencies. Error bars represent standard deviation; n = 3 PCR replicates. 

(Continued on next page) 

the higher the target abundance, the lower the C T. Because PCR amplification 

is exponential, the C T value is proportional to the log concentration of the target 

DNA or, in the case of reverse transcriptase (RT)-PCR, of the target RNA 

(Fig. 2A). It is therefore necessary to calibrate and log transform the C T to get 

the final result. It is also important to note that the C T is not an absolute measure 

of target abundance, as its value will vary depending on where the threshold 

is set.


Fig. 2. (continued) (B) Validation plot for the ∆∆C T method. ∆C T values (∆C T = C T 

MMP9 - C T 18S) were calculated for each dilution point shown in A and plotted against 

log input amount of cDNA. The absolute value of the slope was calculated by linear 

regression and shown to be less than 0.1, thereby confirming that PCR assays for 

MMP9 and 18S have equal efficiencies and validating the use of the ∆∆C T method of 

analysis (see text). Error bars represent standard deviation; n = 3 PCR replicates. 

2.3. Experimental Considerations 

2.3.1. Assay Design 

When beginning a real-time PCR experiment, a significant part of user input 

is directed towards assay design. In addition to the usual pair of PCR primers, 

TaqMan assays require a sequence-specific fluorescently labeled probe, which 

is flanked by the primers. The primers and probe should be contained within a 

target amplicon of 150 bp, preferably straddling an exon–exon junction. The 

melting temperatures (Tm) of the two primers should be within 1°C of each 

other and between 58 and 60°C. The Tm of the TaqMan probe should be 10°C 

greater than that of the primers. Primer and probe selection requires detailed 

sequence analysis using specialist software such as Applied Biosystems’ proprietary 

design package, Primer Express (14), or MIT’s free design program, 

Primer3 (www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). Following 

design and synthesis, primer and probe concentrations are optimized and 

amplification efficiencies determined (see below) prior to use. As alternatives to 

in-house primer and probe design, sequences designed and published by others 

or the increasingly commercially available preoptimized assays can be used,


such as Applied Biosystems’ off-the-shelf TaqMan Gene Expression Assays (15) 

or their personalized Custom TaqMan Gene Expression Assays (16). A catalog 

of available TaqMan Gene Expression Assays can be found at www.allgenes. 

com. It is important to note that whatever the source of the assay to be used, it is 

imperative to consider in detail the mRNA being targeted. Many genes are subject 

to complex alternative splicing, and the specificity of real-time PCR is such 

that only the specified target sequence will be detected. For example, if the assay 

is designed over an alternative splice junction, only this splice variant will be 

detected. 

2.3.2. Tissue Collection and Storage for mRNA Quantification 

Procedures for tissue collection and storage can easily be overlooked when 

beginning a real-time PCR project. At the time of collection, priority is not necessarily 

given to immediate tissue storage. However, if samples are destined for 

mRNA analysis, measures to protect the sample need to be considered, as RNA 

is both thermolabile and susceptible to rapid degradation by endoribonucleases 

(RNases). In vivo, RNA degradation can also be influenced by its sequence, 

especially in the 3'-untranslated region, and many transcripts, particularly cytokines 

and other signaling molecules, contain sequences specifically designed to 

enhance degradation (17). As illustrated in Fig. 3, mRNAs degrade rapidly in 

excised tissue held at room temperature due primarily to the breakdown of intracellular 

compartmentalization and the release of ribonucleases. Moreover, different 

transcripts degrade at differing rates, making their relative quantification 

inaccurate. It is therefore essential to establish the degradation rate of the target 

genes if analysis is to be attempted on partially degraded material (18). Wherever 

possible, protection and correct storage of tissue should occur immediately 

after collection. This can best be achieved by snap freezing the sample in liquid 

nitrogen. Where this is not possible, tissue can be placed in a suitable protective 

solution such as RNAlater (Ambion, Crawley, UK). Note, however, that for this 

method to be successful, the sample size must be small enough to enable adequate 

diffusion of the protective solution through the sample. 

2.3.4. RNA Preparation 

RNA isolation using off-the-shelf extraction kits, such as the RNeasy kit (Qiagen, 

Crawley, UK) and the RNAqueous kit (Ambion, Huntingdon, UK) is convenient, 

rapid, and obviates the need for phenol. Samples are disrupted and homogenized 

in a buffer containing guanidinium salts, which simultaneously lyses cells and 

inactivates endogenous RNases. Ethanol is added to the lysate and the solution 

passed through a silica-based filter to which RNA binds while other cellular components 

pass through. Finally, the filter is washed to remove contaminants, and 

the RNA is eluted.


Fig. 3. Effect of time at room temperature on RNA degradation in cardiac tissue. 

Samples of left ventricular myocardium were left at room temperature for the times 

shown prior to RNA extraction. 300 ng of RNA was used in a 30-µL reverse transcription 

(RT) reaction, and the cDNA equivalent of 4 ng of RNA was analyzed by realtime 

PCR for RGS3, Giα2 (49), TnIc (see Table 4), GAPDH and 18S rRNA (cat. nos. 

402869 and 4310893E, respectively, Applied Biosystems, Warrington, UK). Note the 

stability of the 18S rRNA target in intact tissue. Error bars = standard deviation. 

RNA recovery using filter-based protocols is determined by the RNA-binding 

capacity of the filter and is thus influenced by the amount of starting material. 

When working with endomyocardial biopsies (typically ranging in size from 0.3 

to 20 mg), it is unlikely that the capacity of the filter will be exceeded. However, 

using standard manufacturers’ protocols we found varying levels of protein contamination, 

DNA co-purification, and RNA yield. The choice of disruption and 

homogenization technique is an important factor (Tables 2 and 3). In our hands 

the most efficient disruption and homogenization protocol for endomyocardial 

biopsies is sample disruption in lysis buffer in a 1.5-mL microtube using a disposable 

fitted pestle (cat. no. 749520-0090; Anachem, Luton, UK), followed by 

homogenization in a 2.0-mL microtube using a hand-held Ultra Turrax T8 homogenizer 

with a 5-mm probe (cat. nos. 406/0319/00 and 406/0319/10, respectively; 

VWR International, Lutterworth, UK) and further homogenization using 

Qiagen’s QiaShredder (cat. no. 79654; Qiagen, Crawley, UK). Contaminating 

protein and DNA can be removed by including proteinase K and DNase I (e.g., 

Qiagen’s RNase-free DNase set, cat. no. 79254; Qiagen, Crawley, UK) treat-


Table 2 

Comparison of RNA Yield From Biopsy-Sized Myocardium 

Samples Using Different Extraction Techniques 

Average RNA yield (ng) 

Homogenization technique per 1.0 mg tissue ± SD n 

Electric homogenizer + QiaShredder 327.1 ± 194.8 8 

Electric homogenizer only 173.6 ± 40.3 4 

QiaShredder only 229.9 ± 81.6 3 

Table 3 

Comparison of RNA Quality From Myocardium and Myocyte 

Cell Culture Samples Using Different Extraction Techniques 

Homogenization Proteinase K Mean sample purity 

Tissue source technique treatment (A 260/A 280) ± SD n 

Rat myocardium Electric homogenizer + Yes 1.95 ± 0.05 4 

(biopsy-sized sample) QiaShredder 

Electric homogenizer only Yes 1.93 ± 0.08 4 

QiaShredder only Yes 1.87 ± 0.05 4 

Cultured neonatal rat QiaShredder only No 1.37 ± 0.06 12 

cardiomyocytes 

ment steps. The beneficial effect of proteinase K incubation on resulting RNA 

purity is shown in Table 3. DNase I treatment is included because reliable RNA 

quantification is essential, in samples prepared using commercial filter columns, 

DNA can account for up to 50% of the purified nucleic acid (6). 

2.3.5. RNA Quantification 

Reliable RNA quantification is important for real-time PCR because it enables 

equal and appropriate loading of both RT and PCR reactions, thereby generating 

predictable and reproducible measurements of internal control levels. The most 

common method of measuring RNA concentration is ultraviolet (UV) absorption 

spectroscopy. While this method is quick and simple to perform, it is comparatively 

insensitive, with minimum nucleic acid concentrations of 1 µg/mL 

typically required to obtain reliable measurements. Ethidium-bromide-based protocols 

are more sensitive than UV absorption spectroscopy and are also routinely 

used to measure RNA concentration, but a superior alternative is to use Ribo- 

Green RNA quantification reagent (cat. no. R11490; Molecular Probes Europe 

BV, Leiden, The Netherlands). RiboGreen is a RNA-binding dye that exceeds


the sensitivity of ethidium-bromide-based assays and UV absorbance spectrophotometry 

by 200- and 1000-fold, respectively (19). The excitation and emission 

maxima for RiboGreen reagent bound to RNA are approx 500 and 525 nm, 

respectively. Conventionally, RiboGreen reagent is used with a fluorescence 

microplate reader, standard spectrofluorometer, or filter fluorometer. However, 

the reagent may also be used on any real-time PCR instrument by selecting the 

SYBR dye layer (SYBR Green I: excitation maximum = 497 nm, emission maximum 

= 521 nm), an important caveat being that other dye options (e.g., TAMRA 

and ROX) have been deselected. While the RiboGreen commercial protocol 

advocates the use of a high-range (20 ng/mL to 1 µg/mL) and a low-range (1–50 

ng/mL) assay for sample quantification, we find the assay to be linear between 

10 and 500 ng/mL when performed on an ABI Prism 7700 in a 200-µL reaction 

volume with RiboGreen reagent at a final dilution of 1 in 400 (Fig. 4). 

High-quality RNA extraction and strict quantification give consistently reproducible 

real-time data. Moreover, using accurately quantified input RNA, predictable 

internal control measurements can be seen, thereby allowing problematic 

RNAs to be readily identified. For example, Fig. 5 shows the 18S rRNA levels 

measured using real-time PCR in cDNA samples prepared from 86 human left 

ventricular myocardial samples ranging in size from less than 1 mg to more than 

90 mg. C T values for 18S rRNA are tightly clustered, and a single sample is 

visible as an outlier indicating a degraded or otherwise unreliable sample. 

2.3.6. Reverse Transcriptase Reaction 

Reverse transcription (RT) of RNA is necessary because RNA cannot act as a 

template for PCR. The RT reaction may be carried out immediately before the 

PCR in the same tube (using either one or two enzymes) or as a separate reaction. 

Single-tube RT-PCR is reportedly less sensitive than two-tube RT-PCR (6) and 

also requires that samples be stored as RNA. In contrast, two-tube RT-PCR generates 

a stock of stable cDNA that is more suitable for long-term storage. 

When performing two-tube RT-PCR, deciding which type of primer to use for 

initiating reverse transcription is important. Random hexamers, gene-specific, 

and oligo dT primers are all suitable options, but as yet there is no broad agreement 

as to which is the most efficient or sensitive (7,20,21). Indeed, first-strand 

cDNA can be synthesized in the absence of exogenous primers, most likely 

owing to self-priming events. In a two-tube RT-PCR reaction, gene-specific 

primers confine analysis to the single gene specified by the initial RT primer. In 

contrast, using random hexamers, oligo dT, or a combination of the two, as primers 

will allow amplification of the whole mRNA population. Note, however, that 

ribosomal RNA transcripts (e.g., 18S), often used as normalizing internal standards, 

will not be represented in oligo-dT-primed cDNA since they lack a poly- 

A tail. In this case the use of random hexamers is recommended.

315 

Fig. 4. Quantification of RNA using RiboGreen. Two independent dilution series (three- and twofold) were prepared from total 

RNA with RNA-grade TE buffer (pH 7.5) and combined to form a single set of quantity standards. The manufacturer’s RiboGreen 

high-range assay protocol (Molecular Probes Europe BV, Leiden, The Netherlands) was followed and fluorescence measured on 

the ABI Prism 7700. Plotting the mean fluorescence against RNA standard concentration shows the RiboGreen assay to be linear 

between 10 and 500 ng/mL. An expansion of the lower portion of the graph is inset. Error bars = standard deviation; n = 3. 

Real-Time PCR 315


Fig. 5. Determination of 18S rRNA abundance by real-time PCR. Total RNA was 

extracted from human ventricular myocardial samples and quantified using the protocols 

described (see text). Myocardial sample sizes were 25.44 mg ± 20.37 mg, range 

1–90 mg. RNA yield was 538 ± 362 ng/mg tissue. RT reactions were accurately loaded 

with either 60 or 300 ng RNA, depending on sample yields. Resulting cDNAs were 

diluted to the equivalent of 2 ng of RNA per µL and a total of 5 ng used in a 25-µL 

PCR with primers and TaqMan probe for 18S rRNA. Mean 18S C T was 13.78 ± 1.96. 

Note the outlying data point is readily identified. 

2.3.7. Choice of Quantification Strategy 

There are two basic approaches to the quantification of mRNA transcript levels 

using real-time PCR: absolute quantification, in which the precise number of 

mRNAs per cell, unit of RNA, or unit of tissue is determined, and relative quantification, 

where mRNA abundance is calculated relative to a calibrator sample 

or control group. 

2.3.7.1. ABSOLUTE QUANTIFICATION 

Absolute quantification requires the preparation of a set of quantity standards 

for which the number of copies of target sequence per unit of sample is accurately 

known for each dilution point. To compensate for variation introduced 

during the RT step, the standard curve may be prepared from RNA copies of the 

target amplicon sequence. These may be generated by in vitro transcription of 

the amplicon (2,5,22,23) or by purchasing custom synthesized RNA oligonucleotides 

(24). In practice, many authors use standard curves derived from dilution 

of a DNA copy of the target amplicon and have shown them to be an acceptable 

alternative (5,22). However, although this may be a quick and convenient way of 

deriving an accurate correlation between C T and DNA abundance, it may not


correlate directly with mRNA abundance, as the efficiency of mRNA to cDNA 

conversion during the RT reaction will be unknown. 

2.3.7.2. RELATIVE QUANTIFICATION 

In many cases absolute quantification is not required and relative quantification 

of mRNA can be used. There are several methods of relative quantification, 

including the use of standard curves, but one of the most frequently used is the 

comparative C T method. Here, expression of the abundance of a target mRNA in 

a test sample is normalized to an internal standard (often 18S rRNA) and related 

to the expression level in a control sample (e.g., normal donor myocardium). 

The difference between the C T value of the target mRNA and that of the internal 

standard is represented as C T (target mRNA) – C T (internal standard) = ∆C T. The 

expression of the target gene in the test sample relative to the control sample is 

therefore given as ∆C T (test) – ∆C T (control) = ∆∆C T . * Where the efficiency of 

PCR is close to 100% (i.e., close to a doubling of product per cycle), the relative 

abundance of the target RNA between the two samples becomes 2 –∆CT . The 

advantage of the comparative C T method is that standard curves do not need to be 

constructed, allowing more samples to be analyzed per plate, saving time and 

money. However, it should be noted that for this form of comparative analysis, 

the PCR amplification efficiencies for both the target gene and the internal standard 

need to be equal. The PCR efficiency must be demonstrated for each assay 

and is assessed by observing how C T varies with template dilution (Fig. 2A). 

When efficiencies for each PCR are equal, the ∆C T value will be the same no 

matter the dilution (see Fig. 2B). Specifically, Applied Biosystems stipulate that 

the comparative C T method can only be reliably used when the gradient of the 

∆C T plot is less than 0.1 (25). In the event that equal PCR efficiencies cannot be 

demonstrated, new primers may need to be designed to improve efficiency, quantification 

performed using the relative standard curve method, or a refined comparative 

C T calculation used. In recognition of the difficulties encountered with 

unequal efficiencies, new strategies have been developed where the actual efficiencies 

of PCR amplifications are included in the quantification calculation (26– 

31). In addition to minimizing assay optimization and validation, the advantage 

of such strategies is that they do not assume 100% PCR efficiency. Furthermore, 

some strategies estimate PCR efficiency for each reaction from the actual data 

used to create the amplification plot rather than an external standard curve (26– 

* The amount of target mRNA recorded at any time during a PCR is influenced by the amount 

of target mRNA at the start of PCR, the efficiency of PCR, and by the number of PCR cycles 

performed. This is described by the equation: X n = X 0 x (1 + E X) n , where X n is the amount of target 

mRNA at cycle n, X 0 is the initial amount of target mRNA, E X is the efficiency of target amplification, 

and n is the number of cycles performed. The comparative C T method expands this equation 

to give the formula: 2 –∆Ct (see Applied Biosystem’s User Bulletin no. 2 [25]).


28). Such strategies do not assume that the PCR efficiencies of the standard curve 

and of the cDNA samples are identical. Neither do they assume that individual 

cDNA samples will have similar PCR efficiencies and can therefore be represented 

with a single efficiency value. Instead, analysis is based entirely upon the 

kinetics of the experimental samples. 

2.3.8. Choice of Internal Control for Normalization 

The importance of choosing a suitable internal control for normalization of 

the target mRNA cannot be overstated, and some researchers advocate the use of 

a minimum of three and up to five independent internal controls (32,33). Most 

importantly, expression of the internal control must be unaffected by the variable 

being investigated. This cannot be assumed and should always be established 

empirically (5,32–34). A list of useful standard internal control RNAs is given in 

Table 4. For analysis using tissue extracts, it is also important to consider potential 

bias resulting from differences in the cellular origins of target and internal 

control transcripts. For example, in the case of 18S rRNA, all cells present in the 

sample under investigation will contribute to the resulting signal, whereas a celltype 

specific transcript will not. When cardiac myocyte gene expression is being 

analyzed in endomyocardial biopsies where the proportion of different cell types 

may vary between samples, it may be more appropriate to use a cell-specific 

internal standard such as myocyte-specific cardiac troponin I (35). 

It is possible to measure both the target gene of interest and the internal control 

simultaneously in the same reaction by color coding the independent reactions 

using TaqMan probes labeled with different fluorescent dyes (36). Multiplexing 

reactions in this way not only prevents errors introduced by repeated 

pipetting, but also minimizes the amount of samples, time, and reagents needed 

to complete the study. The disadvantage of multiplexing assays is an increase 

in the initial time required to optimize both PCRs together and ensure that neither 

reaction predominates. 

3. Real-Time PCR and Allelic Discrimination 

3.1. Overview 

Since the completion of the Human Genome Project, much attention has been 

focused on genetic variation. The simplest type of genetic variant is the SNP, 

where one nucleotide is substituted for another. Approximately 3 million SNPs 

have already been cataloged in the National Institutes of Health SNP database 

(http://www.ncbi.nlm.nih.gov/SNP). SNPs causing changes in promoter regions 

or in amino acid coding sequences have been identified in many genes and are a 

logical starting point when considering the impact of genetic variation between 

individuals, as they may affect gene regulation, protein structure, and/or function.

319 

Table 4 

Common Internal Controls Used in Real-Time PCR 

Abundance across 

Name Symbol Function a general tissue panel Comment 

18S ribosomal RNA 18S Facilitates ribosome Very high Reported pseudogenes 

assembly 

β-Actin ACTB Cytoskeletal protein High/moderate a Reported pseudogenes 

Glyceraldehyde-3-phosphate GAPDH Carbohydrate metabolism High a Reported pseudogenes 

dehydrogenase 

β 2-Microglobulin B2M β-Chain of major histo- High/moderate a 

compatibility complex 

class I molecules 

Hypoxanthine phosphoribosyl- HRPT Purine metabolism Low/undetectable a Reported pseudogenes 

transferase-1 

Acidic ribosomal PO Component of 60S subunit High b Reported pseudogenes 

phosphoprotein of the ribosome and splice variants 

Cardiac troponin I TnIc Regulatory subunit Cardiac myocyte Forward: 5' tcctccaactaccgcgctta 

of the cardiac contractile specific Reverse: 5' ctcgctccagctcttgcttt 

apparatus Probe: 5' agcagagtcttcagctgcaattttctcgag 

a From ref. 50. 

b From GeneCards at http://bioinformatics.weizmann.ac.il/cards/. 

Real-Time PCR 319


Fig. 6. Steps involved in carrying out a single-nucleotide polymorphism association 

study in cardiac transplantation. 

In transplantation, several pathways exist where recipient or donor organ 

SNPs (or genotype) might affect the clinical outcome. SNP association may 

therefore provide valuable information on the prediction of complications after 

transplantation. Several studies to date have examined associations between 

SNPs in genes encoding immunological proteins as potential determinants of 

acute and chronic rejection. Other pathways relevant to cardiac transplantation 

include those involved in immunosuppressant and lipid metabolism and susceptibility 

to infection. A number of recent studies are summarized in Table 5. 

The attraction of SNP association studies in transplantation compared to nontransplant 

chronic diseases includes shorter time to the occurrence of clinical 

events, regular clinical assessments, and the study of both recipient and donor 

genotypes. In studying recipient genotypes, the systemic effect of a particular 

SNP is being examined, whereas when studying their donor’s genotype, the local 

effect is being examined. A significant limitation of SNP association studies in 

cardiac transplantation, however, is the small group size at a single center, which, 

in addition to reduction of statistical power, makes the study of rare SNPs impossible 

(see Table 5 for typical sample sizes). Figure 6 outlines the steps involved 

in conducting an SNP association study in cardiac transplantation.

321 

Table 5 

Examples of Single-Nucleotide Polymorphism Association Studies in Cardiac Transplantation 

SNPs 

Topic examined Pathway Total number Association Reference 

Acute rejection IL-10 IL-10 is an 70 recipients No association 51 

G-1082A immunomodulator 61 donors 

G-819T 

C-592A 

TNF-α 90 recipients TGF-β coding SNPs 52 

TGF-β associated with time to first 

IL-10 rejection 

IL-6 

IFN-γ 

Transplant coronary IL-10 IL-10: anti-inflam- 148 recipients, No association 53 

artery disease IL-1082 matory cytokine 135 donors 

IL -819 

IL-592 

IL-1B, IL-1R1, 

IL-1RN, I-L6, 179 recipients IL-1R1 SNP associated with 54 

IL-10, TNF-α, long-term graft survival 

TGF-β1, and 

FCGRIIA 


(Continued on next page)

322 

Table 5 (Continued) 

Examples of Single-Nucleotide Polymorphism Association Studies in Cardiac Transplantation 

SNPs 

Topic examined Pathway Total number Association Reference 

Transplant coronary β-Fibrinogen Pathways involved 53 recipients, Donor PAI-1 and factor XIII 55 

artery disease Factor V in hemostatis 53 donors SNPs associated with 

(continued) Prothrombin development of transplant 

Factor XIII coronary artery disease 

PAI-1 

GPIIIa 

GPI a 

GPIbα 

Pharmacokinetics MDR1 Calcineurin 63 pediatric MDR1 C3435T TT and 56 

C3435T and inhibitor uptake recipients G2677T TT associated with 

G2677T and metabolism lower tacrolimus dose 

CYP 3A5 requirements to achieve 

desired concentrations 

Hyperlipidemia Apo-A-I Apolipoprotein is 103 recipients Subjects possessing the 57 

promoter a component of A allele have higher 

polymorphism high-density triglyceride and LDL 

lipoprotein cholesterol levels 

322 Felkin et al.


3.2. Real-Time PCR and Genotyping 

Real-time PCR can be used to study SNPs by providing a useful method of 

genotyping. The method is based on the same overall principles described above 

but makes use of the ability to discriminate between the two alleles by use of 

two differently labeled probes. Primers flanking the polymorphic site and probes 

complementary to each of the two alleles, each with a unique reporter dye of 

different fluorescent wavelength, are designed. Typically, the reporter dyes FAM 

(518 nm) and VIC (525 nm) are used. In the PCR reaction, the probes hybridize 

preferentially to their complementary alleles so that fluorescence is only generated 

where perfect nucleotide matching has occurred. Wild-type homozygous 

DNA therefore produces one fluorescent wavelength, whereas mutant homozygous 

produces the other. DNA containing both alleles (heterozygous) produces 

emission of both fluorescent wavelengths. Fluorescence at the two wavelengths 

is detected by the integral fluorometer, in this case, the Sequence Detection System 

(SDS) of the ABI Prism 7700, which also dampens background signals and 

inequalities due to variations in initial DNA concentrations. Most systems can 

also be set up to perform autocalling of genotype by comparison with the spectral 

fluorescent emissions of control standards of known genotype (see Fig. 7). 

Genotypes may also be ascribed by hand by examining the raw spectral data. 

Using the ABI Prism 7700, it is possible to genotype between 84 and 96 individuals 

(using autocalling and manual methods, respectively) for one SNP in 2.5 

h, making this a medium throughput genotyping method. The ABI Prism 

7900HT has a 384-well block, so throughput can be four times higher. 

3.3. Experimental Considerations 

3.3.1. Assay Design 

The usefulness of real-time PCR and TaqMan chemistry in genotyping is 

largely dictated by the sequence of the gene concerned. Unlike mRNA quantification, 

in which the position of TaqMan probe and flanking primers is largely at 

the discretion of the operator, for genotyping the position of the TaqMan probe 

is fixed by the SNP under study. In some cases it can prove difficult to design 

suitable probes. For optimal assay performance, primers and probes must be 

designed according to strict criteria. In particular, Applied Biosystems stipulate 

that the probe should contain the SNP in its middle third, be less than 20 nucleotides 

long, and have a salt-adjusted melting temperature (Tm) of 65–67°C. 

Where this proves difficult, for example, if the SNP of interest lies in an ATrich 

region, TaqMan minor groove binder (MGB) probes may be used (cat. no. 

4316034, Applied Biosystems, Warrington, UK). Conjugation of an MGB complex 

to an oligonucleotide dramatically increases its Tm by stabilizing the 

nucleic acid duplex (37–39). Attaching an MGB to a TaqMan probe therefore


Fig. 7. Autocalling of AMPD-1 C34T genotypes. In the upper panel, individuals 

are sorted according to fluorescence characterisation as 1, 2, and 1/2. Each dot represents 

a single result. The lower panel gives details of each individual sample. In this 

example, allele 1 refers to the AMPD-1 C34T C allele and allele 2 to the T allele. 

Control DNA was placed in row H of the plate (No Amp refers to no-template controls) 

and DNA of unknown genotype in rows A–G. 1, CC homozygotes; 1/2, CT 

heterozygotes; 2, TT homozygotes. 

means that shorter sequences (13- to 20-mers) can be used to obtain probes with 

an optimal Tm. Because single-nucleotide mismatches become more disruptive 

as probe length decreases, the opportunity to minimize probe length is particularly 

valuable in SNP analysis. Primers flanking the polymorphic site that create 

an amplicon ideally between 80 and 200 bp long are designed according to 

the criteria outlined by Applied Biosystems (40). Assay optimization is then 

performed in order to determine the primer and probe concentrations at which 

allelic discrimination is clearest. 

As with mRNA detection assays, designing and optimizing probe and primer 

sets is often the most time-consuming part of any real-time PCR genotyping 

project. Off-the-shelf assays, such as Applied Biosystems’ TaqMan SNP genotyping 

assays (41) or personalized products like Custom TaqMan SNP Genotyping 

Assays (42), can remove or substantially reduce the time spent on design. 

To search available TaqMan SNP genotyping assays visit www.allsnps.com.


3.3.2. Sources of DNA and Optimization 

DNA for use in genotyping can be isolated from a variety of sources, including 

whole blood or spleen (often the case for donor DNA) using standard extraction 

methods and stored until use at –20°C in deionized, sterile water. In the 

setting of transplantation, DNA may be available for analysis as a byproduct of 

DNA-based routine tissue typing. DNA may also be isolated from stored myocardial 

samples (43). Each genotyping reaction requires in the region of 0.01– 

0.1 µg of DNA. 

The first step of a genotyping project is to identify DNA samples representing 

each of the genotypes being analyzed (i.e., AA, AB, and BB genotype). 

These will serve both as control templates for PCR optimization and as reference 

standards during subsequent analysis. Identifying DNA samples representing 

the three genotypes may have to be done by screening a large range of 

DNA samples essentially at random. Where the polymorphism is relatively 

frequent, as in the case of adenosine monophosphate deaminase (AMPD)-1 

(described later), an initial screen of 1–200 DNA samples should reveal all 

genotypes. Alternatively, artificial target sequences can be synthesized and 

diluted appropriately for use. Once samples of all three genotypes have been 

detected, these can be included as controls against which the SDS software 

compares emissions from wells of unknown sample type and so ascribes the 

correct genotype. This feature is known as autocalling, and because 12 wells 

are required for samples of known genotype (3 for each of both homozygous 

genotypes, 3 for heterozygous genotypes, and 3 no-template controls), the 

genotypes of only 84 samples can be determined per 96-well plate. 

3.4. AMPD-1 Genotyping Using Real-Time PCR 

Because of its likely role in cardioprotection (44,45), we have examined the 

C34T SNP (Gln12STOP) of (AMPD-1) in 392 cardiac transplant recipients, 

377 of their donors, and 294 unrelated Caucasian controls using a real-time 

PCR-based allelic discrimination assay (46). The method used for this and other 

similar projects, outlined in Fig. 6, included confirmation of genotype by 

single-stranded conformational polymorphism (SSCP) analysis in 10% of 

samples. All results were concordant between the two methods. Previous studies 

showed that approx 21% of Caucasians carry the C34T T allele, and heart 

failure patients possessing this allele have been shown to survive longer without 

need for transplantation (mean 7.6 vs 3.2 yr; p < 0.001) (44). Carriers of the 

C34T T allele have substantially reduced cardiac AMPD activity (47), which 

through increasing adenosine may contribute to cardioprotection. We found an 

association between possession of the C34T T allele in cardiac donors with 

reduced pre-donation inotrope requirements (48) suggesting a cardioprotective 

effect in the setting of donor organ function.


4. Conclusion 

Since the launch of the original chemistry and instrumentation, quantitative 

real-time RT-PCR has become commonplace in laboratories worldwide, and 

its popularity has ensured the development of a large variety of chemistries 

and instruments to suit every budget and throughput requirement. The exceptional 

accuracy and sensitivity easily achievable with real-time PCR make it 

the method of choice for mRNA quantification, especially from limited tissue 

samples. When beginning a real-time RT-PCR project, it is important to remember 

that the technique is based entirely on the assumption that the amount of 

cDNA amplified and detected is an accurate reflection of the corresponding 

mRNA levels in the starting material and thus to consider how each aspect of 

the protocol may bias this assumption and consequently the conclusions. Genotyping 

using real-time PCR technology is also an accurate and useful method 

for single nucleotide polymorphism association studies in cardiac transplantation. 

Acknowledgments 

We thank Antony Mullen for his initial assistance in setting up real-time 

PCR and the Magdi Yacoub Institute, British Heart Foundation, and the Royal 

Brompton and Harefield NHS Trust for financial support. 

References 

1. Holland, P. M., Abramson, R. D., Watson, R., and Gelfand, D. H. (1991) Detection 

of specific polymerase chain reaction product by utilizing the 5'-3' nuclease 

actively of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. USA 88, 

7276–7280. 

2. Gibson, U. E. M., Heid, C. A., and Williams, P. M. (1996) A novel method for 

real time quantitative RT-PCR. Genome Res. 6, 995–1001. 

3. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996) Real time quantitative 

PCR. Genome Res. 6, 986–994. 

4. Livak, K. J., Flood, S. J., Marmaro, J., Giusti, W., and Deetz, K. (1995) Oligonucleotides 

with fluorescent dyes at opposite ends provide a quenched probe system 

useful for detecting PCR product and nucleic acid hybridization. PCR 

Methods Appl. 4, 357–362. 

5. Bustin, S. A. (2000) Absolute quantification of mRNA using real-time reverse 

transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169–193. 

6. Bustin, S. A. (2002) Quantification of mRNA using real-time reverse transcription 

PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29, 23–39. 

7. Ginzinger, D. G. (2002) Gene quantification using real-time quantitative PCR: an 

emerging technology hits the mainstream. Exp. Hematol. 30, 503–512. 

8. Brand, N. J. and Barton, P. J. R. (2002) Myocardial molecular biology: an introduction. 

Heart 87, 284–293.


9. Barton, P. J. R., Birks, E. J., Felkin, L. E., Cullen, M. E., Koban, M. U., and 

Yacoub, M. H. (2003) Increased expression of extracellular matrix regulators 

TIMP1 and MMP1 in deteriorating heart failure. J. Heart Lung Transplant. 22, 

738–744. 

10. De Souza, A. I., Felkin, L. E., Barton, P. J. R., Banner, N. R., and Rose, M. L. 

(2003) Sequential expression of three known protective genes in cardiac biopsies 

after transplantation.J. Heart Lung Transplant. 22(1), S163. 

11. Barton, P. J. R., Felkin, L. E., Koban, M. U., Cullen, M. E., Brand, N. J., and 

Dhoot, G. K. (2004) The slow skeletal muscle troponin T gene is expressed in 

developing and diseased human heart. Mol. Cell. Biochem. 263, 81–90. 

12. SYBR Green PCR Master Mix and RT-PCR. (2004) Applied Biosystems Protocol: 

Rev C Part 4310251C. 

13. Morrison, T. B., Weis, J. J., and Wittwer, C. T. (1998) Quantification of low-copy 

transcripts by continuous SYBR Green I monitoring during amplification. 

BioTechniques 24, 954–958, 960, 962. 

14. Primer Express Software v1.5 Applications-based primer design software. (2004) 

Applied Biosystems User’s Manual: Rev D Part 4303014D. 

15. TaqMan Gene Expression Assays. (2004) Applied Biosystems Protocol Rev B 

4333458B. 

16. Assays-by-Design service for gene expression assays. (2004) Applied Biosystems 

Protocol Part 4334429C. 

17. van Hoof, A. and Parker, R. (2003) Messenger RNA degradation: beginning at 

the end. Curr. Biol. 12, R285–R287. 

18. Tong, D., Schneeberger, C., Leodolter, S., and Zeillinger, R. (1997) Quantitative 

determination of gene expression by competitive reverse transcription-polymerase 

chain reaction in degraded RNA samples. Anal. Biochem. 251, 173–177. 

19. Jones, L. J., Yue, S. T., Cheung, C. Y., and Singer, V. L. (1998) RNA quantitation 

by fluorescence-based solution assay: RiboGreen reagent characterization. Anal. 

Biochem. 265, 368–374. 

20. Stahlberg, A., Hakansson, J., Xian, X., Semb, H., and Kubista, M. (2004) Properties 

of the reverse transcription reaction in mRNA quantification. Clin. Chem. 

50(3), 509–515. 

21. Deprez, R. H. L., Fijnvandraat, A. C., Ruijter, J. M., and Moorman, A. F. M. 

(2002) Sensitivity and accuracy of quantitative real-time polymerase chain reaction 

using SYBR green I depends on cDNA synthesis conditions. Anal. Biochem. 

307, 63–69. 

22. Pfaffl, M. W. and Hageleit, M. (2001) Validities of mRNA quantification using 

recombinant RNA and recombinant DNA external calibration curves in real-time 

RT-PCR. Biotechnol. Lett. 23, 275–282. 

23. Depre, C., Shipley, G. L., Chen, W., et al. (1998) Unloaded heart in vivo replicates 

fetal gene expression of cardiac hypertrophy. Nat. Med. 4, 1269–1275. 

24. Uray, I. P., Connelly, J. H., Thomazy, V., et al. (2002) Left ventricular unloading 

alters receptor tyrosine kinase expression in the failing human heart. J. Heart 

Lung Transplant. 21, 771–782.


25. Relative quantitation of gene expression: ABI PRISM 7700 Sequence detection 

system. (1997) Applied Biosystems User Bulletin #2: Rev B Part 4304859B, pp. 

1–36. 

26. Peirson, S. N., Butler, J. N., and Foster, R. G. (2003) Experimental validation of 

novel and conventional approaches to quantitative real-time PCR data analysis. 

Nucleic Acids Res. 31, e73. 

27. Ramakers, C., Ruijter, J. M., Deprez, R. H. L., and Moorman, A. F. M. (2003) 

Assumption-free analysis of quantitative real-time polymerase chain reaction 

(PCR) data. Neurosci. Lett. 339, 62–66. 

28. Liu, W. and Saint, D. A. (2002) A new quantitative method of real time reverse 

transcription polymerase chain reaction assay based on simulation of polymerase 

chain reaction kinetics. Anal. Biochem. 302, 52–59. 

29. Liu, W. and Saint, D. A. (2002) Validation of a quantitative method for real time 

PCR kinetics. Biochem. Biophys. Res. Commun. 294, 347–353. 

30. Pfaffl, M. W., Horgan, G. W., and Dempfle, L. (2002) Relative expression software 

tool (REST) for group-wise comparison and statistical analysis of relative 

expression results in real-time PCR. Nucleic Acids Res. 30, e36. 

31. Pfaffl, M. W. (2001) A new mathematical model for relative quantification in 

real-time RT-PCR. Nucleic Acids Res. 29, e45. 

32. Vandesompele, J., De Preter, K., Pattyn, F., et al. (2002) Accurate normalization 

of real-time quantitative RT-PCR data by geometric averaging of multiple internal 

control genes. Genome Biol. 3, 1–2. 

33. Pfaffl, M. W., Tichopad, A., Prgomet, C., and Neuvians, T. P. (2004) Determination 

of stable housekeeping genes, differentially regulated target genes and sample 

integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. 

Lett. 26, 509–515. 

34. Livak, K. J. and Schmittgen, T. D. (2001) Analysis of relative gene expression 

data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 

25, 402–408. 

35. Razeghi, P., Young, M. E., Cockrill, T. C., Frazier, O. H., and Taegtmeyer, H. 

(2002) Downregulation of myocardial myocyte enhancer factor 2C and myocyte 

enhancer factor 2C-regulated gene expression in diabetic patients with nonischemic 

heart failure. Circulation 106, 407–411. 

36. Multiple PCR with TaqMan VIC probes: ABI PRISM 7700 sequence detection 

system. Applied Biosystems User Bulletin 5: Rev B Part 4306236B, 2004. 

37. Afonina, I. A., Reed, M. W., Lusby, E., Shishkina, I. G., and Belousov, Y. S. 

(2002) Minor groove binder-conjugated DNA probes for quantitative DNA detection 

by hybridization-triggered fluorescence. BioTechniques 32, 940–949. 

38. Afonina, I., Zivarts, M., Kutyavin, I., Lukhtanov, E., Gamper, H., and Meyer, R. 

B. (1997) Efficient priming of PCR with short oligonucleotides conjugated to a 

minor groove binder. Nucleic Acids Res. 25, 2657–2660. 

39. Kutyavin, I. V., Lukhtanov, E. A., Gamper, H. B., and Meyer, R. B. (1997) Oligonucleotides 

with conjugated dihydropyrroloindole tripeptides: base composition 

and backbone effects on hybridization. Nucleic Acids Res. 25, 3718-3723.


40. Primer express v 1.5 and TaqMan MGB probes for allelic discrimination: All PCR 

instruments. (2000) Applied Biosystems User Bulletin Part 4317594A, pp. 1–28. 

41. Assays-on-Demand SNP genotyping products. (2004) Applied Biosystems Protocol 

Rev A Part 4332856A. 

42. Assays-by-Design Service for SNP Assays. (2004) Applied Biosystems Protocol 

Rev C Part 4334431C. 

43. Cunningham, D. A., Crisp, S. J., Barbir, M., Lazem, F., Dunn, M. J., and Yacoub, 

M. H. (1998) Donor ACE gene polymorphism: A genetic risk factor for accelerated 

coronary sclerosis following cardiac transplantation. Eur. Heart J. 19, 319– 

325. 

44. Loh, E., Rebbeck, T. R., Mahoney, P. D., Denofrio, D., Swain, J. L., and Holmes, 

E. W. (1999) Common variant in AMPD1 gene predicts improved clinical outcome 

in patients with heart failure. Circulation 99, 1422–1425. 

45. Anderson, J. L., Habashi, J., Carlquist, J. F., et al. (2000) A common variant of the 

AMPD1 gene predicts improved cardiovascular survival in patients with coronary 

artery disease. J. Am. Coll. Cardiol. 36, 1248–1252. 

46. Taegtmeyer, A. B., Breen, J. B., Smith, J. D., et al. (2004) Increased incidence of 

acute rejection among cardiac transplant recipients possessing the Gln12STOP 

variant of AMPD-1. Am. J. Transplant. 4(8), 311. 

47. Kalsi, K. K., Yuen, A. H., Rybakowska, I. M., et al. (2003) Decreased cardiac 

activity of AMP deaminase in subjects with the AMPD1 mutation-A potential 

mechanism of protection in heart failure. Cardiovasc. Res. 59, 678–684. 

48. Taegtmeyer, A. B., Breen, J., Smith, J. D., Banner, N. R., Yacoub, M. H., and 

Barton, P. J. (2004) Increased frequency of adenosine monophosphate deaminase 

1 C34TT allele in cardiac donors is associated with reduced pre-donation inotrope. 

J. Heart Lung Transplant. 23(2), S89. 

49. Owen, V. J., Burton, P. B. J., Mullen, A. J., Birks, E. J., Barton, P. J. R., and 

Yacoub, M. H. (2001) Expression of RGS3, RGS4 and Gi alpha 2 in acutely failing 

donor hearts and end-stage heart failure. Eur. Heart J. 22, 1015–1020. 

50. Radonic, A., Thulke, S., Mackay, I. M., Landt, O., Siegert, W., and Nitsche, A. 

(2004) Guideline to reference gene selection for quantitative real-time PCR. 

Biochem. Biophys. Res. Commun. 313, 856–862. 

51. Bijlsma, F. J., Bruggink, A. H., Hartman, M., et al. (2001) No association between 

IL-10 promoter gene polymorphism and heart failure or rejection following cardiac 

transplantation. Tissue Antigens 57, 151–153. 

52. Gourley, I. S., Denofrio, D., Rand, W., Desai, S., Loh, E., and Kamoun, M. (2004) 

The effect of recipient cytokine gene polymorphism on cardiac transplant outcome. 

Hum. Immunol. 65, 248–254. 

53. Densem, C. G., Hutchinson, I. V., Yonan, N., and Brooks, N. H. (2003) Influence 

of interleukin-10 polymorphism on the development of coronary vasculopathy 

following cardiac transplantation. Transplant. Immunol. 11, 223–228. 

54. Vamvakopoulos, J. E., Taylor, C. J., Green, C., et al. (2002) Interleukin 1 and 

chronic rejection: possible genetic links in human heart allografts. Am. J. Transplant. 

2, 76–83.


55. He, J. Q., Gaur, L. K., Stempien-Otero, A., et al. (2002) Genetic variants of the 

hemostatic system and development of transplant coronary artery disease. J. Heart 

Lung Transplant. 21, 629–636. 

56. Zheng, H., Webber, S., Zeevi, A., et al. (2003) Tacrolimus dosing in pediatric 

heart transplant patients is related to CYP3A5 and MDR1 gene polymorphisms. 


57. Gonzalez-Amieva, A., Lopez-Miranda, J., Marin, C., et al. (2003) The apo A-I 

gene promoter region polymorphism determines the severity of hyperlipidemia 

after heart transplantation. Clin. Transplant. 17, 56–62.

Organ Preservation 331 

15 

Organ Preservation 

Mark Hicks, Alfred Hing, Ling Gao, 

Jonathon Ryan, and Peter S. MacDonald 

Summary 

The success of organ transplantation is critically dependent on the quality of the donor 

organ. Donor organ quality, in turn, is determined by a variety of factors including donor 

age and preexisting disease, the mechanism of brain death, donor management prior to 

organ procurement, the duration of hypothermic storage, and the circumstances of 

reperfusion. It has been recognized for some time that both the short- and long-term 

outcomes after cadaveric organ transplantation are significantly inferior to those obtained 

when the transplanted organ is obtained from a living donor, regardless of whether the 

donor is related or unrelated to the recipient. Brain death results in a series of hemodynamic, 

neurohormonal, and pro-inflammatory perturbations, all of which are thought to 

contribute to donor organ dysfunction. The process of transplantation exposes the donor 

organ to an obligatory period of ischemia and reperfusion. Traditionally, hypothermic 

storage of the donor organ has been used to protect it from ischemic injury, but donor 

organs differ markedly in their capacity to withstand hypothermic ischemia. Data from 

the Registry of the International Society for Heart and Lung Transplantation indicate that 

the risk of primary graft failure and death rises dramatically for both the heart and lung as 

ischemic time increases. Based on these data, maximum recommended ischemic times 

for the donor heart and lung are 6 and 8 h, respectively. In this chapter, strategies aimed 

at minimizing the adverse consequences of brain death and ischemia/reperfusion injury 

to the donor heart and lung are discussed. These strategies are likely to become increasingly 

important as the reliance on marginal donors increases to meet the growing demand 

for organ transplantation. 

Key Words: Brain death; neurohormonal changes; intensive care; catecholamines; 

hormonal therapy; reperfusion therapy. 


The success of organ transplantation is critically dependent on the quality 

of the donor organ. Donor organ quality, in turn, is determined by a variety of 



331

332 Hicks et al. 

factors including donor age and preexisting disease, the mechanism of brain 

death, donor management prior to organ procurement, the duration of hypothermic 

storage, and the circumstances of reperfusion. As demand for solid 

organ transplantation has increased, so has the use of marginal donors (e.g., 

those obtained from older donors or from donors with evidence of chronic 

organ disease or dysfunction prior to brain death) (1). Thus, many cadaveric 

organs offered for transplantation have preexisting disease or dysfunction 

prior to the onset of brain death, and although results obtained with marginal 

doors are generally regarded as acceptable (at least in relation to the waiting 

list mortality), it is clear that both short- and long-term posttransplant outcomes 

are not as good when compared with organs obtained from conventional 

donors (2,3). Furthermore, although the use of marginal donors has led 

to an increase in the potential donor pool, it has also led to an increased 

discard rate of cadaveric organs offered for transplantation. For example, as 

reported by Rosendale et al. (1), “the discard rate of kidneys procured from 

the cadaver donor in USA has been increasing to an alarming level of more 

than 15% of those kidneys recovered for transplantation.” The discard rate 

for other organs is even higher. Approximately 25% of livers and 60% of 

hearts and lungs from cadaveric donors are not transplanted due to poor donor 

organ quality (4,5). 

Another factor that adversely affects donor organ quality is brain death. It 

has been recognized for some time that both the short- and long-term outcomes 

after cadaveric organ transplantation are significantly inferior to those 

obtained when the transplanted organ is obtained from a living donor whether 

the donor is related or unrelated to the recipient (6). Brain death results in a 

series of hemodynamic, neurohormonal, and pro-inflammatory perturbations, 

all of which are thought to contribute to donor organ dysfunction. 

Finally, the process of transplantation exposes the donor organ to an obligatory 

period of ischemia and reperfusion. Traditionally, hypothermic storage 

of the donor organ has been used to protect it from ischemic injury, but donor 

organs differ markedly in their capacity to withstand hypothermic ischemia. 

Data from the Registry of the International Society for Heart and Lung Transplantation 

indicate that the risk of primary graft failure and death rises dramatically 

for both the heart and lung as ischemic time increases (2,3). Based 

on these data, the maximum recommended ischemic times for the donor heart 

and lung are 6 and 8 h, respectively. 

In this chapter, strategies aimed at minimizing the adverse consequences of 

brain death and ischemia/reperfusion (I/R) injury to the donor heart and lung 

are discussed. These strategies are likely to become increasingly important as 

the reliance on marginal donors increases to meet the growing demand for 

organ transplantation.


2. Management of the Brain-Dead Donor 

2.1. The Hemodynamic, Neurohumoral, 

and Immunological Consequences of Brain Death 

2.1.1. Hemodynamic Changes 

Brain death is accompanied by a series of complex hemodynamic, neurohormonal, 

and immunological changes. The time course and severity of these 

changes may vary according to the tempo and nature of the neurological insult 

leading to brain death. The most severe changes are usually seen in the setting 

of acute onset of brain death (such as occurs with severe intracranial hemorrhage), 

which is associated typically with an acute and intense autonomic discharge, 

characterized by initial bradycardia (parasympathetic discharge) 

followed by extreme tachycardia and hypertension (sympathetic discharge). 

Potential donor organs suffer an ischemic insult during this phase—the heart 

as a result of a massive increase in workload (7) and the peripheral organs 

caused by intense peripheral vasoconstriction (8). This autonomic storm has its 

onset within the first few minutes and usually passes within 15 min. The autonomic 

storm is also characterized by a sudden increase in cytosolic calcium, 

which in turn activates enzymes such as lipase, protease, endonuclease, nitric 

oxide (NO) synthase, and xanthine oxidase (8). These enzymatic changes disrupt 

normal adenosyl triphosphate (ATP) utilization and generate oxygen-free 

radicals, which contribute to organ failure. Thereafter, there is a loss of sympathetic 

tone associated with persistent tachycardia and hypotension. The loss of 

autonomic tone also results in impaired vascular autoregulation with diminished 

blood supply and oxygen delivery to organs and tissues. Both initial and 

late circulatory changes can lead to severe ischemic damage in donor organs 

before their removal, causing deterioration of the quality of the transplanted 

graft. 

2.1.2. Neurohormonal Changes 

Although most investigators accept a link between brain death and disruption 

of the hypothalamic–pituitary axis, there are conflicting data regarding the 

hormonal changes that occur during and after central nervous system injury 

and their influence on hemodynamic parameters and organ quality (9–11). In 

animal models the hormonal changes fall into two categories: those associated 

with the autonomic storm represent a transient and massive increase in circulating 

catecholamines, and those associated with hypothalamic–pituitary failure 

lead to neurogenic diabetes insipidus and a marked decrease in levels of 

thyroid hormones and cortisol, at least in animal models (12,13). Metabolic 

abnormalities associated with these hormonal perturbations include impaired 

aerobic metabolism despite normal O 2 delivery. This has been demonstrated


both globally (14) and in specific organs including the heart (12) and kidney 

(15). The consequent reliance on anaerobic metabolism results in lactic acidosis 

(12,14,15) and rapid depletion of high-energy substrates such as ATP (12). 

Progressive depletion of high-energy stores has been reversed successfully by 

a combination of T3, cortisol, and insulin administration, suggesting that hormonal 

changes are the major cause of mitochondrial dysfunction with impaired 

energy production at the cellular level (16). 

Some investigators, however, have demonstrated only minor hormonal 

changes in humans after the onset of brain death (17,18). An extensive survey 

of studies on brain-dead human donors indicates that a reduction in the level of 

free triiodothyronine (T3) has almost always been documented, but changes in 

other hormone levels (such as thyroid-stimulating hormone, thyroxine [T4], and 

cortisol) are variable (17–21). Levels of reverse T3 have been found to be normal 

or increased after brain death, consistent with a “sick euthyroid” state. Differences 

between experimental and some clinical findings may be explained by 

the fact that the former are determined with a uniform mechanism of brain death 

in highly controlled systems in contrast to the latter group, in which patients 

suffer brain death by a variety of mechanisms. 

2.1.3. Immunological/Inflammatory Changes 

Studies investigating the relation between brain death and immunological 

activation of peripheral organs have demonstrated that the explosive increase in 

intracranial pressure followed by systemic hypotension upregulates various lymphocyte- 

and macrophage-derived cytokines on solid organs in rats (22). The 

hypothesis that brain death increases the immunogenicity of solid organs is further 

supported by findings that kidneys and hearts transplanted from brain-dead 

donor animals experience accelerated acute rejection compared to those from 

living donors (23). Early adhesion molecules (selectins) not present on the vascular 

cell surface under resting conditions but upregulated rapidly after injury 

seem to trigger subsequent events. Adherent leukocyte populations express other 

classes of adhesion molecules (intercellular adhesion molecule; vascular cell 

adhesion molecule; lymphocyte-function associated antigen-1) and release 

proinflammatory lymphokines (tumor necrosis factor-α, interferon [IFN]-γ). 

Expression of major histocompatibility complex (MHC) class I and II molecules 

is increased. The upregulation of MHC on graft cells is mediated primarily by 

IFN-γ, itself increased by the brain-death–I/R insult. The mediators of immunological 

activation of donor organs after brain death have not been determined. 

The deleterious changes in endothelial surfaces and the increasing immunogenicity 

of solid organs begin promptly after massive central injury, and it has 

been suggested that these changes can be partly explained by excessive catecholamine 

release (8). This hypothesis is further supported by the experimen-


tal observation that even short-term administration of catecholamines in braindead 

donors is followed by reduced survival and poor initial function after renal 

allotransplantation in pigs (24). 

2.2. Intensive Care Unit Management of the Brain-Dead Organ Donor 

Donor management has been described as “the most neglected area of transplant 

medicine” (25). In one study it was estimated that failure to provide adequate 

physiological support to potential donors accounted for at least 25% of lost 

donor organs (26). Data from the Australia & New Zealand Organ Donation 

registry (27) reveals that more than 90% of brain-dead individuals develop hypotension 

and receive some form of inotropic/pressor support, most commonly noradrenaline. 

Other inotropic/pressor agents used include adrenaline, dopamine, 

dobutamine, and metaraminol. The choice of agent is likely to reflect local preferences, 

but currently there is little evidence to support the use of any single 

catecholamine over others. The duration of pressor support varies considerably, 

but 90% of brain-dead donors receive support for between 6 and 24 h, prior to 

donor organ removal. 

The impact of the administration of catecholamines to the brain-dead donor on 

subsequent graft outcome remains unclear. Experimental studies in solid organ 

transplantation and clinical studies in heart transplantation have generally demonstrated 

worse outcomes when the donor has received catecholamines (24,28– 

32). On the other hand, several clinical studies, including a recent meta-analysis, 

found that that graft outcomes after kidney transplantation were better when 

donor kidneys were obtained from donors who had received catecholamines (32). 

In this same meta-analysis, heart transplant outcomes were worse and liver transplant 

outcomes were unaffected by donor catecholamine treatment. At present, it 

is unknown whether these differences in transplanted organ outcomes reflect 

differences in the type of donors that receive catecholamines, the direct effects of 

catecholamines on different donor organs, or indirect effects (such as better maintenance 

of blood flow to the kidney in donors receiving catecholamine infusions). 

Regardless of the explanation, this observation creates an immediate 

dilemma for the intensive care physician caring for the brain-dead donor. Does 

he or she administer a drug that appears to benefit one potential donor organ but 

harms another? 

A series of observations reported by Rosendale et al. (1) suggest that it may 

not be necessary to optimize preservation of one organ at the expense of another. 

In a large retrospective review of the Organ Procurement and Transplantation 

Network database, they noted that 15% more kidneys were transplanted from 

donors whose heart was transplanted: 91 vs 76% (p < 0.001). Furthermore, kidneys 

from heart donors had a lower incidence of delayed graft function: 18 vs 

25% (p < 0.001) and better 1-yr survival: 91 vs 87% (p < 0.001). These data


suggest that donor treatments that optimize the function of the donor heart (and 

cardiac output) are likely to benefit donor kidney function as well (and presumably 

the function of other donor organs). 

2.3. Hormonal Resuscitation of the Brain-Dead Donor 

Generally accepted principles of donor management include correction of 

any fluid imbalance by intravenous fluid replacement, treatment of diabetes 

insipidus, maintenance of blood pressure using vasoconstrictors (usually) or 

vasodilators, with maintenance of adequate ventilation and electrolyte homeostasis 

(33–35). However, there is no consensus regarding correction of hormonal 

abnormalities in the brain-dead donor other than treatment of diabetes 

insipidus. The use of vasopressin or its synthetic analog desmopressin is contentious 

because both have been reported to impair perfusion of the donor pancreas 

(36). On the other hand, there is a paucity of data on the effects of other 

vasopressor agents on perfusion of the donor pancreas or other intra-abdominal 

organs. 

Almost 50 yr ago, Wagner and Braunwald demonstrated that patients with 

autonomic failure were exquisitely sensitive to the vasoconstrictor effects of 

vasopressin, whereas minimal vasopressor effects were demonstrable in normal 

subjects (37). In 1986, Yoshioka and colleagues demonstrated that brain-dead 

subjects could be maintained in a stable hemodynamic state for an average of 23 

d using a combination of low-dose vasopressin and adrenaline (38). In the same 

study, brain-dead subjects treated with adrenaline alone all progressed to cardiac 

arrest at an average of 24 h after brain death. More recently, several investigators 

have demonstrated that low-dose vasopressin is effective in restoring 

blood pressure and systemic vascular resistance in hemodynamically unstable 

brain-dead donors (39,40). Low-dose vasopressin has been shown to be effective 

in maintaining hepatic energy metabolism after brain death in experimental 

dogs (41). Furthermore, human studies have shown that renal and hepatic function 

are well preserved in brain-dead patients supported with low-dose vasopressin 

infusions (38,42,43). 

Clinical trials of thyroid hormone administration to the brain-dead donor 

have shown variable efficacy (44–47). There are several possible explanations 

for the discordant results observed in clinical trials to date. In general, studies 

in which the brain-dead donor has been treated with thyroid hormone alone 

(either T3 or T4) have generally failed to demonstrate any hemodynamic benefit 

associated with this treatment (45,46,48). In contrast, studies of hormonal 

replacement in which thyroid hormone has been administered in combination 

with cortisol (44,49) or as part of a multihormone “cocktail” have demonstrated 

favorable effects on donor hemodynamic status (16,50). The extent of hormonal 

disturbance and the impact this has on donor organ quality may vary among


donors, depending on the clinical circumstances leading to brain death. Retrospective 

analysis of these studies suggests that combined hormonal therapy is 

most useful in hemodynamically unstable donors, those with impaired left ventricular 

function on echocardiography, or those requiring prolonged vasopressor 

support. 

Perhaps the most supportive clinical study for combined hormonal therapy 

was that performed by Wheeldon and colleagues (50). Based on the experimental 

work of Novitzky and colleagues (12,16,51,52), they developed a combined 

infusion of T3, methylprednisolone, vasopressin, and insulin, which has subsequently 

become known as the Papworth cocktail. They reported that in 150 

consecutive multiorgan donors, 52 hearts were unacceptable for transplantation 

based on conventional selection criteria. Forty-four of these (92%) became 

acceptable after institution of Swan–Ganz monitoring, hemodynamic “optimization,” 

and administration of combined hormonal therapy. Importantly, similar 

posttransplant outcomes were observed after transplantation of these 

resuscitated hearts compared with organs that initially met “acceptable” criteria. 

Largely based on the results of this study, a recent consensus meeting of 

various stakeholders in the United States developed a uniform cadaveric donor 

management protocol (Fig. 1) that incorporates invasive hemodynamic monitoring 

and hormonal resuscitation (HR) for donors who are hemodynamically 

unstable (4). 

Recently, Rosendale et al. (53) published the findings of a large retrospective 

analysis of all brain-dead donors recovered in the United States from January 

1, 2000, to September 30, 2001. Of 10,292 consecutive brain-dead donors 

analyzed, 701 (7%) received three-drug HR (T3 or L-thyroxine, methylprednisolone, 

and vasopressin). Univariate analysis showed that the mean number 

of organs from HR donors (3.8) was 22.5% greater than that from non-HR 

resuscitation donors (3.1) (p < 0.001). Multivariate analyses showed that HR 

was associated with the following statistically significant increased probabilities 

of an organ being transplanted from a donor: kidney 7.3%, heart 4.7%, 

liver 4.9%, lung 2.8%, and pancreas 6.0%. Extrapolation of these probabilities 

to the 5921 brain-dead donors recovered in 2001 was calculated to yield a total 

increase of 2053 organs. 

2.4. Anti-Inflammatory Treatment of the Brain-Dead Donor 

Another potential approach to improving the quality of cadaveric donor organs 

involves the use of specific or nonspecific anti-inflammatory treatments aimed 

at blunting or reversing the upregulation of pro-inflammatory cytokines, adhesion 

molecules, and donor specific antigens. The administration of high-dose 

steroids to brain-dead donors has been shown experimentally to improve the 

survival of renal and cardiac allografts (54,55) and clinically to improve donor


Fig. 1. Crystal City recommendations for cardiac donor management, which have been 

adopted into the United Network for Organ Sharing Critical Pathway. (From ref. 5.) 

lung function, resulting in an increased number of transplanted lung allografts 

(56). It is noteworthy that the steroid doses of the combined hormone resuscitation 

protocols used in the above-mentioned studies were very high, indicating 

that the hormone cocktail is likely to be playing an anti-inflammatory as well as 

a hormone-replacement role (44,50,53). 

Based on available experimental and clinical trial data reviewed above, the 

United Network for Organ Sharing and other stakeholders in the United States


Table 1 

Lung Donor Management Recommendations 

The airway 

Bronchoscopy 

Frequent suctioning and aspiration precautions 

Albuterol therapy for wheezing (may improve lung fluid clearance) 

Mechanical ventilation 

Adequate oxygenation 

PO2 > 100 mmHg, FIO2 = 0.40 or O2 saaturation > 95% 

Adequate ventilation 

Maintain pH 7.35–7.45 and PCO2 30-35 mmHg 

PEEP + 5 cm H2O 

Tidal volume 10-12 mL/kg 

Peak airway pressures < 30 mmHg 

Fluid Management and Monitoring 

CVP at a minimum; PA catheter desirable 

Arterial line and pulse oximetry 

Judicious fluid resuscitation to ensure end-organ perfusion 

CVP 6–8 mmHg, Pcwp 8–12 mmHg 

Urine output 1 mL/kg/h 

Colloid as the fluid of choice for volume resuscitation 

Albumin (normal serum) with normal PT, PTT; FFP with coagulopathy 

Hemoglobin > 100 g/L 

PO 2, partial pressure of oxygen; PIO 2, fractional concentration of O 2 in inspired gas; PCO 2, 

partial pressure of carbon dioxide; PEEP, positive end-expiratory pressure; CVP, central venous 

pressure; Pcwp, pulmonary capillary wedge pressure; PI, intrathorcic pressure; PTT, partial 

thromboplastin time; FFP, fresh frozen plasma. 

From ref. 4. 

have now endorsed the use of hemodynamic monitoring and combined HR in 

all brain-dead donors who are hemodynamically unstable, require high doses 

of inotropic/pressor agents, or show evidence of impaired cardiac function on 

echocardiography (4,5). Brain-dead donors who demonstrate one or more of 

these features probably account for between one-quarter and one-third of multiorgan 

donors. Routine administration of combined HR to these donors is likely 

to increase the yield of all donor organs (53,57). An algorithm for the management 

of the brain-dead donor developed by the Heart Working Group of the 

Consensus Meeting is shown in Fig. 1. 

Additional recommendations were made by the Lung Working Group of the 

Consensus Meeting in relation to optimizing lung function and the suitability of 

the lungs for transplantation (4). These recommendations are summarized in 

Table 1. Of particular importance are management of the airway and ventilation.


Regular airway suctioning should be performed to clear bronchial secretions, 

and any donor with clinical or radiological signs of retained sputum or impaired 

alveolar ventilation should undergo bronchoscopy with bronchial toilet to clear 

the airways and collect specimens for microscopy and culture. Ventilator settings 

should be adjusted to maintain adequate oxygenation (arterial pO 2 > 100 

mmHg or O 2 saturation > 95%) and ventilation (pH 7.35–7.45 with arterial pCO 2 

30–35 mmHg) Target ventilator settings are FiO 2 < 0.40, PEEP + 5 cmH 2O, tidal 

volume 10–12 mL/kg, and peak airway pressure less than 30 mmHg. Major 

deviations from these ventilator settings should prompt the performance of a 

chest x-ray and bronchoscopy with corrective measures determined by the findings 

(35). 

3. Preservation of the Heart 

3.1. Excision of the Donor Heart and Storage Conditions 

More than 80% of cadaveric donors are multiorgan donors. Under these circumstances, 

the donor heart is procured during a procedure in which the lungs, 

liver, kidneys, and/or pancreas are also excised. After venting the venous circulation, 

the ascending aorta is cross-clamped and cold preservation solution is 

rapidly infused into the aortic root to produce rapid cooling and electromechanical 

arrest of the heart. Usually the donor heart is then excised and placed in a 

plastic bag containing approx 1 L of preservation solution. The plastic bag is 

then sealed and placed in an insulated container packed with ice (between 0 and 

4°C), in which it is stored until implantation. 

An alternative to static hypothermic ischemic storage is continuous ex vivo 

perfusion of the donor heart, a process that involves the continuous infusion of 

an oxygenated cold preservation fluid through the coronary circulation (58). 

Continuous ex vivo perfusion has been used to preserve donor kidneys since 

the 1960s. Experimental studies of continuous perfusion of the explanted heart 

have found that high flow rates can cause myocardial edema and early graft 

dysfunction (59–61). This tendency may be reduced by the addition of highmolecular-weight 

vascular impermeants (colloids) such as hydroxyethyl starch, 

polyethylene glycol, or dextran 40 to the perfusion fluid to prevent the accumulation 

of fluid in the interstitial space by exerting colloidal oncotic pressure in 

the intravascular space (60). 

Alternatively, continuous low-flow or micro-perfusion has been shown experimentally 

to provide superior results to static hypothermic storage during extended 

preservation times. Indeed, excellent preservation of the donor rabbit heart for 

storage times up to 24 hr has been demonstrated with this technique (60). Despite 

the strong experimental data in support of its superior efficacy, the clinical uptake 

of continuous ex vivo perfusion of the donor heart has been very limited. There 

are several likely reasons for this. First, acceptable transplant outcomes have been


obtained with static hypothermic storage of the donor heart for periods of up to 6 

hr. Second, continuous perfusion systems are perceived as being costly and cumbersome. 

Third, the perfusion system requires close monitoring to ensure that the 

perfusate is bubble-free and is being delivered into the coronary circulation at the 

appropriate flow rate. 

3.2. Cardiac Injury During Storage and Transplantation 

3.2.1. Hypothermic Ischemia: The Good and the Bad 

A common feature of all methods of donor heart preservation described to 

date has been the use of hypothermia, which markedly reduces myocardial 

energy consumption and slows the loss of high-energy substrates. According to 

the van’t Hoff equation, the activity of enzymatic reactions is reduced by approx 

50% for every 10°C reduction in temperature (62). For static ischemic storage, 

profound hypothermia (1–4°C in a standard ice chest) has been found to produce 

satisfactory myocardial protection for up to 6 h in clinical heart transplantation 

(63). Equivalent levels of myocardial preservation have been reported after 4 h 

of storage of the canine heart at 4 and 12°C (64). With continuous ex vivo perfusion, 

excellent myocardial protection may be achieved with lesser degrees of 

hypothermia (65). 

The benefits of hypothermia, however, come at a cost. A major hazard of 

hypothermia is cell swelling. Normally, the cationic composition of intracellular 

(high K + , low Na + ) and extracellular fluid (high Na + , low K + ) is maintained by 

the membrane Na,K-ATPase pump, which uses energy (ATP) derived from oxidative 

phosphorylation in mitochondria. The total intracellular colloid osmotic 

pressure derived from the intracellular proteins and impermeable anions is 

approx 110–140 mOsm/kg (62). Anaerobic–hypothermic preservation suppresses 

the Na,K-ATPase pump. Sodium and chloride diffuse into the cell down 

their ionic concentration gradients, and the water that follows leads to cell swelling. 

Hence, in order to prevent cell swelling, impermeable substances must be 

added to the preservation solution to generate the same amount of osmotic pressure 

present in the intracellular compartment. Examples include the intravascular 

impermeants mentioned above. Other impermeants that can be used for this 

purpose are saccharides such as lactobionate, raffinose, glucose, and mannitol or 

anions such as citrate, phosphate, sulfate, and gluconate. 

Another consequence of hypothermic ischemic storage is intracellular Ca 2+ 

accumulation. Under normothermic conditions, myocyte handling of Ca 2+ is an 

energy-dependent process, in which Ca 2+ is removed from the cytoplasm (directly 

and indirectly) by the action of ATPases. Inactivation of these ATPases together 

with activation of the Na + -H + exchanger (see below) during hypothermic storage 

allows Ca 2+ to accumulate within the cytoplasm, resulting in Ca 2+ overload during 

storage.


Hypothermia markedly slows myocardial energy consumption but does not 

arrest it completely. Under hypothermic ischemic storage conditions, the energydependent 

processes required to maintain cell viability can only be sustained 

through anaerobic glycolysis. This results in rapid depletion of high-energy substrates, 

lactic acid production, and intracellular acidosis. High levels of intracellular 

lactic acid not only injure cellular organelles, but also can activate 

macrophages. This, in turn, can lead to cytokine production and the initiation of 

an inflammatory response (62). 

The accumulation of intracellular H + ion during hypothermic ischemic storage 

activates a membrane-bound Na-H ion exchanger or antiporter (66) (Fig. 2). 

This ion exchanger, while quiescent under normal conditions, is activated by a 

decrease in intracellular pH and is driven by the transmembrane ionic gradients 

for Na + and H + in an energy-independent process. The Na-H antiporter exchanges 

intracellular H + for extracellular Na + . With inactivation of the Na,K-ATPase 

pump by hypothermia, the resultant accumulation of intracellular Na + reverses 

the direction of a second membrane ion exchanger (the Na-Ca antiporter), which 

exchanges intracellular Na + for extracellular Ca 2+ . Hence, the net effect of intracellular 

acidosis during ischemia is an accumulation of intracellular Ca 2+ (66). 

One method to prevent acidosis during hypothermia is the addition of hydrogen 

ion buffers to the preservation solution. Hydrogen ion buffers used for cardiac 

preservation include potassium phosphate, sodium bicarbonate, magnesium sulfate, 

and histidine. One of the distinguishing characteristics of Bretschneider 

(HTK) solution, for example, is its extremely high concentration of histidine in 

comparison with other organ-preservation solutions (Table 2). An alternative 

(and possibly more effective) approach to preventing the harmful effects of acidosis 

is via pharmacological inhibition of the Na-H exchanger (67). 

3.2.2. Reperfusion Injury 

Although restoration of oxygenated blood flow is essential to the survival of 

ischemic tissue, the process of reperfusion can paradoxically lead to further tissue 

injury (68). The severity of this reperfusion injury is directly related to the 

severity and duration of the ischemic insult that preceded it. Reperfusion injury 

results in myocyte damage through myocardial stunning, microvascular and endothelial 

injury, and irreversible cell damage or necrosis (lethal reperfusion injury). 

The major chemical mediators are thought to be oxygen-derived free radicals 

and Ca 2+ (68). In addition, there is evidence that white blood cells directly contribute 

to reperfusion injury after periods of prolonged ischemia (69). 

3.2.2.1. OXYGEN-DERIVED FREE RADICALS 

Restoration of oxygen to tissues that have accumulated anaerobic metabolites 

leads to a burst in the production of oxygen-derived free radicals and oxi-


Fig. 2. Activity of the sodium hydrogen exchanger under normal conditions and during 

ischaemia reperfusion. Under normoxic conditions (Panel A), ATP supply is nonlimiting. 

Internal sodium is extruded via Na + /K + ATPase, calcium is extruded via the 

sodium/calcium exchanger and the sodium/hydrogen exchanger is quiescent. As a consequence 

of ischaemia (Panel B), ATP is depleted and the Na + /K + ATPase becomes 

inactive. Accumulation of H + as a result of glycolysis, activates the sodium hydrogen 

exchanger, resulting a large influx of sodium. This sodium is now cleared by the sodium/ 

calcium exchanger resulting in a dangerous intracellular accumulation of calcium which 

may cause electrical instability, contractile dysfunctions and myocyte death. 

dants. These include superoxide anion, hydrogen peroxide, hypochlorous acid, 

hydroxyl radical, and peroxynitrite. Small amounts of oxygen-derived free radicals 

are produced as a normal byproduct of a number of essential cellular processes 

(e.g., mitochondrial energy production and cell-to-cell signaling) but are 

prevented from causing cell injury by a variety of cellular antioxidant mecha-


Table 2 

Composition and Clinical Usage of Some Commercial Preservation Solutions 

Component UW m-EC HTK Stanford STHS2 Celsior Perfadex 

Ionic Compositin 

Na + (mmol/L) 30 10 10 25 120 100 138 

K + (mmol/L) 120 115 10 30 16 15 6 

Cl (mmol/L) 0 15 50 30 203 41.5 142 

Mg 2+ (mmol/L) 5 0 4 0 16 13 0.8 

Ca 2+ (mmol/L) 0 0 0.015 0 1.2 0.25 0.3 

Acid-Base Buffers 

Bicarbonate (mmol/L) 0 10 0 25 10 0 0 

Phospage (mmol/L) 25 57.5 0 0 0 0 0.8 

Sulphate (mmol/L) 4 0 0 0 0 0 00.8 

Histidine 0 0 180 0 0 30 0 

Impermeants 

Lactobionate (mmol/L) 100 0 0 0 0 80 0 

Raffinose (mmol/L) 30 0 0 0 0 0 0 

Hydroxyethyl starch (g/L) 50 0 0 0 0 0 0 

Dextran 40 (g/L) 0 0 0 0 0 0 50 

Mannitol (mmol/L) 0 0 30 12.5 0 60 0 

Glucose (mmol/L) 0 214 0 50 0 0 5 

Metabolic Agents 

Adenosine (mmol/L) 5 0 0 0 0 0 0 

Glutamate (mmol/L) 0 0 0 0 0 20 0 

Ketoglutarate (mmol/L) 0 0 1 0 0 0 0 

Tryptophan (mmol/L) 0 0 2 0 0 0 0 

Anti-Oxidants 

Glutathione (mmol/L) 2 0 0 0 0 3 0 

Allopurinol (mmol/L) 1 0 0 0 0 0 0 

pH 7.4 7.4 7.2 8.1–8.4 7.8 7.3 7.4 

Osmolality (mOsm/L) 320 375 310 440 324 360 302 

Clinical usage UW m-EC HTK Stanford STHS2 Celsior Perfadex 

Organ 

Kidney +++ +/– ++ – – + – 

Liver +++ +/– ++ – – + – 

Heart + – ++ + + ++ – 

Lung + + ++ +/– – ++ +++ 

Pancreas +++ +/– ++ – – + –


Fig. 3. Outline of some of the potential free radical consequences of ischaemia reperfusion 

during organ harvest, storage, re-implantation and reperfusion. Some experimental 

approaches to minimize various elements of the process are shown in red dashed 

boxes. Approaches incorporated into commercially available storage solutions are 

shown in solid boxes. 

nisms. The abrupt increase in cellular levels of oxygen-derived free radicals 

that occurs during reperfusion after prolonged ischemia is due in part to excess 

production of free radicals via reaction of xanthine and hypoxanthine with xanthine 

oxidase. In addition, prolonged ischemia depletes the cell of its antioxidant 

reserves so that it is less capable of scavenging any excess free radicals 

generated during reperfusion. Oxygen-derived free radicals contribute to cell 

injury through a wide variety of chemical reactions including lipid peroxidation, 

abnormal crosslinking, and cleavage of proteins and DNA disruption. 

Potential approaches to the prevention of the burst in oxygen-derived free radical 

accumulation during organ storage and reperfusion (Fig. 3) include the 

addition to the preservation solution of a pharmacological inhibitor of xanthine 

oxidase, such as allopurinol, and the addition of antioxidant free radical scavengers. 

Examples include reduced glutathione, mannitol, superoxide dismutase, 

desferrioxamine, and 21-aminosteroids.


3.2.2.2. CA 2+ OVERLOAD DURING REPERFUSION 

As described previously, there is an accumulation of intracellular Ca 2+ during 

hypothermic ischemic storage due to coupled activation of the Na-H and 

Na-Ca exchangers. Reperfusion with oxygenated blood initially leads to further 

activation of the Na-H exchanger resulting in further Ca 2+ influx (67). In addition 

to increased Ca 2+ influx, Ca 2+ reuptake into the sarcoplasmic reticulum is 

reduced as a result of depressed activity of the sarcoplasmic reticulum Ca 2+ 

pump (following depletion of intracellular ATP levels). The sustained increase 

in diastolic Ca 2+ has two potentially lethal consequences for the myocyte: sustained 

contraction (contracture) of actin–myosin proteins and sustained activation 

of Ca 2+ -dependent enzymes within mitochondria resulting in mitochondrial 

failure. Potential approaches to prevention of Ca 2+ overload during reperfusion 

include a reduction in the Ca 2+ concentration of the preservation fluid, supplementation 

of the preservation fluid with Mg 2+ , which competes with Ca 2+ for 

Ca 2+ exchangers and pumps, and the addition of drugs that inhibit Ca 2+ influx. 

These include Ca 2+ channel blockers and Na-H exchange inhibitors. 

3.2.2.3. WHITE BLOOD CELLS 

White blood cells are another potential source of oxygen-derived free radicals. 

Ischemic injury to the vascular endothelium leads to upregulation of various 

adhesion molecules, which initiate sticking and activation of circulating 

white cells and platelets to the vessel lumen (69). In addition to release of free 

radicals, white cells may physically plug the lumens of microscopic vessels 

within the reperfused organ, leading to the no-reflow phenomenon (70). The 

use of white blood cell filters at the time of reperfusion has been shown experimentally 

and clinically to reduce evidence of reperfusion injury and graft dysfunction 

(71,72). 

3.2.2.4. ENDOTHELIAL INJURY DURING ISCHEMIA AND REPERFUSION 

Under normal physiological conditions, the vascular endothelium synthesizes 

compounds that induce vascular relaxation and inhibit white cell and 

platelet adherence to the vessel wall. These compounds include NO, endothelium-dependent 

hyperpolarization factor, and prostacyclin. Ischemic injury to 

endothelial cells inhibits production of these compounds upregulating of prothrombotic 

and pro-inflammatory adhesion molecules as a consequence. Oxygen-derived 

free radicals generated on reperfusion may further damage the 

vascular endothelium. For example, superoxide reacts directly with NO, leading 

to loss of the physiological activity of NO and formation of peroxynitrite, a 

potent cytotoxic-free radical. Nitric oxide and prostacyclin are potent vasodilators 

and possess cytoprotective properties that may be beneficial for preservation 

of allograft function during and after cold ischemic storage. Prostacyclin


and related prostanoids have been used to produce maximal vasodilatation 

within the vascular bed of the donor organ either via prior intravenous administration 

(73–76) or by addition to the preservation solution (73,77,78). Similarly, 

NO donors (e.g., glyceryl trinitrate and diazenium diolates—NONOates) 

have been added to preservation solutions to offset the loss of endogenous NO 

that occurs during hypothermic storage and reperfusion (79–81). 

Endothelial injury caused by I/R injury has been implicated as a factor in the 

development of both acute allograft dysfunction and chronic allograft 

vasculopathy. Another potential source of endothelial injury is the high K + concentration 

of some intracellular preservation solutions such as University of 

Wisconsin (UW) solution, although this remains controversial. Several clinical 

studies suggest that the development of coronary allograft vasculopathy may 

differ according to the type of preservation solution used at the time of transplantation, 

with two studies reporting higher rates when the heart was stored in 

UW solution (82,83). 

3.3. Formulation of Preservation Solutions 

Such is the complexity of the molecular and cellular mechanisms that mediate 

I/R injury that it is unlikely that any single approach or treatment will provide 

maximal protection to the donor organ during ischemic storage and reperfusion. 

Rather a combination of therapeutic approaches is likely to be required. In the 

context of myocardial preservation, three general principles have guided the formulation 

of cardioplegic and preservation solutions: (1) rapid reduction of tissue 

metabolic rate by profound hypothermia and electromechanical arrest of the 

heart, (2) provision of a biochemical medium that maintains tissue viability and 

structural integrity, and (3) prevention of reperfusion injury. 

Many different myocardial preservation solutions have been developed and 

are in use for clinical heart transplantation. In one survey it was reported that at 

least 167 different types of preservation fluids were used for heart transplantation 

in the United States (84). This in itself is a reflection of the current uncertainties 

regarding the optimal strategy for myocardial preservation. Some (e.g., 

Bretschneider [HTK, Custodial], Celsior, St Thomas solution [STS, Plegisol], 

and UW solution [UW, Viaspan]) are commercially available solutions, but 

many are locally produced noncommercial solutions (84,85). In some centers, 

the same solution is used for both flush (cardioplegia) and storage, whereas 

other centers have elected to use separate solutions for initial cardioplegia and 

subsequent cold storage and transport of the cardiac allograft. With currently 

available preservation solutions, the maximum recommended storage time for 

cardiac allografts is approx 6 h. Table 2 lists the electrolyte composition, chemical 

additives, and common clinical uses of a number of commercially available 

organ-preservation solutions.


3.3.1. Electrolyte Composition of Preservation Solutions 

Preservation solutions differ in terms of both their electrolyte composition 

and additives. Most solutions can be divided into two broad categories—extracellular 

and intracellular—based on their Na + and K + concentrations. Preservation 

solutions that mimic extracellular fluid contain a high Na + concentration 

(�70 mmol/L) and a K + concentration in the range of 5–30 mmol/L. Preservation 

solutions that mimic intracellular fluid contain a low Na + concentration 

(�70 mmol/L) and K + concentration in the range of 30–125 mmol/L. Examples 

of intracellular and extracellular preservation solutions are shown in Table 1. 

Celsior (Na + 100, K + 15 mmol/L) and UW solutions (Na + 30, K + 125 mmol/L) 

are examples of extracellular and intracellular preservation solutions that have 

been used for clinical heart transplantation (82,86–88). 

The primary rationale for intracellular preservation solutions is that the presence 

of similar concentrations of Na + and Cl- in the intracellular and extracellular 

compartments minimizes the passive fluxes of these ions into the cell (and hence 

cell swelling) during hypothermia. Another potential advantage of intracellular 

solutions is that the high K + concentration in the preservation solution facilitates 

cardiac arrest while the low Na + concentration reduces the drive for the Na-H 

exchanger. On the other hand, a significant concern with intracellular preservation 

solutions, particularly with regard to myocardial preservation, is the potential 

for high K + concentrations to cause coronary endothelial cell injury. This is a 

controversial issue as there is contradictory experimental evidence (89–92). The 

damaging effects of hyperkalemia on the endothelial cell may be temperature 

dependent. Several investigators have noted that UW solution provided excellent 

endothelial cell preservation at 4°C but caused endothelial injury at higher 

temperatures (93,94). This observation suggests that if UW solution is used to 

preserve the donor heart, the preservation solution should be completely rinsed 

from the heart before any cardiac rewarming occurs at the time of implantation. 

A further limitation of hyperkalemic preservation solutions, whether intracellular 

or extracellular, relates to their depolarizing action, which results in continuing 

transmembrane fluxes and the consequent maintenance of high-energy 

phosphate metabolism, even during hypothermic ischemia (89). A potentially 

beneficial alternative to hyperkalemic cardioplegia is to arrest the heart in a 

“hyperpolarized” or “polarized” state, which maintains the membrane potential 

of the arrested myocardium at or near to the resting membrane potential. At 

these potentials, transmembrane fluxes will be minimized and there should be 

little metabolic demand, resulting in improved myocardial protection. Recent 

studies have explored these alternative concepts for myocardial protection 

(89,95). The use of compounds such as adenosine or ATP-sensitive potassium 

channel openers, which are thought to induce hyperpolarized arrest, has demonstrated 

improved protection after normothermic, or short periods of hypother-


mic, ischemia when compared to hyperkalemic (depolarized) arrest. Similarly, 

the sodium channel blockers tetrodotoxin and lignocaine were used to induce 

polarized arrest (demonstrated by direct measurement of membrane potential 

during ischemia) was also shown to provide better recovery of function after 

long-term hypothermic storage (89,95). Indeed, the combination of adenosine 

with lignocaine in the same cardioplegic solution, as proposed by Dobson and 

Jones, has been shown to dramatically enhance myocardial protection during 

both normothermic and hypothermic ischemia (95). 

Other important electrolyte components of myocardial preservation solutions 

are Ca 2+ and Mg 2+ . As mentioned earlier, inactivation of Ca 2+ ATPases together 

with activation of the Na + -H + exchanger during hypothermic ischemic storage 

allows Ca 2+ to accumulate within the cytoplasm, resulting in Ca 2+ overload during 

storage. Further activation of the Na + -H + exchanger on reperfusion exacerbates 

Ca 2+ overload, causing activation of Ca 2+ -dependent enzymes, which cause 

cell injury through a variety of actions, contracture of the myofilaments, and 

irreversible mitochondrial damage, culminating in cell death. Experimental studies 

indicate that complete omission of Ca 2+ from preservation solution is detrimental 

to myocardial recovery (96–98). On the other hand, similar experimental 

studies demonstrate that Ca 2+ concentrations equivalent to those of extracellular 

fluid are also detrimental to myocardial recovery after ischemia (99,100). 

Normocalcaemic concentrations appear to facilitate Ca 2+ overload during 

ischemia and reperfusion. Low concentrations of Ca 2+ in the preservation solution 

together with high concentrations of Mg 2+ , however, have been shown to 

limit Ca 2+ overload and improve myocardial preservation (100,101). Of the currently 

available commercial solutions, Celsior and STS No. 2 solution contain a 

low Ca 2+ concentration in combination with a high Mg 2+ concentration. 

3.3.2. Chemical Additives 

Apart from differences in electrolyte composition, preservation solutions differ 

with respect to chemical additives. The additives used in commercially available 

preservation solutions fall into one of four broad categories, although some 

chemicals (e.g., adenosine) may belong to more than one category. The major 

categories are metabolic substrates, osmotic and oncotic impermeants, antioxidants 

and free-radical scavengers, and acid–base buffers. Examples of chemical 

additives within each category are shown in Table 2. Experimentally at least, 

these additives can be shown to enhance donor organ recovery of the preservation 

solutions to which they have been added (60,102,103). 

3.4. Novel Approaches to Myocardial Protection 

Clinical studies with commercially available myocardial storage solutions 

indicate that they provide acceptable donor heart preservation for periods of up


to 6 h. Experimental studies suggest that more prolonged periods of donor heart 

storage can be achieved with some storage solutions, but it is apparent from 

these studies that there is scope to further enhance the myocardial protection 

provided by these solutions. For example, Baxter and colleagues (81) demonstrated 

in a rat heterotopic heart transplant model that supplementation of 

Celsior solution with glyceryl trinitrate significantly improved myocardial 

preservation. In another study, Kevelaitis and colleagues (104) demonstrated 

in an isolated rat heart model that supplementation of Celsior with cariporide 

(a Na + -H + exchanger inhibitor) or diazoxide (a mitochondrial K ATP [mK ATP] 

channel agonist) enhanced myocardial recovery after prolonged hypothermic 

storage. Interestingly, they observed that cariporide plus diazoxide produced 

additive benefits when Celsior solution was supplemented with both drugs. 

Another potential approach to enhancing myocardial preservation is to administer 

treatments to the donor prior to excision of the heart. Two therapies that 

might be administered in this way are Na + -H + exchange inhibitors and mK ATP 

channel activators. As mentioned previously, Kevelaitis and colleagues demonstrated 

in an isolated rat heart model that supplementation of Celsior with 

cariporide (a Na + -H + exchanger inhibitor) or diazoxide (a mK ATP channel agonist)-enhanced 

myocardial recovery after prolonged hypothermic storage 

(104). However, there is evidence that for these therapies optimal benefit is 

seen only when the treatment is administered prior to the onset of ischemia. 

For example, in the Guardian Study (105), a large clinical study of patients at 

high risk of ischemic myocardial injury, only those patients who received the 

Na + -H + exchange inhibitor cariporide prior to the onset of ischemia benefited 

from the treatment. Recently, Cropper and colleagues demonstrated in the isolated 

working rat heart that administration of the Na + -H + exchange inhibitor 

cariporide produced significantly greater protection when administered prior 

to hypothermic storage than when added to the storage solution (106). 

BMS-180448, like diazoxide, is a selective mK ATP channel-opening drug. In 

contrast to diazoxide and other ATP-sensitive potassium channel-opening 

drugs, BMS-180448 is cardiac selective, such that intravenous administration 

is not associated with systemic hypotension (107). Intravenous administration 

of BMS-180448 prior to coronary ligation has been shown to reduce myocardial 

infarct size by approx 50% in a dog infarct model (107). This drug mimics 

the phenomenon of ischemic preconditioning, originally described in 1986 by 

Murry and colleagues (108). Our laboratory has shown that pretreatment of 

isolated rat hearts with ischemic preconditioning, pinacidil, diazoxide, or BMS- 

180448 improve cardiac function in a working rat heart model after prolonged 

hypothermic storage (109–111). Furthermore, combination pretreatment with 

cariporide and mitochondrial K ATP-channel activators, produced greater protection 

than administration of either drug alone in the same model (111).


While these results are encouraging, they have been observed in an in vitro 

isolated rat heart obtained from non-brain-dead donors. We and others have 

shown that brain death induces transient myocardial ischemia, and thus it is 

possible that the process of brain death activates mK ATP channels through endogenous 

ischemic preconditioning (7,112,113). Furthermore, there is experimental 

evidence that cardioplegic solutions that contain high concentrations of K + 

and Mg + may mediate their cardioprotection in part via activation of mK ATP 

channels (101,114). Hence, exogenous administration of mK ATP channel activators 

may have limited benefit in a setting where the mK ATP channel is already 

activated by myocardial ischemia and/or cardioplegia. Indeed, our own studies 

on the impact of the cardioselective mK ATP channel activator, BMS-180448, on 

myocardial preservation in a porcine brain-dead heart transplant model showed 

only marginal benefit from this drug when administered to the donor and no 

additional benefit when it was administered in combination with the Na-H 

exchange inhibitor cariporide (115). 

4. Preservation of the Lung 

Like other vascularized organs, the transplanted lung is subject to ischemiareperfusion 

injury. The clinical manifestations of I/R injury can vary from asymptomatic 

functional and radiological abnormalities to a life-threatening syndrome 

of severe pulmonary edema and pulmonary hypertension. I/R injury to the lung 

is thought to be the major cause of primary graft failure and peri-operative mortality 

(116). It causes considerable postoperative morbidity (116) and is also 

thought to play an important pathogenetic role in chronic allograft failure (obliterative 

bronchiolitis syndrome) (117). 

4.1. Excision of the Donor Lungs 

Several techniques of donor lung excision and ex vivo preservation have 

been developed. These include the administration of a cold preservation solution 

via the pulmonary artery followed by static hypothermic storage (usually 

in the same preservation solution), topical cooling, donor core cooling on cardiopulmonary 

bypass, and ex vivo perfusion. Of these techniques, single pulmonary 

artery flush and static hypothermic storage is the simplest and the one 

most commonly used in clinical practice (118). Many variations of the single 

pulmonary artery flush and static storage method have been described, and the 

optimal method remains controversial. Controversial aspects of the single pulmonary 

artery flush method include the flushing conditions (use of vasodilator 

prostaglandins, the volume, temperature, and infusion pressure of the flush 

solution), the route of administration (pulmonary and/or bronchial arteries, 

antegrade vs retrograde), and the storage conditions (temperature, oxygenation, 

and state of lung inflation).


4.1.1. Flushing Conditions 

Prostacyclin and related prostaglandins have been used to produce maximal 

vasodilatation within the pulmonary vascular bed either via prior intravenous 

administration (73–75) or by addition to the preservation solution (73,77,78). 

The primary rationale for the use of vasodilator prostaglandins is to ensure rapid 

and uniform distribution of the preservation solution to the lung by preventing 

the pulmonary arteriolar vasoconstriction that would otherwise occur in response 

to administration of hyperkalemic preservation solution. Other reported benefits 

of prostaglandin administration include inhibition of platelet aggregation, inhibition 

of neutrophil-mediated release of oxygen-derived free radicals, and reduction 

in the increased vascular permeability caused by inflammatory mediators 

(119). However, some experimental work has reported adverse effects of prostaglandins 

on donor lung preservation (120), and this may be the reason that 

these agents have not been adopted universally in clinical practice (118). 

A survey of 112 lung transplant centers by Hopkinson and colleagues identified 

a wide variation in the volume of preservation solution administered to the 

donor at the time of pulmonary flush—from 20 to 120 mL/kg of donor body 

weight (118). The median volume was 60 mL/kg administered over 4 min. This 

infusion rate avoids excessive increases in pulmonary artery pressure. In that 

same survey, the authors reported considerable variation in the temperature of 

the perfusate and storage solution from 4 to 10°C. 

4.1.2. Route of Administration of Flush/Preservation Solution 

The most common route of administration of pulmonary preservation solution 

is antegradely via a cannula placed in the main pulmonary artery (118). 

Alternative routes of administration include retrograde adminstration via the 

left atrial appendage (121) or via the pulmonary veins either in situ or prior to 

reimplantation (on the back table) (122,123). Potential advantages of retrograde 

administration of pulmonary preservation solution are that it allows delivery of 

the solution to both the bronchial and pulmonary circulation and that pulmonary 

arterial constriction will not affect distribution of the solution and may actually 

enhance it. Furthermore, retrograde administration will flush out any thrombotic 

or fat emboli (123). A third route of administration is via the bronchial 

arteries using a cannula placed in an isolated segment of thoracic aorta (124). 

4.2. Storage Conditions 

Early studies of lung preservation clearly demonstrated that the collapsed 

lung tolerates ischemia poorly (125–127). Furthermore, these studies demonstrated 

that the prevention of lung collapse during harvesting and storage markedly 

enhances the ability of the lung to tolerate ischemic storage (125–127), but 

the optimal degree of lung inflation during storage is uncertain. While there is


experimental evidence that hyperventilation during harvesting and hyperinflation 

during storage results in superior lung preservation compared with lungs 

stored without inflation (128), there is also evidence that hyperinflation during 

storage may cause barotrauma (129), increase pulmonary capillary permeability 

(130), and cause pulmonary edema (131). In the study of DeCampos and 

colleagues, optimal recovery of lung function was observed when lungs were 

inflated to 50% of total lung capacity during storage (129). The optimal oxygen 

content of the gas used to inflate the donor lung during storage is also uncertain. 

While high intra-alveolar oxygen concentrations permit the ischemic lung to 

remain metabolically active even during hypothermia (132,133), they also facilitate 

production of oxygen-derived free radicals both during ischemia and upon 

reperfusion (134,135). Perhaps because of the uncertainties mentioned above, 

the most common clinical practice is ventilation with an FiO 2 of between 0.3 and 

0.4 during procurement and near-total inflation for storage (118). 

The ideal storage temperature for lung preservation is another point of uncertainty. 

The most commonly used storage temperature is 4°C. Experimental studies 

of lung preservation at 4°C have yielded disparate findings. For example, an 

early study by Feeley and colleagues in a canine heart–lung transplant model 

suggested that 5 h of storage of the heart–lung bloc at 4°C was associated with 

severe physiological dysfunction and pulmonary edema with minimal evidence 

of cardiac dysfunction (136). In contrast, excellent recovery of lung function 

was demonstrated in a pig transplant model after simple storage of the donor 

lung at 4°C for 18 h (137). Two studies using isolated rabbit and rat lungs 

compared recovery of lung function after prolonged ischemic storage at temperatures 

ranging from 4 to 38°C. They found that optimal recovery of lung 

function was obtained when the lungs were stored at 10 and 12°C, respectively 

(138,139). 

In the lung as in the heart, hypothermic inhibition of cellular ATPase activity 

results in cell swelling. Within the pulmonary vascular bed, endothelial cell 

swelling results in increased capillary permeability and pulmonary vascular 

resistance (140). As with other vascularized organ transplants, hypothermiainduced 

cell swelling can be minimized by the addition of high-molecular-weight 

vascular impermeants (colloids) to the perfusion or preservation fluid. The two 

most commonly used lung preservation solutions, Perfadex and UW solution, 

contain the colloidal agents hydroxyethyl starch and dextran 40, respectively. 

4.3. Reperfusion 

I/R injury in the lung is thought to be mediated by oxygen-derived free radicals 

and by activated leukocytes (140). As mentioned previously, the ischemic 

lung inflated with air or other oxygen-containing gas is capable of maintaining 

oxidative metabolism even during profound hypothermia (132,133). Indeed,


several investigators have demonstrated that inflation of ischemic lungs with 

gas mixtures containing increased concentrations of oxygen results in increased 

generation of oxygen-derived free radicals and free-radical-induced lung injury 

even during profound hypothermic storage (134,135,141). The primary source 

of oxygen radical generation during oxygenated lung ischemia is likely to be 

activated endothelial NADPH oxidase (142). 

Reperfusion of ischemic lung results in a further burst in free radical generation. 

In the isolated rat model, this burst appears to occur in bimodal pattern with 

an early peak at 30 min postreperfusion and a delayed peak at about 4 h postreperfusion 

(143). The late peak appeared to be mediated by activated neutrophils 

(144). The major brunt of the reperfusion injury is borne by the pulmonary 

endothelial cell. The subsequent endothelial cell injury results in vasoconstriction, 

platelet and leukocyte aggregation, and increased capillary permeability. 

Similar approaches to the prevention of reperfusion injury have been adopted 

for the lung as for other organs. These include supplementation of the lung 

preservation solution with antioxidants (145,146) and the use of leukocyte 

depletion (147,148). Although these approaches appear to work well in the 

laboratory, their clinical application has been very limited. 

One potential approach to the prevention of I/R injury that is unique to the 

lung is the use of inhaled NO. Interest in this approach was generated by a 

series of case reports in which inhaled NO was found to markedly improve 

lung function and pulmonary vascular resistance in patients who had developed 

severe I/R injury after lung transplantation (149,150). Although NO has 

well-characterized vasodilator, antiplatelet, and antileukocyte properties, it is 

itself a free radical and is able to combine with other radicals such as superoxide 

anion to generate even more toxic species such as peroxynitrite and higher 

oxides of nitrogen in combination with oxygen. Experimental and clinical 

studies of inhaled NO have shown conflicting results, with some investigators 

reporting benefit (151,152) and others reporting harm (153). A modification of 

the use of inhaled NO to prevent lung I/R injury is to co-administer NO 

with agents that directly inhibit the generation of superoxide anion—examples 

include superoxide dismutase and pentoxifylline (153,154). A recently reported 

double-blind randomized controlled study of low-dose inhaled NO (10 ppm) 

initiated 10 min after reperfusion in 84 lung-transplant recipients found no benefit 

or harm with active treatment (154), and so the benefit of prophylactic 

inhaled NO remains unproven. 

Another consequence of pulmonary I/R injury is loss of pulmonary surfactant 

(155). Experimental studies of intratracheal administration of surfactant 

prior to lung transplant reperfusion demonstrated improved airway compliance 

in animals receiving surfactant compared to saline controls (156). Clinical studies 

of nebulized surfactant administration either alone (157) or in combination


with inhaled NO (158,159) suggest that this may be an effective treatment for 

I/R injury, but controlled clinical trials are still lacking. 

A nonpharmacological approach to the prevention or mitigation of reperfusion 

injury to the transplanted lung is the use of controlled or low-flow reperfusion. 

The rationale behind this approach is the prevention of stress-induced 

endothelial injury during the first 10–15 min of reperfusion, a period of transient 

increased capillary permeability (160). The beneficial effects of controlled 

reperfusion were initially demonstrated in an ex vivo rat lung model (160,161) 

and have subsequently been confirmed in a pig transplant model (162,163). In 

the latter studies, a leukocyte filter was also used at the time of reperfusion. 

Clinical application of controlled reperfusion (combined with leukocyte depletion) 

has been limited, but initial reports suggest that this is a promising approach 

(164,165). 

4.4. Composition of Lung Perfusion/Preservation Solutions 

The first solution to be used clinically for flush perfusion of pulmonary grafts 

was modified Euro-Collins solution. This choice was based on experimental 

studies that demonstrated better preservation of lung grafts with modified Euro- 

Collins solution compared with non-colloid-containing extracellular solutions 

such as Ringer’s lactate solution or isotonic saline (166,167). The highly successful 

clinical application of UW solution as a flush/storage solution for intraabdominal 

donor organs led to investigation of its suitability for donor lung 

perfusion and storage. Experimental studies demonstrated superior long-term 

preservation with UW solution compared with modified Euro-Collins solution 

(168,169), but it is unclear whether this superiority in the laboratory has translated 

into clinical practice (118). 

As with donor heart preservation, a significant concern with the use of intracellular-based 

storage solutions such as UW solution and modified Euro- 

Collins solution for donor lung preservation is their potential to induce endothelial 

injury and pulmonary vasoconstriction (170). It is largely because of this 

concern that vasodilatory prostaglandins are commonly administered before or 

with pulmonary flush solutions, although the effectiveness of this treatment has 

been questioned (171,172). Alternative vasodilators to prostaglandins include 

nitric oxide donors and calcium antagonists (79,173). Both vasodilators have 

been shown experimentally to provide better lung preservation than prostaglandins 

when administered in combination with intracellular perfusion solutions 

(79,173). Recently, Kelly and colleagues demonstrated another potentially deleterious 

effect of high-K + -containing storage solutions (174). They found that 

isolated rat pulmonary artery segments produced more oxygen-derived free radicals 

when stored in intracellular solutions compared with rings stored in extracellular 

solutions.


Concerns regarding the deleterious effects of the high K + content of intracellular 

storage solutions have led to renewed interest in the use of extracellular 

solutions for pulmonary flush and preservation. The solution that has 

been most extensively studied in this context is low-potassium dextran (LPD; 

Perfadex). As mentioned earlier, the dextran 40 in LPD acts as an oncotic 

agent reducing both intracellular swelling and interstitial pulmonary edema 

during hypothermic storage. Another potentially beneficial action of dextran 

40 in the context of lung preservation is its inhibitory effect on platelet and 

erythrocyte aggregation, thereby minimizing microcirculatory thrombosis 

and endothelial cell activation within the graft (175,176). Several experimental 

studies have demonstrated superior lung preservation with LPD compared 

with Euro-Collins solution (170,177–179) or UW solution 

(170,178–180). Clinical studies comparing LPD with other flush solutions 

for lung preservation, usually Euro-Collins solution, have demonstrated 

equivalent or superior outcomes when the lungs were stored in LPD solution 

(181–186). 

A number of further modifications to LPD solution have been shown experimentally 

to further enhance lung preservation compared with LPD solution 

alone. These modifications include the addition of glucose to support 

limited aerobic metabolism in the hypothermically stored lungs (187) and the 

addition of glyceryl trinitrate as a nitric oxide donor (188). It remains to be 

seen whether these modifications translate into better outcomes in clinical 

lung transplantation. 

Other preservation solutions with low potassium concentration (in comparison 

with intracellular storage solutions) that have been assessed in lung 

transplantation include HTK (Bretschneider solution), Celsior, and a modified 

cold blood solution (Papworth or Wallwork solution). Wittwer and colleagues, 

using an isolated rat lung model, showed that lungs preserved in 

Celsior solution for 4 h demonstrated better function postreperfusion compared 

with lungs stored in LPD solution (189). In another study, using a rat 

lung transplant model, Celsior was found to produce better lung preservation 

than Papworth solution after 5 and 12 h of storage (190). More recently, 

Warnecke and colleagues used a porcine lung transplant model to compare 

lung preservation in Celsior, HTK, and Euro-Collins solution (191). They 

found that donor lung preservation was best with Celsior solution and that 

both HTK and Celsior provided better donor lung preservation than Euro- 

Collins solution. Surfactant function after reperfusion was impaired in all three 

treatment groups (191,192). In a large clinical study, Celsior solution and 

Papworth solution produced comparable clinical outcomes at 1 mo post-lung 

transplantation compared with Euro-Collins or UW solution (193). In the same 

study, the incidence of reperfusion pulmonary edema was less with the extra-


cellular solutions, leading the authors to conclude that extracellular-type solutions 

were associated with better lung preservation. 

As the number of centers performing lung transplantation has increased so 

has the variability in the choice of perfusion/preservation solutions. In the 

worldwide survey conducted by Hopkinson and colleagues, 77% of lung transplant 

centers used modified Euro-Collins solution, 13% used UW solution, and 

8% used Papworth blood-based solution (118). Only one center used donor 

core cooling. Most centers stored the lungs in the same solution as used for 

flushing, although seven centers stored the lungs in isotonic saline, and only 

one center stored the organs in low-potassium dextran solution. A more recent 

survey of North American lung transplant centers demonstrated a dramatic 

change in the choice of perfusion/preservation solution (194). The most commonly 

used preservation solution in this survey was low-potassium dextran 

(46%), followed by UW solution (22%), modified Euro-Collins solution (18%), 

Celsior (12%), and Euro-Collins solution (2%) 

As with other vascularized organ transplants, the ideal perfusion and preservation 

solution for lung transplantation is yet to be developed. Currently 

used solutions permit safe lung preservation for periods of 6–8 h. While this 

remains a very active area of research, the wide variation in animal models, 

perfusion solutions, and storage protocols makes comparisons between studies 

difficult. A major limitation of many experimental studies conducted to 

date is that the adverse effects of brain death and prolonged donor ventilation 

have not been incorporated into the study design. 

4.5. Future Developments in Pulmonary Preservation 

The severe shortage of suitable donor lungs has stimulated interest in the 

use of donor lungs from non-heart-beating donors (NHBDs). Under these circumstances 

the donor lung is subject to a period of obligatory warm ischemia, 

which exposes the lungs to a more severe I/R injury compared with lungs 

obtained from heart beating donors (194). On the other hand, oxygen remaining 

in the alveoli after circulatory arrest enables aerobic metabolism to continue 

for a period of time and can potential mitigate the ischemic injury (133). 

Experimental studies suggest that lungs obtained from NHBD animals can be 

successfully transplanted if the warm ischemic time is less than 2 h (195,196). 

These studies showed that as warm ischemic time increases beyond 2 h, the 

risk of primary graft failure rises dramatically. Several therapeutic strategies 

have been found to enhance posttransplant recovery of lungs obtained from 

NHBDs. These strategies include the use of inhaled NO following lung reperfusion 

(197,198), the addition of glyceryl trinitrate to the lung perfusate and 

storage solution (199), and the intravenous administration of glyceryl trinitrate 

prior to reperfusion (200).


Table 3 

Potential Therapeutic Targets for Myocardial 

or Pulmonary Protection During Ischemia and Reperfusion 

Target Drugs References 

Metabolic inhibitors 2,3-butanedione monoxime 201–203 

Nitric oxide donors Glyceryl trinitrate 80,81 

Endothelin antagonists Bosentan 204 

Ischemic preconditioning Adenosine 111,115 

MitoK ATP chananel agonists 

Na-H Exchanger Cariporide 106,115,205 

p38 MAP kinase SP203580 206 

NF-kB Aspirin, Prednisolone 207,208 

PARP PJ34,INO-1001 209,210 

(Additional) Anti-oxidants Bioflavonoids, 21-aminosteroids 211–214 

Haem oxygenase PDTC 208 

5. Conclusion 

As greater understanding of the complex metabolic pathways involved in I/R 

injury has been achieved, novel targets for therapeutic intervention have been 

identified. Table 3 provides a list of some of the potential metabolic pathways 

that are not targeted by currently employed preservation solutions. Some of 

these targets may be adequately addressed by further modification of current 

preservation solutions. Others may require separate administration of a pharmacological 

agent to the donor prior to the onset of ischemia or to the recipient 

prior to reperfusion. The integration of these novel approaches to myocardial 

and pulmonary protection with existing preservation strategies and the extent to 

which the preservation of these organs can be enhanced are likely to be active 

areas of laboratory and clinical research in the years to come. 

References 

1. Rosendale, J. D., Chabalewski, F. L., McBride, M. A., et al. (2002) Increased 

transplanted organs from the use of a standardized donor management 

protocol.[see comment]. Am. J. Transplant. 2(8), 761–768. 

2. Taylor, D. O., Edwards, L. B., Mohacsi, P. J., et al. (2003) The registry of the 

International Society for Heart and Lung Transplantation: twentieth official adult 

heart transplant report—2003. J. Heart Lung Transplant. 22(6), 616–624. 

3. Trulock, E. P., Edwards, L. B., Taylor, D. O., et al. (2003) The Registry of the 

International Society for Heart and Lung Transplantation: Twentieth Official 

adult lung and heart-lung transplant report—2003. J. Heart Lung Transplant. 

22(6), 625–635.


4. Rosengard, B. R., Feng, S., Alfrey, E. J., et al. (2002) Report of the Crystal City 

meeting to maximize the use of organs recovered from the cadaver donor. Am. J. 

Transplant. 2(8), 701–711. 

5. Zaroff, J. G., Rosengard, B. R., Armstrong, W. F., et al. (2002) Consensus conference 

report: maximizing use of organs recovered from the cadaver donor: cardiac 

recommendations, March 28–29, 2001, Crystal City, Va. Circulation 106(7), 

836–841. 

6. Terasaki, P. I., Cecka, J. M., Gjertson, D. W., and Takemoto, S. (1995) High 

survival rates of kidney transplants from spousal and living unrelated donors.[see 

comment]. N. Engl. J. Med. 333(6), 333–336. 

7. Ryan, J. B., Hicks, M., Cropper, J. R., et al. (2003) Functional evidence of reversible 

ischemic injury immediately after the sympathetic storm associated with 

experimental brain death. J. Heart Lung Transplant. 22(8), 922–928. 

8. Pratschke, J., Wilhelm, M. J., Kusaka, M., et al. (1999) Brain death and its influence 

on donor organ quality and outcome after transplantation. Transplantation 

67(3), 343–348. 

9. Finkelstein, I., Toledo-Pereyra, L. H., and Castellanos, J. (1987) Physiologic and 

hormonal changes in experimentally induced brain dead dogs. Transplant. Proc. 

19(5), 4156–4158. 

10. Macoviak, J. A., McDougall, I. R., Bayer, M. F., Brown, M., Tazelaar, H., and 

Stinson, E. B. (1987) Significance of thyroid dysfunction in human cardiac allograft 

procurement. Transplantation 43(6), 824–826. 

11. Mertes, P. M., el Abassi, K., Jaboin, Y., et al. (1994) Changes in hemodynamic 

and metabolic parameters following induced brain death in the pig.[see comment]. 


12. Novitzky, D., Wicomb, W. N., Cooper, D. K., and Tjaalgard, M. A.(1987) Improved 

cardiac function following hormonal therapy in brain dead pigs: relevance 

to organ donation. Cryobiology 24(1), 1–10. 

13. Bittner, H. B., Kendall, S. W., Campbell, K. A., Montine, T. J., and Van Trigt, P. 

(1995) A valid experimental brain death organ donor model. J. Heart Lung Transplant. 

14(2), 308–317. 

14. Depret, J., Teboul, J. L., Benoit, G., Mercat, A., and Richard, C. (1995) Global 

energetic failure in brain-dead patients. Transplantation 60(9), 966–971. 

15. Wicomb, W. N., Cooper, D. K., and Novitzky, D. (1986) Impairment of renal 

slice function following brain death, with reversibility of injury by hormonal 

therapy. Transplantation 41(1), 29–33. 

16. Novitzky, D., Cooper, D. K., and Reichart, B. (1987) Hemodynamic and metabolic 

responses to hormonal therapy in brain-dead potential organ donors. Transplantation 

43(6), 852–854. 

17. Howlett, T. A., Keogh, A. M., Perry, L., Touzel, R., and Rees, L. H. (1989) Anterior 

and posterior pituitary function in brain-stem-dead donors. A possible role 

for hormonal replacement therapy. Transplantation 47(5), 828–834. 

18. Gramm, H. J., Meinhold, H., Bickel, U., et al. (1992) Acute endocrine failure 

after brain death? Transplantation 54(5), 851–857.


19. Masson, F., Thicoipe, M., Gin, H., et al. (1993) The endocrine pancreas in braindead 

donors. A prospective study in 25 patients. Transplantation 56(2), 363– 

367. 

20. Harms, J., Isemer, F. E., and Kolenda, H. (1991) Hormonal alteration and pituitary 

function during course of brain-stem death in potential organ donors. Transplant. 

Proc. 23(5), 2614–2616. 

21. Arita, K., Uozumi, T., Oki, S., Kurisu, K., Ohtani, M., and Mikami, T. (1993) 

The function of the hypothalamo-pituitary axis in brain dead patients. Acta 

Neurochir. 123(1–2), 64–75. 

22. Takada, M., Nadeau, K. C., Hancock, W. W., et al. (1998) Effects of explosive 

brain death on cytokine activation of peripheral organs in the rat. Transplantation 

65(12), 1533–1542. 

23. Pratschke, J., Wilhelm, M. J., Kusaka, M., et al. (2000) Accelerated rejection of 

renal allografts from brain-dead donors. Ann. Surg. 232(2), 263–271. 

24. Pienaar, H., Schwartz, I., Roncone, A., Lotz, Z., and Hickman, R. (1990) Function 

of kidney grafts from brain-dead donor pigs. The influence of dopamine and 

triiodothyronine. Transplantation 50(4), 580–582. 

25. Valero, R. (2002) Donor management: one step forward.[comment]. Am. J. 

Transplant. 2(8), 693–694. 

26. Mackersie, R. C., Bronsther, O. L., and Shackford, S. R. (1991) Organ procurement 

in patients with fatal head injuries. The fate of the potential donor. Ann. 

Surg. 213(2), 143–150. 

27. Excell, L., Wride, P., and Russ, G. (2004)ANZOD Registry Report 2004. 

Adelaide, South Australia: The Australian & New Zealand Organ Donation Registry, 

pp. 44–48. 

28. Marshall, R., Ahsan, N., Dhillon, S., Holman, M., and Yang, H. C. (1996) Adverse 

effect of donor vasopressor support on immediate and one-year kidney allograft 

function. Surgery 120(4), 663–666. 

29. O’Brien, E. A., Bour, S. A., Marshall, R. L., Ahsan, N.m and Yang, H. C. (1996) 

Effect of use of vasopressors in organ donors on immediate function of renal 

allografts. J. Transplant Coord. 6(4), 215–216. 

30. Nakatani, T., Ishikawa, Y., Kobayashi, K., and Ozawa, K. (1991) Hepatic mitochondrial 

redox state in hypotensive brain-dead patients and an effect of dopamine 

administration. Intensive Care Med. 17(2), 103–107. 

31. Schneider, A., Toledo-Pereyra, L. H., Zeichner, W. D., Allaben, R., and Whitten, 

J. (1983) Effect of dopamine and pitressin on kidneys procured and harvested for 

transplantation. Transplantation 36(1), 110–111. 

32. Schnuelle, P., Berger, S., de Boer, J., Persijn, G., and van der Woude, F. J. (2001) 

Effects of catecholamine application to brain-dead donors on graft survival in 

solid organ transplantation.[see comment]. Transplantation 72(3), 455–463. 

33. Powner, D. J. and Darby, J. M. (2000) Management of variations in blood pressure 

during care of organ donors. Prog. Transplant. 10(1), 25–32. 

34. Powner, D. J. and Kellum, J. A. (2000) Maintaining acid-base balance in organ 

donors. Prog. Transplant. 10(2), 98–105.


35. Powner, D. J., Darby, J. M., and Stuart, S. A. (2000) Recommendations for 

mechanical ventilation during donor care. Prog. Transplant. 10(1), 33–40. 

36. Keck, T., Banafsche, R., Werner, J., Gebhard, M. M., Herfarth, C., and Klar, E. 

(2001) Desmopressin impairs microcirculation in donor pancreas and early graft 

function after experimental pancreas transplantation.[see comment]. Transplantation 

72(2), 202–209. 

37. Wagner, H. J. and Braunwald, E. (1956) The pressor effect of the antidiuretic 

principle of the posterior pituitary in orthostatic hypotension. J. Clin. Invest. 35, 

1412–1418. 

38. Yoshioka, T., Sugimoto, H., Uenishi, M., et al. (1986) Prolonged hemodynamic 

maintenance by the combined administration of vasopressin and epinephrine in 

brain death: a clinical study. Neurosurgery 18(5), 565–567. 

39. Pennefather, S. H., Bullock, R. E., Mantle, D., and Dark, J. H. (1995) Use of low 

dose arginine vasopressin to support brain-dead organ donors. Transplantation 

59(1), 58–62. 

40. Chen, J. M., Cullinane, S., Spanier, T. B., et al. (1999) Vasopressin deficiency 

and pressor hypersensitivity in hemodynamically unstable organ donors. Circulation 

100(19 Suppl.), II244–246. 

41. Manaka, D., Okamoto, R., Yokoyama, T., et al. (1992) Maintenance of liver graft 

viability in the state of brain death. Synergistic effects of vasopressin and epinephrine 

on hepatic energy metabolism in brain-dead dogs. Transplantation 53 

(3), 545–550. 

42. Kinoshita, Y., Yahata, K., Yoshioka, T., Onishi, S. and Sugimoto, T. (1990) 

Long-term renal preservation after brain death maintained with vasopressin and 

epinephrine. Transplant Int. 3(1), 15–18. 

43. Nagareda, T., Kinoshita, Y., Tanaka, A., et al. (1989) Clinicopathological study 

of livers from brain-dead patients treated with a combination of vasopressin and 

epinephrine. Transplantation 47(5), 792–797. 

44. Salim, A., Vassiliu, P., Velmahos, G. C., et al. (2001) The role of thyroid hormone 

administration in potential organ donors. Arch. Surg. 136(12), 1377–1380. 

45. Garcia-Fages, L. C., Cabrer, C., Valero, R., and Manyalich, M. (1993) Hemodynamic 

and metabolic effects of substitutive triiodothyronine therapy in organ 

donors. Transplant. Proc. 25(6), 3038–3039. 

46. Goarin, J. P., Cohen, S., Riou, B., Jet al. (1996) The effects of triiodothyronine 

on hemodynamic status and cardiac function in potential heart donors. Anesth. 

Analgesia 83(1), 41–47. 

47. Scheinkestel, C. D., Tuxen, D. V., Cooper, D. J., and Butt, W. (1995) Medical 

management of the (potential) organ donor. Anaest. Intensive Care 23(1), 51–59. 

48. Meyers, C. H., D’Amico, T. A., Peterseim, D. S., et al. (1993) Effects of triiodothyronine 

and vasopressin on cardiac function and myocardial blood flow after 

brain death.[see comment]. J. Heart Lung Transplant. 12(1 Pt. 1), 68–80. 

49. Taniguchi, S., Kitamura, S., Kawachi, K., Doi, Y., and Aoyama, N. (1992) Effects 

of hormonal supplements on the maintenance of cardiac function in potential donor 

patients after cerebral death. Eur. J. Cardio-Thorac. Surg. 6(2), 96–102.


50. Wheeldon, D. R., Potter, C. D., Oduro, A., Wallwork, J., and Large, S. R. (1995) 

Transforming the “unacceptable” donor: outcomes from the adoption of a standardized 

donor management technique. J. Heart Lung Transplant. 14(4), 734– 

742. 

51. Novitzky, D., Cooper, D. K., and Reichart, B. (1987) The value of hormonal 

therapy in improving organ viability in the transplant donor. Transplant. Proc. 

19(1 Pt. 3), 2037–2038. 

52. Novitzky, D., Cooper, D. K., Morrell, D., and Isaacs, S. (1988) Change from 

aerobic to anaerobic metabolism after brain death, and reversal following triiodothyronine 

therapy. Transplantation 45(1), 32–36. 

53. Rosendale, J. D., Kauffman, H. M., McBride, M. A., et al. (2003) Aggressive 

pharmacologic donor management results in more transplanted organs. Transplantation 

75(4), 482–487. 

54. Pratschke, J., Kofla, G., Wilhelm, M. J., et al. (2001) Improvements in early 

behavior of rat kidney allografts after treatment of the brain-dead donor. Ann. 

Surg. 234(6), 732–740. 

55. Segel, L. D., Follette, D. M., Castellanos, L. M., Hayes, R., Baker, J. M., and 

Smolens, I. V. (1997) Steroid pretreatment improves graft recovery in a sheep 

orthotopic heart transplantation model. J. Heart Lung Transplant. 16(4), 371– 

380. 

56. Follette, D. M., Rudich, S. M., and Babcock, W. D. (1998) Improved oxygenation 

and increased lung donor recovery with high-dose steroid administration 

after brain death. J. Heart Lung Transplant. 17(4), 423–429. 

57. Rosendale, J. D., Kauffman, H. M., McBride, M. A., et al. (2003) Hormonal 

resuscitation yields more transplanted hearts, with improved early function. 


58. Wicomb, W., Cooper, D. K., Hassoulas, J., Rose, A. G., and Barnard, C. N. (1982) 

Orthotopic transplantation of the baboon heart after 20 to 24 hours’ preservation 

by continuous hypothermic perfusion with an oxygenated hyperosmolar solution. 

J. Thorac. Cardiovasc. Surg. 83(1), 133–140. 

59. Wicomb, W. N., Cooper, D. K., and Barnard, C. N. (1982) Twenty-four-hour 

preservation of the pig heart by a portable hypothermic perfusion system. Transplantation 

34(5), 246–250. 

60. Wicomb, W. N. and Collins, G. M. (1989) 24-hour rabbit heart storage with UW 

solution. Effects of low-flow perfusion, colloid, and shelf storage. Transplantation 

48(1), 6–9. 

61. Nickless, D. K., Rabinov, M., Richards, S. M., Conyers, R. A., and Rosenfeldt, 

F. L. (1998) Continuous perfusion improves preservation of donor rat hearts: 

importance of the implantation phase. Ann. Thorac. Surg. 65(5), 1265–1272. 

62. Jahania, M. S., Sanchez, J. A., Narayan, P., Lasley, R. D. and Mentzer, R. M., Jr. 

(1999) Heart preservation for transplantation: principles and strategies. Ann. 

Thorac. Surg. 68(5), 1983–1987. 

63. McCrystal, G., Pepe, S., Esmore, D. and Rosenfeldt, F. (2004) The challenge of 

improving donor heart prteservation. Heart Lung Circ.13, 74–83.


64. Hendry, P. J., Anstadt, M. P., Plunkett, M. D., et al. (1990) Optimal temperature 

for preservation of donor myocardium. Circulation 82(5 Suppl.), IV306–312. 

65. Shimada, Y., Yamamoto, F., Yamamoto, H., Oka, T., and Kawashima, Y. (1996) 

Temperature-dependent cardioprotection of exogenous substrates in long-term 

heart preservation with continuous perfusion: twenty-four-hour preservation of 

isolated rat heart with St. Thomas’ Hospital solution containing glucose, insulin, 

and aspartate. J. Heart Lung Transplant. 15(5), 485–495. 

66. Lazdunski, M., Frelin, C., and Vigne, P. (1985) The sodium/hydrogen exchange 

system in cardiac cells: its biochemical and pharmacological properties and its 

role in regulating internal concentrations of sodium and internal pH. J. Mol. Cell. 

Cardiol. 17(11), 1029–1042. 

67. Karmazyn, M. (1999) The role of the myocardial sodium-hydrogen exchanger in 

mediating ischemic and reperfusion injury. From amiloride to cariporide. Ann. 

NY Acad. Sci. 874, 326–334. 

68. Verma, S., Fedak, P. W., Weisel, R. D., et al. (2002) Fundamentals of reperfusion 

injury for the clinical cardiologist. Circulation 105(20), 2332–2336. 

69. Jordan, J. E., Zhao, Z. Q., and Vinten-Johansen, J. (1999) The role of neutrophils 

in myocardial injury. Cardiovasc. Res. 43(4), 860–878. 

70. Rezkalla, S. H. and Kloner, R. A. (2002) No-reflow phenomenon.[see comment]. 

Circulation 105(5), 656–662. 

71. Pearl, J. M., Drinkwater, D. C., Jr., Laks, H., Stein, D. G., Capouya, E. R., and 

Bhuta, S. (1992) Leukocyte-depleted reperfusion of transplanted human hearts 

prevents ultrastructural evidence of reperfusion injury. J. Sur. Res. 52(4), 298– 

308. 

72. Pearl, J. M., Drinkwater, D. C., Laks, H., Capouya, E. R. and Gates, R. N. (1992) 

Leukocyte-depleted reperfusion of transplanted human hearts: a randomized, 

double-blind clinical trial. J. Heart Lung Transplant. 11(6), 1082–1092. 

73. Wallwork, J., Jones, K., Cavarocchi, N., Hakim, M., and Higenbottam, T. (1987) 

Distant procurement of organs for clinical heart-lung transplantation using a 

single flush technique. Transplantation 44(5), 654–658. 

74. Hirt, S. W., Wahlers, T., Jurmann, M., Fieguth, H. G., Dammenhayn, L., and 

Haverich, A. (1992) Improvement of currently used methods for lung preservation 

with prostacyclin and University of Wisconsin solution. J. Heart Lung Transplant. 

11(4 Pt. 1), 656–664. 

75. Nawata, S., Sugi, K., Ueda, K., Nawata, K., Kaneda, Y., and Esato, K. (1996) 

Prostacyclin analog OP2507 prevents pulmonary arterial and airway constriction 

during lung preservation and reperfusion. J. Heart Lung Transplant. 15(5), 470– 

474. 

76. Kishida, A., Kurumi, Y., and Kodama, M. (1997) Efficacy of prostaglandin I2 

analog on liver grafts subjected to 30 minutes of warm ischemia. Surg, Today 

27(11), 1056–1060. 

77. Sanchez-Urdazpal, L., Gores, G. J., Ferguson, D. M., and Krom, R. A. (1991) 

Improved liver preservation with addition of iloprost to Eurocollins and University 

of Wisconsin storage solutions. Transplantation 52(6), 1105–1107.


78. Changani, K. K., Fuller, B. J., Bell, J. D., Taylor-Robinson, S. D., Moore, D. 

P., and Davidson, B. R. (1999) Improved preservation solutions for organ 

storage: a dynamic study of hepatic metabolism. Transplantation 68(3), 345– 

355. 

79. Bhabra, M. S., Hopkinson, D. N., Shaw, T. E., and Hooper, T. L. (1996) Relative 

importance of prostaglandin/cyclic adenosine monophosphate and nitric oxide/ 

cyclic guanosine monophosphate pathways in lung preservation. Ann. Thorac. 

Surg. 62(5), 1494–1499. 

80. Du, Z. Y., Hicks, M., Jansz, P., Rainer, S., Spratt, P., and Macdonald, P. (1998) 

The nitric oxide donor, diethylamine NONOate, enhances preservation of the 

donor rat heart. J. Heart Lung Transplant. 17(11), 1113–1120. 

81. Baxter, K., Howden, B. O., and Jablonski, P. (2001) Heart preservation with 

celsior solution improved by the addition of nitroglycerine. Transplantation 71 

(10), 1380–1384. 

82. Drinkwater, D. C., Rudis, E., Laks, H., et al. (1995) University of Wisconsin 

solution versus Stanford cardioplegic solution and the development of cardiac 

allograft vasculopathy. J. Heart Lung Transplant. 14(5), 891–896. 

83. Garlicki, M. (2003) May preservation solution affect the incidence of graft 

vasculopathy in transplanted heart? Ann. Transplant. 8(1), 19–24. 

84. Demmy, T. L., Biddle, J. S., Bennett, L. E., Walls, J. T., Schmaltz, R. A., and 

Curtis, J. J. (1997) Organ preservation solutions in heart transplantation—patterns 

of usage and related survival. Transplantation 63(2), 262–269. 

85. Richens, D., Junius, F., Hill, A., Keogh, A., Macdonald, P., McGoldrick, J., and 

Spratt, P. (1993) Clinical study of crystalloid cardioplegia vs aspartate-enriched 

cardioplegia plus warm reperfusion for donor heart preservation. Transplant. 

Proc. 25(1 Pt. 2), 1608–1610. 

86. Wildhirt, S. M., Weis, M., Schulze, C., et al. (2000) Effects of Celsior and University 

of Wisconsin preservation solutions on hemodynamics and endothelial 

function after cardiac transplantation in humans: a single-center, prospective, randomized 

trial. Transplant Int. 13 (Suppl. 1), S203–211. 

87. Remadi, J. P., Baron, O., Roussel, J. C., et al. (2002) Myocardial preservation 

using Celsior solution in cardiac transplantation: early results and 5-year followup 

of a multicenter prospective study of 70 cardiac transplantations. Ann. Thorac. 

Surg. 73(5), 1495–1499. 

88. Vega, J. D., Ochsner, J. L., Jeevanandam, V., et al. (2001) A multicenter, randomized, 

controlled trial of Celsior for flush and hypothermic storage of cardiac 

allografts. Ann. Thorac. Surg. 71(5), 1442–1447. 

89. Chambers, D. J. and Hearse, D. J. (1999) Developments in cardioprotection: 

“polarized” arrest as an alternative to “depolarized” arrest. Ann. Thorac. Surg. 

68(5), 1960–1966. 

90. Suleiman, M. S., Halestrap, A. P., and Griffiths, E. J. (2001) Mitochondria: a 

target for myocardial protection. Pharmacol. Ther. 89(1), 29–46. 

91. Yang, Q., Zhang, R. Z., Yim, A. P., and He, G. W. (2004) Histidine-tryptophanketoglutarate 

solution maximally preserves endothelium-derived hyperpolarizing


factor-mediated function during heart preservation: comparison with University 

of Wisconsin solution. J. Heart Lung Transplant. 23(3), 352–59. 

92. Sorajja, P., Cable, D. G., and Schaff, H. V. (1997) Hypothermic storage with 

University of Wisconsin solution preserves endothelial and vascular smoothmuscle 

function. Circulation 96(9 Suppl.), II-297–303. 

93. von Oppell, U. O., Pfeiffer, S., Preiss, P., Dunne, T., Zilla, P., and Reichart, B. 

(1990) Endothelial cell toxicity of solid-organ preservation solutions. Ann. 

Thorac. Surg. 50(6), 902–910. 

94. Ou, R., Gavin, J. B., Esmore, D. S., and Rosenfeldt, F. L. (1999) Increased temperature 

reduces the protective effect of University of Wisconsin solution in the 

heart[see comment]. Ann. Thorac. Surg. 68(5), 1628–1635. 

95. Dobson, G. P. and Jones, M. W. (2004) Adenosine and lidocaine: a new concept 

in nondepolarizing surgical myocardial arrest, protection, and preservation. J. 

Thorac. Cardiovasc. Surg. 127(3), 794–805. 

96. Donnelly, A. J. and Djuric, M. (1991) Cardioplegia solutions. Am. J. Hosp. 

Pharm. 48(11), 2444–2460. 

97. Michel, P., Hadour, G., Rodriguez, C., Chiari, P., and Ferrera, R. (2000) Evaluation 

of a new preservative solution for cardiac graft during hypothermia. J. Heart 

Lung Transplant. 19(11), 1089–1097. 

98. Michel, P., Vial, R., Rodriguez, C., and Ferrera, R. (2002) A comparative study 

of the most widely used solutions for cardiac graft preservation during hypothermia. 

J. Heart Lung Transplant. 21(9), 1030–1039. 

99. Chen, R. H. (1996) The scientific basis for hypocalcemic cardioplegia and 

reperfusion in cardiac surgery. Ann. Thorac. Surg. 62(3), 910–914. 

100. Fukuhiro, Y., Wowk, M., Ou, R., Rosenfeldt, F., and Pepe, S. (2000) Cardioplegic 

strategies for calcium control: low Ca(2+), high Mg(2+), citrate, or Na(+)/H(+) 

exchange inhibitor HOE-642. Circulation 102(19 Suppl. 3), III319–325. 

101. McCully, J. D. and Levitsky, S. (2003) The mitochondrial K(ATP) channel and 

cardioprotection. Ann. Thorac. Surg. 75(2), S667–673. 

102. Southard, J. H., van Gulik, T. M., Ametani, M. S., et al. (1990) Important components 

of the UW solution. Transplantation 49(2), 251–257. 

103. Biguzas, M., Jablonski, P., Howden, B. O., et al. (1990) Evaluation of UW solution 

in rat kidney preservation. II. The effect of pharmacological additives. Transplantation 

49(6), 1051–1055. 

104. Kevelaitis, E., Oubenaissa, A., Mouas, C., Peynet, J., and Menasche, P. (2001) 

Ischemic preconditioning with opening of mitochondrial adenosine triphosphatesensitive 

potassium channels or Na/H exchange inhibition: which is the best protective 

strategy for heart transplants? J. Thorac. Cardiovasc. Surg. 121(1), 

155–162. 

105. Theroux, P., Chaitman, B. R., Danchin, N., et al. (2000) Inhibition of the sodiumhydrogen 

exchanger with cariporide to prevent myocardial infarction in highrisk 

ischemic situations. Main results of the GUARDIAN trial. Guard during 

ischemia against necrosis (GUARDIAN) Investigators. Circulation 102(25), 

3032–3038.


106. Cropper, J. R., Hicks, M., Ryan, J. B., and Macdonald, P. S. (2003) Cardioprotection 

by cariporide after prolonged hypothermic storage of the isolated working 

rat heart. J. Heart Lung Transplant. 22(8), 929–936. 

107. Grover, G. J., McCullough, J. R., D’Alonzo, A. J., Sargent, C. A., and Atwal, K. S. 

(1995) Cardioprotective profile of the cardiac-selective ATP-sensitive potassium channel 

opener BMS-180448. Journal of Cardiovascular Pharmacology 25(1), 40–50. 

108. Murry, C. E., Jennings, R. B., and Reimer, K. A. (1986) Preconditioning with 

ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation 74(5), 

1124–1136. 

109. Du, Z. Y., Hicks, M., Spratt, P., Mundy, J. A., and Macdonald, P. S. (1998) Cardioprotective 

effects of pinacidil pretreatment and lazaroid (U74500A) preservation 

in isolated rat hearts after 12-hour hypothermic storage. Transplantation 66 

(2), 158–163. 

110. Hicks, M., Du, Z. Y., Jansz, P., Rainer, S., Spratt, P., and Macdonald, P. S. (1999) 

ATP-sensitive potassium channel activation mimics the protective effect of 

ischaemic preconditioning in the rat isolated working heart after prolonged hypothermic 

storage. Clin. Exp. Pharm. Physiol. 26(1), 20–25. 

111. Cropper, J. R., Hicks, M., Ryan, J. B., and Macdonald, P. S. (2003) Enhanced 

cardioprotection of the rat heart during hypothermic storage with combined Na+ - 

H+ exchange inhibition and ATP-dependent potassium channel activation. J. Heart 

Lung Transplant. 22(11), 1245–1253. 

112. Pinelli, G., Mertes, P. M., Carteaux, J. P., et al. (1995) Myocardial effects of 

experimental acute brain death: evaluation by hemodynamic and biological studies. 

Ann. Thorac. Surg. 60(6), 1729–1734. 

113. Halejcio-Delophont, P., Siaghy, E. M., Devaux, Y., et al. (1998) Increase in myocardial 

interstitial adenosine and net lactate production in brain-dead pigs: an in 

vivo microdialysis study. Transplantation 66(10), 1278–1284. 

114. Toyoda, Y., Levitsky, S., and McCully, J. D. (2001) Opening of mitochondrial 

ATP-sensitive potassium channels enhances cardioplegic protection. Ann. Thorac. 

Surg. 71(4), 1281–1289. 

115. Ryan, J. B., Hicks, M., Cropper, J. R., et al. (2003) Sodium-hydrogen exchanger 

inhibition, pharmacologic ischemic preconditioning, or both for extended cardiac 

allograft preservation. Transplantation 76(5), 766–771. 

116. Thabut, G., Vinatier, I., Stern, J. B., et al. (2002) Primary graft failure following lung 

transplantation: predictive factors of mortality[see comment]. Chest 121(6), 1876–1882. 

117. Fiser, S. M., Tribble, C. G., Long, S. M., et al. (2002) Ischemia-reperfusion injury 

after lung transplantation increases risk of late bronchiolitis obliterans syndrome. 


118. Hopkinson, D. N., Bhabra, M. S., and Hooper, T. L. (1998) Pulmonary graft preservation: 

a worldwide survey of current clinical practice. J. Heart Lung Transplant. 

17(5), 525–531. 

119. Novick, R. J., Reid, K. R., Denning, L., Duplan, J., Menkis, A. H., and McKenzie, 

F. N. (1991) Prolonged preservation of canine lung allografts: the role of prostaglandins. 

Ann. Thorac. Surg. 51(5), 853–859.


120. Bonser, R. S., Fragomeni, L. S., Jamieson, S. W., et al (1991) Effects of prostaglandin 

E1 in twelve-hour lung preservation. J. Heart Lung Transplant. 10(2), 310–316. 

121. Sarsam, M. A., Yonan, N. A., Deiraniya, A. K., and Rahman, A. N. (1993) Retrograde 

pulmonaryplegia for lung preservation in clinical transplantation: a new technique. 

J. Heart Lung Transplant. 12(3), 494–498. 

122. Varela, A., Cordoba, M., Serrano-Fiz, S., et al. (1997) Early lung allograft function 

after retrograde and antegrade preservation. J. Thorac. Cardiovasc. Surg. 114(6), 

1119–1120. 

123. Venuta, F., Rendina, E. A., Bufi, M., et al. (1999) Preimplantation retrograde 

pneumoplegia in clinical lung transplantation. [see comment]. J. Thorac. Cardiovasc. 

Surg. 118(1), 107–114. 

124. Steen, S., Kimblad, P. O., Sjoberg, T., Lindberg, L., Ingemansson, R., and Massa, 

G. (1994) Safe lung preservation for twenty-four hours with Perfadex. [see comment]. 


125. Homatas, J., Bryant, L., and Eiseman, B. (1968) Time limits of cadaver lung 

viability. J. Thorac. Cardiovasc. Surg. 56(1), 132–140. 

126. Veith, F. J., Sinha, S. B., Graves, J. S., Boley, S. J., and Dougherty, J. C. (1971) 

Ischemic tolerance of the lung. The effect of ventilation and inflation. J. Thorac. 

Cardiovasc. Surg. 61(5), 804–810. 

127. Stevens, G. H., Sanchez, M. M., and Chappell, G. L. (1973) Enhancement of lung 

preservation by prevention of lung collapse. J. Surg. Res. 14(5), 400–405. 

128. Puskas, J. D., Hirai, T., Christie, N., Mayer, E., Slutsky, A. S., and Patterson, G. A. 

(1992) Reliable thirty-hour lung preservation by donor lung hyperinflation. J. 


129. DeCampos, K. N., Keshavjee, S., Liu, M., and Slutsky, A. S. (1998) Optimal 

inflation volume for hypothermic preservation of rat lungs. J. Heart Lung Transplant. 

17(6), 599–607. 

130. Haniuda, M., Hasegawa, S., Shiraishi, T., Dresler, C. M., Cooper, J. D., and 

Patterson, G. A. (1996) Effects of inflation volume during lung preservation on 

pulmonary capillary permeability. J. Thorac. Cardiovasc. Surg. 112(1), 85–93. 

131. Aoe, M., Okabayashi, K., Cooper, J. D., and Patterson, G. A. (1996) Hyperinflation 

of canine lung allografts during storage increases reperfusion pulmonary 

edema. J. Thorac. Cardiovasc. Surg. 112(1), 94–102. 

132. De Leyn, P. R., Lerut, T. E., Schreinemakers, H. H., Van Raemdonck, D. E., 

Mubagwa, K., and Flameng, W. (1993) Effect of inflation on adenosine triphosphate 

catabolism and lactate production during normothermic lung ischemia. 


133. Date, H., Matsumura, A., Manchester, J. K., Cooper, J. M., Lowry, O. H., and Cooper, 

J. D. (1993) Changes in alveolar oxygen and carbon dioxide concentration and 

oxygen consumption during lung preservation. The maintenance of aerobic metabolism 

during lung preservation. J. Thorac. Cardiovasc. Surg. 105(3), 492–501. 

134. Fisher, A. B., Dodia, C., Tan, Z. T., Ayene, I., and Eckenhoff, R. G. (1991) Oxygen-dependent 

lipid peroxidation during lung ischemia. J. Clin. Invest. 88(2), 674– 

679.


135. Haniuda, M., Dresler, C. M., Mizuta, T., Cooper, J. D., and Patterson, G. A. (1995) 

Free radical-mediated vascular injury in lungs preserved at moderate hypothermia. 


136. Feeley, T. W., Mihm, F. G., Downing, T. P., et al. (1985) The effect of hypothermic 

preservation of the heart and lungs on cardiorespiratory function following 

canine heart-lung transplantation. Ann. Thorac. Surg. 39(6), 558–562. 

137. Muller, C., Hoffmann, H., Bittmann, I., et al. (1997) Hypothermic storage alone 

in lung preservation for transplantation: a metabolic, light microscopic, and 

functional analysis after 18 hours of preservation. Transplantation 63(5), 625– 

630. 

138. Wang, L. S., Yoshikawa, K., Miyoshi, S., et al. (1989) The effect of ischemic 

time and temperature on lung preservation in a simple ex vivo rabbit model used 

for functional assessment. J. Thorac. Cardiovasc. Surg. 98(3), 333–342. 

139. Shiraishi, T., Igisu, H., and Shirakusa, T. (1994) Effects of pH and temperature 

on lung preservation: a study with an isolated rat lung reperfusion model. Ann. 

Thorac. Surg. 57(3), 639–643. 

140. Kelly, R. F. (2000) Current strategies in lung preservation. J. Lab. Clin. Med. 

136(6), 427–440. 

141. Du, Z. Y., Hicks, M., Winlaw, D., Spratt, P., and Macdonald, P. (1996) Ischemic 

preconditioning enhances donor lung preservation in the rat. J. Heart Lung Transplant. 

15(12), 1258–1267. 

142. Al-Mehdi, A. B., Zhao, G., Dodia, C., et al. (1998) Endothelial NADPH oxidase 

as the source of oxidants in lungs exposed to ischemia or high K+. Circ. Res. 83 

(7), 730–737. 

143. Eppinger, M. J., Jones, M. L., Deeb, G. M., Bolling, S. F., and Ward, P. A. (1995) 

Pattern of injury and the role of neutrophils in reperfusion injury of rat lung. J. 

Surg. Res. 58(6), 713–718. 

144. Eppinger, M. J., Deeb, G. M., Bolling, S. F., and Ward, P. A. (1997) Mediators 

of ischemia-reperfusion injury of rat lung. Am. J. Pathol. 150(5), 1773–1784. 

145. Nezu, K., Kushibe, K., Tojo, T., et al. (1994) Protection against lipid peroxidation 

induced during preservation of lungs for transplantation. J. Heart Lung Transplant. 

13(6), 998–1002. 

146. Du, Z., Hicks, M., Winlaw, D., Macdonald, P., and Spratt, P. (1995) Lazaroid 

U74500A enhances donor lung preservation in the rat transplant model. Transplant. 

Proc. 27(6), 3574–3577. 

147. Breda, M. A., Hall, T. S., Stuart, R. S., et al. (1985) Twenty-four hour lung preservation 

by hypothermia and leukocyte depletion. J. Heart Transplant. 4(3), 325– 

329. 

148. Pillai, R., Bando, K., Schueler, S., Zebly, M., Reitz, B. A., and Baumgartner, W. 

A. (1990) Leukocyte depletion results in excellent heart-lung function after 12 

hours of storage. Ann. Thorac. Surg. 50(2), 211–214. 

149. Adatia, I., Lillehei, C., Arnold, J. H., et al. (1994) Inhaled nitric oxide in the 

treatment of postoperative graft dysfunction after lung transplantation. Ann. 

Thorac. Surg. 57(5), 1311–138.


150. Macdonald, P., Mundy, J., Rogers, P., et al. (1995) Successful treatment of lifethreatening 

acute reperfusion injury after lung transplantation with inhaled nitric 

oxide. J. Thorac. Cardiovasc. Surg. 110(3), 861–863. 

151. Chetham, P. M., Sefton, W. D., Bridges, J. P., Stevens, T., and McMurtry, I. F. 

(1997) Inhaled nitric oxide pretreatment but not posttreatment attenuates ischemiareperfusion-induced 

pulmonary microvascular leak. Anesthesiology 86(4), 895– 

902. 

152. Struber, M., Harringer, W., Ernst, M., et al. (1999) Inhaled nitric oxide as a prophylactic 

treatment against reperfusion injury of the lung. Thorac. Cardiovasc. 

Surg. 47(3), 179–82. 

153. Eppinger, M. J., Ward, P. A., Jones, M. L., Bolling, S. F., and Deeb, G. M. (1995) 

Disparate effects of nitric oxide on lung ischemia-reperfusion injury. Ann. 

Thorac. Surg. 60(5), 1169–1176. 

154. Meade, M. O., Granton, J. T., Matte-Martyn, A., et al. (2003) A randomized trial of 

inhaled nitric oxide to prevent ischemia-reperfusion injury after lung 

transplantation.[see comment]. Am. J. Respir. Crit. Care Med. 167(11), 1483–1489. 

155. Novick, R. J., Possmayer, F., Veldhuizen, R. A., Menkis, A. H., and McKenzie, 

F. N. (1991) Surfactant analysis and replacement therapy: a future tool of the 

lung transplant surgeon? Ann. Thorac. Surg. 52(5), 1194–1200. 

156. Buchanan, S. A., Mauney, M. C., Parekh, V. I., et al. (1996) Intratracheal surfactant 

administration preserves airway compliance during lung reperfusion. Ann. 

Thorac. Surg. 62(6), 1617–1621. 

157. Struber, M., Hirt, S. W., Cremer, J., Harringer, W., and Haverich, A. (1999) 

Surfactant replacement in reperfusion injury after clinical lung transplantation. 

Intens. Care Med. 25(8), 862–864. 

158. Struber, M., Brandt, M., Cremer, J., Harringer, W., Hirt, S. W., and Haverich, A. 

(1996) Therapy for lung failure using nitric oxide inhalation and surfactant 

replacement[see comment]. Ann. Thorac. Surg. 61(5), 1543–1545. 

159. Della Rocca, G., Pierconti, F., Costa, M. G., et al. (2002) Severe reperfusion 

lung injury after double lung transplantation [see comment]. Cri. Care (Lond.) 6 

(3), 240–244. 

160. Bhabra, M. S., Hopkinson, D. N., Shaw, T. E., Onwu, N., and Hooper, T. L. (1998) 

Controlled reperfusion protects lung grafts during a transient early increase in 

permeability[see comment]. Ann. Thorac. Surg. 65(1), 187–192. 

161. Hopkinson, D. N., Bhabra, M. S., Odom, N. J., Bridgewater, B. J., Van Doorn, C. 

A., and Hooper, T. L. (1996) Controlled pressure reperfusion of rat pulmonary 

grafts yields improved function after twenty-four-hours’ cold storage in University 

of Wisconsin solution. J. Heart Lung Transplant. 15(3), 283–290. 

162. Halldorsson, A., Kronon, M., Allen, B. S., et al. (1998) Controlled reperfusion 

after lung ischemia: implications for improved function after lung transplantation. 


163. Halldorsson, A. O., Kronon, M., Allen, B. S., et al. (1998) Controlled reperfusion 

prevents pulmonary injury after 24 hours of lung preservation. [see comment]. 

Ann. Thorac. Surg. 66(3), 877–885.


164. Lick, S. D., Brown, P. S., Jr., Kurusz, M., et al. (2000) Technique of controlled 

reperfusion of the transplanted lung in humans [see comment]. Ann. Thorac. Surg. 

69(3), 910–912. 

165. Kurusz, M., Roach, J. D., Jr., Vertrees, R. A., Girouard, M. K., and Lick, S. D. 

(2002) Leukocyte filtration in lung transplantation. Perfusion 17(Suppl.), 63– 

67. 

166. Kondo, Y., Turner, M. D., Cockrell, J. V., and Hardy, J. D. (1974) Ischemic 

tolerance of the canine autotransplanted lung. Surgery 76(3), 447–453. 

167. Veith, F. J., Crane, R., Torres, M., et al. (1976) Effective preservation and transportation 

of lung transplants. J. Thorac. Cardiovasc. Surg. 72(1), 97–105. 

168. Bresticker, M. A., LoCicero, J., 3rd, Oba, J., and Greene, R. (1992) Successful 

extended lung preservation with UW solution. Transplantation 54(5), 780–784. 

169. Kawahara, K., Ikari, H., Hisano, H., et al. (1991) Twenty-four-hour canine lung 

preservation using UW solution. Transplantation 51(3), 584–587. 

170. Oka, T., Puskas, J. D., Mayer, E., et al. (1991) Low-potassium UW solution for 

lung preservation. Comparison with regular UW, LPD, and Euro-Collins solutions. 


171. Sasaki, S., Yasuda, K., McCully, J. D., and LoCicero, J., 3rd (1999) Does PGE1 

attenuate potassium-induced vasoconstriction in initial pulmonary artery flush 

on lung preservation? J. Heart Lung Transplant. 18(2), 139–142. 

172. Kukkonen, S., Heikkila, L. J., Verkkala, K., Mattila, S. P., and Toivonen, H. 

(1995) Prostaglandin E1 or prostacyclin in Euro-Collins solution fails to improve 

lung preservation. Ann. Thorac. Surg. 60(6), 1617–1622. 

173. Sasaki, S., Yasuda, K., McCully, J. D., and LoCicero, J., 3rd (1999) Calcium 

channel blocker enhances lung preservation. J. Heart Lung Transplant. 18(2), 

127–132. 

174. Kelly, R. F., Murar, J., Hong, Z., et al. (2003) Low potassium dextran lung preservation 

solution reduces reactive oxygen species production. Ann. Thorac. Surg. 

75(6), 1705–1710. 

175. Zoucas, E., Goransson, G., and Bengmark, S. (1984) Colloid-induced changes in 

bleeding following liver resection in the rat. Res. Exp. Med. 184(4), 251–258. 

176. Fatkin, D., Loupas, T., Low, J., and Feneley, M. (1997) Inhibition of red cell 

aggregation prevents spontaneous echocardiographic contrast formation in human 

blood. Circulation 96(3), 889–896. 

177. Keshavjee, S. H., Yamazaki, F., Cardoso, P. F., McRitchie, D. I., Patterson, G. 

A., and Cooper, J. D. (1989) A method for safe twelve-hour pulmonary preservation. 


178. Sasaki, S., McCully, J. D., Alessandrini, F., and LoCicero, J., 3rd (1995) Impact 

of initial flush potassium concentration on the adequacy of lung preservation. J. 


179. Hausen, B., Beuke, M., Schroeder, F., et al. (1997) In vivo measurement of lung 

preservation solution efficacy: comparison of LPD, UW, EC and low K+-EC 

following short and extended ischemia. Eur. J. Cardio-Thorac. Surg. 12(5), 771– 

780.


180. Carbognani, P., Rusca, M., Solli, P., et al. (1997) Pneumocytes type II ultrastructural 

modifications after storage in preservation solutions for transplantation. Eur. 

Surg. Res. 29(5), 319–326. 

181. Aziz, T. M., Pillay, T. M., Corris, P. A., et al. (2003) Perfadex for clinical lung 

procurement: is it an advance? Ann. Thorac. Surg. 75(3), 990–995. 

182. Fischer, S., Matte-Martyn, A., De Perrot, M., et al. (2001) Low-potassium dextran 

preservation solution improves lung function after human lung transplantation. 


183. Muller, C., Furst, H., Reichenspurner, H., Briegel, J., Groh, J., and Reichart, B. 

(1999) Lung procurement by low-potassium dextran and the effect on preservation 

injury. Munich Lung Transplant Group. Transplantation 68(8), 1139–1143. 

184. Struber, M., Wilhelmi, M., Harringer, W., et al. (2001) Flush perfusion with low 

potassium dextran solution improves early graft function in clinical lung transplantation. 

Eur. J. Cardio-Thorac. Surg. 19(2), 190–194. 

185. Muller, C., Bittmann, I., Hatz, R., et al. (2002) Improvement of lung preservation—from 

experiment to clinical practice. Eu. Sur. Res. 34(1–2), 77–82. 

186. Rabanal, J. M., Ibanez, A. M., Mons, R., et al. (2003) Influence of preservation 

solution on early lung function (Euro-Collins vs Perfadex) Transplant. Proc. 

35(5), 1938–1939. 

187. Wagner, F. M., Jamieson, S. W., Fung, J., Wolf, P., Reichenspurner, H., and 

Kaye, M. P. (1995) A new concept for successful long-term pulmonary preservation 

in a dog model. Transplantation 59(11), 1530–1536. 

188. Wittwer, T., Albes, J. M., Fehrenbach, A., et al. (2003) Experimental lung preservation 

with Perfadex: effect of the NO-donor nitroglycerin on postischemic 

outcome. J. Thorac. Cardiovasc. Surg. 125(6), 1208–1216. 

189. Wittwer, T., Wahlers, T., Fehrenbach, A., Elki, S. and Haverich, A. (1999) Improvement 

of pulmonary preservation with Celsior and Perfadex: impact of storage time on 

early post-ischemic lung function. J. Heart Lung Transplant. 18(12), 1198–11201. 

190. Xiong, L., Legagneux, J., Wassef, M., et al. (1999) Protective effects of Celsior 

in lung transplantation. J. Heart Lung Transplant. 18(4), 320–327. 

191. Warnecke, G., Struber, M., Hohlfeld, J. M., Niedermeyer, J., Sommer, S. P., and 

Haverich, A. (2002) Pulmonary preservation with Bretscheider’s HTK and Celsior 

solution in minipigs. Eur. J. Cardio-Thorac. Surg. 21(6), 1073–1079. 

192. Thabut, G., Vinatier, I., Brugiere, O., et al. (2001) Influence of preservation solution 

on early graft failure in clinical lung transplantation. Am. J. Respir. Crit. 

Care Med. 164(7), 1204–1208. 

193. Levine, S. M. and Transplant/Immunology Network of the American College of 

Chest, P. (2004) A survey of clinical practice of lung transplantation in North 

America[see comment]. Chest 125(4), 1224–1238. 

194. Kootstra, G. (1997) The asystolic, or non-heartbeating, donor. Transplantation 

63(7), 917–921. 

195. Egan, T. M., Lambert, C. J., Jr., Reddick, R., Ulicny, K. S., Jr., Keagy, B. A. and 

Wilcox, B. R. (1991) A strategy to increase the donor pool: use of cadaver lungs 

for transplantation. Ann. Thorac. Surg. 52(5), 1113–1121.


196. Aitchison, J. D., Orr, H. E., Flecknell, P. A., Kirby, J. A. and Dark, J. H. (2001) 

Functional assessment of non-heart-beating donor lungs: prediction of post-transplant 

function. Eur. J. Cardio-Thorac. Surg. 20(1), 187–194. 

197. Bacha, E. A., Sellak, H., Murakami, S., et al. (1997) Inhaled nitric oxide attenuates 

reperfusion injury in non-heartbeating-donor lung transplantation. Paris-Sud 

University Lung Transplantation Group. Transplantation 63(10), 1380–1386. 

198. Luh, S. P., Tsai, C. C., Shau, W. Y., et al. (2000) The effects of inhaled nitric 

oxide, gabexate mesilate, and retrograde flush in the lung graft from non-heart 

beating minipig donors. Transplantation 69(10), 2019–2027. 

199. Naka, Y., Chowdhury, N. C., Liao, H., et al. (1995) Enhanced preservation of 

orthotopically transplanted rat lungs by nitroglycerin but not hydralazine. Requirement 

for graft vascular homeostasis beyond harvest vasodilation. Circ. Res. 76(5), 

900–906. 

200. Loehe, F., Preissler, G., Annecke, T., Bittmann, I., Jauch, K. W. and Messmer, 

K. (2004) Continuous infusion of nitroglycerin improves pulmonary graft function 

of non-heart-beating donor lungs. Transplantation 77(12), 1803–1808. 

201. Siegmund, B., Klietz, T., Schwartz, P. and Piper, H. M. (1991) Temporary contractile 

blockade prevents hypercontracture in anoxic-reoxygenated 

cardiomyocytes. Am. J. Physiol. 260(2 Pt. 2), H426–435. 

202. Garcia-Dorado, D., Theroux, P., Duran, J. M., et al. (1992) Selective inhibition 

of the contractile apparatus. A new approach to modification of infarct size, infarct 

composition, and infarct geometry during coronary artery occlusion and 

reperfusion. Circulation 85(3), 1160–1174. 

203. Warnecke, G., Schulze, B., Hagl, C., Haverich, A. and Klima, U. (2002) Improved 

right heart function after myocardial preservation with 2,3-butanedione 2monoxime 

in a porcine model of allogenic heart transplantation. J. Thorac. 

Cardiovasc. Surg. 123(1), 81–88. 

204. Okada, K., Yamashita, C., and Okada, M. (1996) Efficacy of oxygenated University 

of Wisconsin solution containing endothelin-A receptor antagonist in 

twenty-four-hour heart preservation. J. Heart Lung Transplant. 15(5), 475–484. 

205. Ryan, J. B., Hicks, M., Cropper, J. R., et al. (2003) Cariporide (HOE-642) 

improves cardiac allograft preservation in a porcine model of orthotopic heart 

transplantation. Transplantation 75(5), 625–631. 

206. Hashimoto, N., Takeyoshi, I., Yoshinari, D., et al. (2002) Effects of a p38 mitogen-activated 

protein kinase inhibitor as an additive to Euro-Collins solution on 

reperfusion injury in canine lung transplantation1. Transplantation 74(3), 320– 

326. 

207. Roberts, J. R., Rowe, P. A., and Demaine, A. G. (2002) Activation of NF-kappaB 

and MAP kinase cascades by hypothermic stress in endothelial cells. Cryobiology 

44(2), 161–169. 

208. Tsuchihashi, S., Tamaki, T., Tanaka, M., et al. (2003) Pyrrolidine dithiocarbamate 

provides protection against hypothermic preservation and transplantation 

injury in the rat liver: the role of heme oxygenase-1. Surgery 133(5), 

556–567.

209. Szabo, G., Soos, P., Bahrle, S., et al. (2004) Role of poly(ADP-ribose) polymerase 

activation in the pathogenesis of cardiopulmonary dysfunction in a canine model 

of cardiopulmonary bypass. Eur. J. Cardio-Thorac. Surg. 25(5), 825–832. 

210. Mangino, M. J., Ametani, M., Szabo, C., and Southard, J. H. (2004) Poly(ADPribose) 

polymerase and renal hypothermic preservation injury. Am. J. Physiol. 

Renal Fluid . Electrolyte Physiol. 286(5), F838–847. 

211. Ahlenstiel, T., Burkhardt, G., Kohler, H., and Kuhlmann, M. K. (2003) 

Bioflavonoids attenuate renal proximal tubular cell injury during cold preservation 

in Euro-Collins and University of Wisconsin solutions. Kidney Int. 63(2), 

554–563. 

212. Omasa, M., Fukuse, T., Matsuoka, K., Inui, K., Hyon, S. H., and Wada, H. (2003) 

Effect of green tea extracted polyphenol on ischemia/reperfusion injury after cold 

preservation of rat lung. Transplant. Proc. 35(1), 138–139. 

213. Du, Z., Hicks, M., and Macdonald, P. (1997) Enhanced preservation of the rat 

heart after prolonged hypothermic storage with the 21-aminosteroid compound 

U74500A. Asia Pacific Heart J. 6, 184–189. 

214. Ryan, J. B., Hicks, M., Cropper, J. R., et al. (2003) Lazaroid (U74389G)-supplemented 

cardioplegia: results of a double-blind, randomized, controlled trial in a 

porcine model of orthotopic heart transplantation. J. Heart Lung Transplant. 

22(3), 347–356.

Pharmacological Manipulation of the Rejection Response 375 

16 

Pharmacological Manipulation of the Rejection Response 

Peter Mark Anthony Hopkins 

Summary 

Immunosuppressive strategies continue to evolve, with a number of new formulations 

having been developed in recent years. Although acute rejection rates may have 

diminished, current protocols of immunosuppression for chronic organ rejection are 

clearly inadequate. This complication remains the primary cause of graft loss months to 

years after solid organ transplant. In summary, the overall goal of achieving immune 

tolerance remains elusive. This chapter will focus on the pharmacological manipulation 

of the rejection response, reviewing historical and current recommended protocols. A 

brief outline of potential future pathways of targeted immunosuppression is described. 

Key Words: Immunosuppression; acute rejection; chronic rejection. 


Descriptions of solid organ transplant rejection have classically recognized 

three distinct categories, including hyperacute, acute, and chronic rejection (1). 

Hyperacute rejection is mediated through the presence of preexisting circulating 

antidonor human leukocyte antigen (HLA) antibodies in the recipient or 

occurs as a consequence of inadvertent ABO blood group incompatibility. The 

routine pretransplant screening of recipient serum by the panel reactive antibody 

(PRA) test and subsequent prospective crossmatch in sensitized patients 

has virtually eliminated this complication (1). Chronic rejection of the transplanted 

organ has complex immunopathogenesis including sustained T-cell 

activation by donor major histocompatibility complex (MHC) antigens and 

development of non-MHC recipient alloantibodies. This alloimmune reaction 

may be facilitated by the generation of adhesion molecules including vascular 

cell adhesion molecule (VCAM-1) and integrins on the lymphocyte cell surface 

(2–5). Infections (particularly cytomegalovirus [CMV]) posttransplant and 



375

376 Hopkins 

the extent of cold ischemia at the time of organ harvest may further influence 

the evolution to chronic allograft rejection. The histological features of chronic 

rejection in solid organ transplantation include fibrosis, chronic inflammation, 

and a number of nonimmunological cell types such as fibroblasts, smooth 

muscle cells, and macrophages. Current protocols of nontargeted immunosuppression 

for chronic rejection are clearly insufficient for prevention of this complication 

because it remains the primary cause of graft loss months to years 

post-solid organ transplant (6). 

Acute rejection (AR) is an immunological process of cell-mediated inflammation 

of an organ recognized as foreign by the recipient. The majority of donor 

proteins recognized as non-self are encoded by the HLA complex (1). Recipient 

T-lymphocytes are the dominant effector cell and may recognize donor peptides 

via two pathways known as direct and indirect alloantigen recognition. 

Facilitating T-lymphocyte binding to antigen and MHC molecules is the T-cell 

receptor, which consists in part of the cluster designation (CD) determinant 

CD3 transmembrane complex. Direct alloantigen recognition refers to a process 

whereby the recipient T-cell receptor engages directly with donor HLA 

material expressed on a donor-derived antigen-presenting cell (APC). In indirect 

recognition the donor HLA molecule is processed into small peptides 

within the interior of a recipient APC and then placed within the groove of a 

recipient HLA molecule (7). Regardless of the relative contribution of each 

pathway in allograft rejection, T-cell activation is followed by signal transduction, 

gene transcription, and cytokine production, which includes interleukins 

(ILs), interferon (IFN)-γ, tumor necrosis factor (TNF), and transforming growth 

factor-β. The different patterns of lymphokine secretion emphasize distinct 

functional properties of each T-lymphocyte (8,9). Pharmacological manipulation 

of the rejection response therefore targets the following areas: 

1. Production and release of cytokines from activated T-cells 

2. Downregulation and inhibition of T-cell surface receptors 

3. Inhibition of lymphocyte and nonimmune cell proliferation 

4. Absolute T- and B-cell depletion 

The majority of solid organ transplant recipients experience at least one episode 

of AR regardless of the immunosuppressive regimen employed. In a 

recently published prospective series of transbronchial lung biopsy in lung and 

heart–lung transplant recipients (10), only 23% of patients remained free of 

AR at 12 mo posttransplant. The average number of rejection episodes per 

patient was just over one, with a significant proportion occurring beyond 12 

mo (14.5%) independent of prior rejection history. AR was most frequently 

observed in the first postoperative month with 26% (63 of 241) of all cases 

detected. Only 6.1% (28 of 462) of surveillance procedures in asymptomatic 

patients between 4 and 12 mo posttransplant confirmed AR. Nonetheless, AR


remains an ongoing risk throughout the life of the transplanted organ. Strategies 

directed against rejection consist primarily of prevention through induction 

and maintenance immunosuppression, complemented by augmentation of 

immune therapy during acute episodes. 

2. Prevention of Acute Rejection 

2.1. Induction Therapy 

Historically, induction therapy refers to antilymphocyte sera (ALS) preparations 

commenced peri-operatively with a view to depleting circulating T lymphocytes, 

thereby boosting initial regimens and inducing a state of immune 

tolerance. Polyclonal antilymphocyte preparations were introduced to organ 

transplantation in 1967 (11), with a view to supplementing existing dual immunosuppression 

of azathioprine and prednisone. A variety of animals have been 

used to generate these antibody products, including rabbit (thymoglobulin and 

rabbit antithymocyte globulin [RATG]) and horse (antithymocyte gammaglobulin 

[ATGAM] and lymphoglobulin). Polyclonal ALS target multiple Tcell 

surface molecules including CD2, CD3, CD4, CD8, CD25, CD40, and 

CD54 (12,13). Unfortunately, in the production of these antilymphocyte sera, 

antibodies may evolve to most T-cell lines, B cells, and nonlymphoid populations. 

The result is global immunosuppression with an excess risk of opportunistic 

infections (14–16), especially CMV, malignancy, particularly Epstein– 

Barr virus-induced posttransplant lymphoproliferative disease (PTLD), and 

bone marrow suppression with thrombocytopenia and leukopenia. In addition, 

transient increases in serum cytokine levels, including IL-1, IL-6, TNF, and 

IFN-γ, accompany first-dose infusions of ALS (17–19). Clinically, this manifests 

as fever and chills in the majority of recipients and sometimes nausea, 

diarrhea, headache, bronchospasm, and, rarely, profound hypotension. Anaphylactic 

reactions and serum sickness are infrequent complications and respond to 

cessation of the ALS infusion and high-dose steroids. 

In 1981 a murine-derived monoclonal antibody (MAb) called OKT3 was 

introduced into protocols for the treatment of renal allograft rejection and potentially 

induction therapy (20). This compound specifically targeted the CD3 complex 

associated with the T-cell receptor expressed on all mature T lymphocytes. 

Binding with OKT3 is followed by opsonization and then subsequent complement-mediated 

and cell-mediated antibody-dependent cytolysis and destruction 

of T cells (21). Nonetheless, OKT3 is a pan-T-cell antibody and therefore suppresses 

all aspects of T-cell immunity with increased risk of CMV and PTLD 

posttransplant similar to polyclonal products. Similar to other ALS preparations, 

OKT3 administration may be complicated by a cytokine-release syndrome and, 

rarely, aseptic meningitis or encephalopathy (22,23). Sensitization may occur 

with the formation of human anti-mouse antibodies with prolonged (>10–14 d)

378 Hopkins 

or sequential administration (24), potentially reducing clinical efficacy and causing 

a serum sickness syndrome. Measurement of the CD3 + peripheral blood lymphocyte 

count is the preferred monitoring tool for all ALS preparations. 

Appropriate targets are a CD3 + count of more than5% of total lymphocyte numbers 

or an absolute count of between 50 and 100 cells per microliter (25). 

Early studies demonstrated a significant benefit from induction therapy in 

delaying the onset of AR episodes in renal transplant recipients (26,27). However, 

the addition of cyclosporine to immunosuppressive regimens in 1978 transformed 

postoperative protocols and prompted many transplant centers to scale 

back the routine use of cytolytic induction therapy. Subsequently, multiple studies 

in renal, liver, cardiac, and lung transplantation (28–31) have reported no 

significant benefit to ALS in improving graft function or survival and variable 

reduction in overall frequency of rejection compared with standard triple immunosuppression 

(cyclosporine, azathioprine, and prednisone). A recent prospective 

randomized trial in lung transplant recipients comparing no induction 

therapy with RATG showed no statistically significant difference in freedom 

from AR at 6 mo. A clearly higher incidence and earlier occurrence of CMV 

infection was observed in the ATG group (32). Although the routine use of 

ALS is diminishing, there are certain clinical situations in which peri-operative 

use may be desirable. These include patients with significant renal impairment 

either pre- or early posttransplant as a strategy to reduce exposure to cyclosporine, 

those with a PRA level of greater than 5%, and patients with a positive 

donor crossmatch (33). 

An alternative approach to induction therapy is the selected neutralization of 

activated T lymphocytes reactive specifically against the allograft. IL-2 plays a 

key role in graft rejection, and IL-2 receptors (CD25) are selectively expressed 

on the surface of only activated T lymphocytes. Therefore, a direct approach 

toward targeted immunosuppression is the development of anti-CD25 MAb to 

competitively inhibit the binding between IL-2 and its receptor (34). Basiliximab 

(Simulect, Novartis) and daclizumab (Zenopax, Roche) are registered chimeric 

human/mouse antibodies directed against the α chain (Tac subunit) of the IL-2 

receptor. Comparison of induction therapy with anti-CD25 MAbs is outlined 

in Table 1. Theoretically, these agents are immunogenic, although their small 

murine sequences are restricted to the variable region of the immunoglobulin 

chain. The development of human antimouse antibodies is generally less than 

1% and is not felt to be clinically relevant. Both basiliximab and dacluzimab are 

designed to be administered concurrently with a calcineurin inhibitor to decrease 

IL-2 production and provide a synergistic effect (35–38). However, Cantarovich 

et al. have described the successful implementation of anti-CD25 MAb therapy 

early posttransplant to allow for a calcineurin inhibitor “holiday” in solid-organ 

transplant recipients with acute renal dysfunction (39).


Table 1 

Comparison of Anti-IL-2-Receptor (CD25) Monoclonal Antibodies 

Property Daclizumab Basiliximab 

MAb type Humanized a Chimeric 

Dose 1 mg/kg iv 20 mg iv 

Half-life 20 d 7 d 

Regimen 5 injections: wk 0, 2, 4, 6, 8 2 injections: d 0, 4 

Safety +++ +++ 

Tolerability Good Good 

Immunogenicity Low Low 

Drug interactions Nil Nil 

Significant depletion of T cells does not occur with CD25 MAbs because 

peripheral CD3 counts remain stable. The humanized nature of the antibody, 

along with an absence of global T-cell suppression, contributes to their excellent 

side-effect profile and low incidence of opportunistic infection. In a doubleblind 

placebo-controlled multicenter trial in 260 renal transplant recipients, the 

incidence of biopsy confirmed that AR at 12 mo was significantly reduced when 

daclizumab was added to standard immunosuppression of cyclosporine, azathioprine, 

and prednisone (22 vs 35%; p < 0.03). No difference was observed in 

the incidence of malignancy or opportunistic infection, and graft survival was 

similar at 12 mo (40). Immunoprophylaxis with basiliximab in combination 

with azathioprine-based triple immunosuppression in liver transplant recipients 

has also shown increased efficacy in the prevention of AR, with no significant 

adverse event profile (37). Experience in cardiac transplantation with IL-2 

receptor blockers and mycophenolate-based triple therapy suggests less AR and 

delayed onset to first rejection episode (41). A comparative analysis of OKT3, 

antithymocyte globulin, and daclizumab for induction immunosuppression in 

clinical lung transplantation shows equivalence in the prevention of early posttransplant 

AR and 2-yr survival (42). In conclusion, preliminary evidence supports 

the idea that this form of induction therapy may further aid in improving 

outcome post-solid-organ transplantation. 

2.2. Initial Immunosuppression Early Posttransplant 

Agents utilized early posttransplant exhibit additive or synergistic effects and 

are administered in combination to achieve multipathway inhibition of lymphocyte 

activation while minimizing cumulative toxicity. Recent innovations in 

pharmaceutical research have expanded the traditional protocols of immunosuppression 

used for almost 20 yr. Nonetheless, statistically significant improvement 

in graft function and survival has not been consistently demonstrated in

380 Hopkins 

Table 2 

Current Available Immunosuppressive Agents 

for Early Posttransplant Protocols and Their Mechanism of Action 

Class of agent Mechanism of action 

Corticosteroids Block cytokine gene transcription 

Lysis of T lymphocytes 

Clacineurin inhibitors Inhibit IL-2 gene transcription 

Cyclosporine Reduce proliferation of activated T cells 

Tacrolimus 

Inhibitors of nucleotide biosynthesis 

Azathioprine Purine analog impairs DNA synthesis 

Mycophenolate mofetil Inhibits IMPDH and B-cell proliferation 

TOR inhibitors Inhibit cyclin-dependent tyrosine kinases 

Rapamycin (sirolimus) 

Everolimus (RAD) 

IL, interleukin; IMPDH, inosine monophosphate dehydrogenasde; TOR, target of rapamycin. 

clinical trials of these new agents (43). Table 2 outlines the current framework 

for initial immunosuppression posttransplant in the prevention of the rejection 

response. Most transplant protocols incorporate an initial triple drug regimen 

consisting of prednisone or steroid equivalent, a calcineurin inhibitor, and either 

azathioprine or mycophenolate. 

2.3. Calcineurin Inhibitors 

Calcineurin blocking agents constitute the backbone of current triple immunosuppressive 

therapy regimens. Cyclosporine (Neoral, Novartis), introduced 

in 1978 (44), and tacrolimus or FK506 (Prograf; Fujisawa), introduced in 1989 

(45), are both prodrugs that bind selectively to different intracellular proteins 

called immunophilins. The cyclosporine–cyclophilin and tacrolimus–FK binding 

protein complexes then inhibit calcineurin, a multifunctional serine threonine 

phosphatase enzyme that normally dephosphorylates substrates for 

transcription factors including nuclear factor of activated T cells, nuclear factor-κB, 

and c-Jun N-terminal kinase (46). The result is dose-dependant inhibition 

of gene expression for IL-2 and other pro-inflammatory lymphokines 

including IL-3, IL-4, IL-5, IFN-γ, and TNF (47). Cytotoxic T lymphocytes 

become arrested at the G0-G1 cell-cycle interface and are therefore unable to 

differentiate and proliferate. Table 3 outlines important comparisons between 

the calcineurin inhibitors available in clinical practice. Side effects and toxicity 

common to both agents include the following: 

1. Serum abnormalities: abnormal liver function tests, hyperkalemia, hypomagnesemia, 

hyperuricemia, renal tubular acidosis, hyperlipidemia, hyperglycemia

381 

Table 3 

Comparison of Cyclosporine and Tacrolimus 

Cyclosporine Tacrolimus 

Chemistry Cyclic polypeptide Macrolide antibiotic 

Bioavailability 33% 25% 

Preparations 10-, 25-, 50-, 100-mg capsules 0.5-, 1-, 5-mg capsules 

100 mg/mL suspension 5-mg, 1-mL ampules 

Initial dosage posttransplant 5–10 mg/kg/d po two divided doses, 0.15 mg/kg/d po two divided doses 

three times a day cystic fibrosis patients 

Terminal half-life 19 h 8.7 h 

Side-effect profile More gingival hyperplasia, hypertension, More diabetes mellitus, pruritis, 

hirsutism tremor, alopecia 

Additional immune activity Potentially pro-proliferative, IL-6 Antifibroproliferative activity 

upregulation, increased TGF-β 

Therapeutic targets 0–2 wk 300–350 ng/mL 0–6 mo 10–15 ng/mL 

3–8 wk 250–300 >6 mo 5–15 ng/mL 

2–3 mo 200–250 

4–6 mo 180–250 

6–12 mo 150–180 

>12 mo 100–150 

In vitro potency 1× 50–100× a 

a Due to differences in partition coefficients and increased binding affinity of tacrolimus to FKBP. 

IL, interleukin; TGF, transforming growth factor; FKBP, FK-binding protein. 

Pharmacological Manipulation of the Rejection Response 381

382 Hopkins 

2. Renal failure: acute (acute arteriolar vasoconstriction), chronic (interstitial fibrosis, 

glomerular sclerosis) 

3. Neurotoxicity: characteristic white matter changes on computed tomography or 

T 2-weighted images or magnetic resonance imaging—headaches, encephalopathy, 

seizures, cortical blindness, quadriplegia 

4. Gastrointestinal: nausea, diarrhea, constipation, vomiting 

5. Other: hypertension, hemolytic–uremic syndrome 

Significant inter- and intraindividual pharmacokinetic variability exists with 

the calcineurin inhibitors, and this contributes to their narrow therapeutic index 

(46). Drug monitoring is essential and is based on either enzyme-linked immunosorbent 

assay or high-performance liquid chromatography (HPLC) using whole 

blood (48). Calcineurin inhibitors display variable and temperature-dependent 

whole blood-to-plasma ratios. At room temperature, cyclosporine displays an 

equilibrium range of approx 50% bound to red blood cells, 30–40% to lipoproteins, 

10% to leukocytes, and 1–6% free plasma (33). The gold standard assay is 

HPLC, as both drugs have multiple metabolites identified and crossreaction with 

MAb-based tests may be considerable (49). Cyclosporine and tacrolimus are 

both primarily metabolized by gut wall and the hepatic cytochrome P450-3A4 

enzyme system and undergo intestinal countertransport by P-glycoprotein. Pharmacokinetic 

interactions are therefore common owing to modulation of cytochrome 

P450 enzyme activity by co-administered drugs. This includes induction 

of CYP3A4 enzymes and reduced calcineurin inhibitor levels with the antiepileptics 

including carbamazepine, phenytoin and phenobarbitol, rifabutin, 

rifampicin, isoniazid, and St. John’s wort. Increased levels with enzyme inhibition 

occur with macrolide antibiotics, including erythromycin, clarithromycin 

and azithromycin, diltiazem, verapamil, colchicine, intravenous methylprednisolone, 

the oral contraceptive pill, and azoles, including itraconazole, fluconazole, 

and voriconazole. The pharmacokinetic behavior of both calcineurin 

inhibitors assumes a one-compartment model. Therapeutic monitoring has historically 

involved sampling a trough level just prior to the morning dose. However, 

calculation of the area under the curve (AUC) provides the most accurate 

measurement of total drug exposure, although it is clinically impractical. 

Cyclosporine trough concentrations (C min) have displayed poor correlation with 

AUC in pharmacokinetic studies in liver and renal recipients, with only 34– 

42% of the variance in AUC explained by the C min-derived regression line 

(50,51). Recent evidence suggests that limited sampling strategies display a high 

correlation coefficient with AUC, including a 2-h postdose cyclosporine assay 

(52). By contrast, therapeutic drug monitoring with tacrolimus suggests that 

C min is an accurate parameter explaining 86–88% of the variance in AUC (53,54). 

With lymphocyte trafficking and accumulation within the graft attenuated 

by calcineurin inhibitors, optimization of dosage is essential in the pharmaco-


logical manipulation of acute rejection. This clearly depends on individual sideeffect 

profile, rejection history, time posttransplantation, and potential endorgan 

toxicity. Studies of AR in lung and heart–lung transplant recipients 

support the notion that higher blood concentrations are required in the early 

postoperative months (10,55). 

2.4. Nucleotide-Blocking Agents 

The introduction of mycophenolate mofetil (Cell Cept, Roche) into clinical 

practice in the early 1990s initiated a progressive decline in azathioprine usage in 

organ transplantation (56,57). Azathioprine (Imuran, Glaxo), a nucleoside analog, 

is metabolized in the liver to thio-inosine-monophosphate by hypoxanthine 

guanine phosphoribosyltransferase. This compound inhibits adenylic and guanylic 

acid production in the de novo purine synthesis pathway (58). Human B 

and T lymphocytes have immature salvage pathways and depend almost exclusively 

on the de novo pathway of purine synthesis for their replication. However, 

the incorporation of thio-inosine-monophosphate into DNA strands potentiates 

chromosomal breaks and the eventual predisposition to malignancies, especially 

cutaneous tumors. Mycophenolate produces reversible noncompetitive blockade 

of the purine pathway enzyme inosine monophosphate dehydrogenase (IMPD). 

The result is a significant decline in guanosine monophosphate and subsequent 

production of DNA via ribonucleotide reductases. Not being a nucleoside analog, 

mycophenolate mofetil (MMF) does not inhibit DNA repair enzymes and 

is theoretically less mutagenic than azathioprine. A further mechanism for the 

selectivity of MMF in lymphocyte inhibition is based on the two isoforms of 

IMPD. The type II isoform preferentially found in activated lymphocytes is 

inactivated more strongly by MMF than the type I IMPD in resting cells (59). 

Table 4 compares the two antimetabolites. Therapeutic drug monitoring is not 

routinely recommended for MMF, although measurements of trough levels may 

help to detect underimmunosuppressed patients. Experience in kidney transplantation 

suggests onset of immunosuppressive effect and decreased acute rejection 

with trough concentrations greater than 1.0 mg/L (60). However, a study in 45 

cardiac transplant recipients of combination MMF and tacrolimus showed prevention 

of AR episodes with Cmin greater than 3 mg/L (61). In clinical practice, 

dosing of MMF is determined by the side-effect profile, which includes gastrointestinal 

symptoms of nausea, vomiting, anorexia, diarrhea, and myelosupression, 

especially leukopenia and anemia. Other rare adverse effects may include 

alopecia, liver dysfunction, pancreatitis, and gastritis. A randomized multicenter 

international trial comparing 3 g of MMF per day to 1.5–3 mg/kg of azathioprine 

per day in 578 cardiac transplant recipients has demonstrated a 45% reduction in 

mortality at 1 yr with MMF. Biopsy-proven rejection with hemodynamic compromise 

or graft loss at 6 mo posttransplant were significantly reduced in the

384 

Table 4 

Comparison of Azathioprine and MMF 

Azathioprine Mycophenolate 

Active metabolites 6-Mercaptopurine Mycophenolic acid 

thio-inosine-monophosphate 

Dosage 2–3 mg/kg/d po once per day first year, 2–3 g/d po two divided doses 

1 mg/kg/d > 12 mo 

Monitoring Not required 2.0–4.5 ng/mL HPLC assay 

Elimination One compartment, expontial decay Two compartment, enterohepatic circulation 

Terminal half life 3 h 18 h 

Immunosuppression T-Cell activity T- and B-cell activity 

Drug interactions Allopurinol—bone marrow suppression Antacids and bile acid sequestering agents reduce MMF 

(dose reduce azathioprine 75%) levels; tacrolimus increases MMF levels 

Other activity — Antiviral activity (EBV-induced B-cell lines) 

Inhibits glycosylation and expression of adhesion molecules 

Inhibits production of TGF-β 

Suppresses nitric oxide by iNOS 

Inhibits smooth muscle and fibroblast proliferation 

MMF, mycophenolate mofetil; HPLC, high-performance liquid chromatography; EBV, Epstein–Barr virus; TGF, transforming growth factor; 

iNOS, anti-inducible nitric oxide synthase. 

384 Hopkins


Table 5 

Toxicity Profile of Nucleotide-Blocking Agents 

Azathioprine (%) Mycophenolate (%) 

Side effects • Leukopeniaa 39.1 30.4 

• Abnormal LFG 12.8 9.7 

• Nausea 54.3 54.0 

• Diarrhea a 34.3 45.3 

• Esophagitis a 2.8 7.3 

Malignancy • Lymphoma 2.1 0.7 

• Other malignancy 5.2 6.2 

Infections • CMV viremia 10.0 12.1 

• CMV tissue invasive 8.7 11.4 

• Herpes simplex 14.5 20.8 

• Herpes zoster a 5.9 10.7 

• Aspergillus 2.1 2.1 

• Candida 17.6 18.7 

a p-value for difference

386 Hopkins 

Table 6 

Side-Effect Profile of TOR Inhibitors 

Frequent Uncommon 

Hyperlipidemia Hypertension 

Stomatitis Increased serum creatinine 

Thrombocytopenia Dirrhea 

Leukopenia Liver inflammation 

Epistaxis Hypophosphatemia 

Bacterial infections Hypokalemia 

Impaired wound healing Intersititial pneurnonitis 

Polyarthralgia Optic neuropathy 

Nausea Distal osteitis 

TOR, target of rapamycin. 

blocking cytokine stimulatory signals including IL-2, IL-4, IL-6, and anti-CD28 

antibodies via a serine threonine kinase called p70S6k. This results in a failure of 

immune effector cells to progress from the G1 to S cell-cycle interface (66). In 

vitro rapamycin also inhibits vascular smooth muscle cell, endothelial cell, and 

fibroblast proliferation induced by fibroblast growth factor, insulin-like growth 

factor, and platelet-derived growth factor (33). RAD or everolimus (Certican, 

Novartis) is a derivative of sirolimus and contains a hydroxyethyl group at position 

40 to increase polarity and oral bioavailability (67). The only significant 

pharmacokinetic difference between these compounds pertains to half-life, which 

is 30 h for RAD and 62 h for sirolimus. Both TOR inhibitors display synergistic 

effects with calcineurin inhibitors and are being studied extensively in combination. 

Cyclosporine and TOR inhibitors must be administered a minimum of 2 h 

apart owing to complex pharmacokinetics, including inhibition of CYP3A4 and 

decreased P-glycoprotein intestinal countertransport of either compound. TOR 

inhibitors are metabolized by CYP3A4 and therefore share similar drug interactions 

with the calcineurin inhibitors. Clinical doses of sirolimus should target 

whole blood levels of 3–15 ng/mL measured by HPLC, depending on time 

posttransplantation (68,69). Effective RAD doses are not established, although 

recent reports suggest 1.5–4 mg/d have a clinically meaningful influence on AR 

(70–72). Potential adverse effects of TOR inhibitors are outlined in Table 6 and 

in clinical practice limit dose escalation. 

An open-label randomized trial of sirolimus compared with azathioprine as 

part of standard triple immunosuppression in 136 de novo cardiac transplant 

recipients has recently been published (73). At 6 mo the rate of biopsy-proven 

AR was halved in the sirolimus group (61.4% azathioprine vs 29.4% 3 mg/d


and 36.2% 5 mg/d of sirloimus). A significant reduction in cardiac allograft 

arterial disease was also demonstrable, suggesting protection from chronic 

transplant vasculopathy (74). Similar results have been obtained in cardiac trials 

evaluating 1.5– 3 mg of RAD (71). Unfortunately, trials of RAD in lung 

transplantation have not shown convincing evidence of reduction in development 

of bronchiolitis obliterans syndrome or chronic rejection (75,76). Analysis 

of 24-mo data from multicenter phase III trials (77) in approx 1300 renal 

transplant recipients reveals that patients on 5 mg of sirolimus in addition to 

cyclosporine experience a significant delay in the onset and reduction in the 

incidence of AR compared with azathioprine (p = 0.02) or placebo (p = 0.001). 

Further potential roles of TOR inhibitors are in calcineurin-inhibitor-sparing 

regimens and weaning of corticosteroids in maintenance immunosuppression. 

3. Corticosteroids in the Treatment of Acute Rejection 

Corticosteroid therapy is the mainstay of treatment options for AR in solid 

organ transplantation. The dose of methylprednisolone employed for high-grade 

allograft rejection is typically 500–1000 mg/d or 10–15 mg/kg intravenously. 

Patients receive this as “pulse” therapy over a 3-d period, often with a continuation 

phase of oral prednisone or equivalent commencing at 1 mg/kg/d. This 

will depend on the histological features of obtained biopsy material, time posttransplantation, 

concurrent infection, and prior rejection history. There is also 

evidence in renal and cardiac transplantation of 100–200 mg/d of oral prednisone 

being equivalent to intravenous methylprednisolone in reversing AR 

(78,79). Controversy exists regarding the necessity to treat low-grade rejection 

scores, particularly in asymptomatic patients. In lung transplantation, minimal 

AR (International Society of Heart-Lung Transplantation [ISHLT] grade A 1) is 

detected in 22% of transbronchial lung biopsy procedures and asymptomatic in 

90% of cases. In addition, the risk of surveillance A 1 lesions progressing to 

higher-grade rejection (ISHLT grade > A 2) or lymphocytic bronchiolitis within 

3 mo is 34% (80). Nonetheless, 30% of mild rejection episodes (grade A 2) may 

resolve spontaneously with no initial therapy. Low grades of rejection in clinically 

well heart–lung patients may be poorly predictive of subsequent airway 

submucosal fibrosis (81). Our current policy is to treat all symptomatic lowgrade 

biopsies with an oral steroid pulse commencing at 1 mg/kg/d and tapering 

by 5 mg each day. There is clinical evidence in other respiratory disease 

models to support that such doses are truly lymphocytolytic in nature (82,83). 

For asymptomatic patients, careful clinical observation is recommended, with 

steroid treatment reserved for those patients who show subsequent graft deterioration. 

Recent evidence suggests an association between multiple episodes 

(>2 grade A 1 biopsies) of low-grade rejection and the subsequent development 

of obliterative bronchiolitis in lung transplantation. Therefore, augmentation of

388 Hopkins 

baseline immunosuppression or a change to a more antifibroproliferative regimen 

may be warranted in such circumstances (80). 

Generally, corticosteroids form an integral part of chronic maintenance protocols, 

albeit at small baseline doses. A steroid-withdrawal approach to immunosuppression 

is certainly not universally practiced across the spectrum of solid 

organ transplantation. Prednisone and prednisolone have high oral bioavailability 

and a plasma half-life from 3 to 4 h. Prednisone undergoes hepatic metabolism 

to prednisolone, which is more than 90% bound to plasma proteins 

including albumin and cortisone-binding globulin. The therapeutic benefit of 

corticosteroids in acute rejection rests with their combined anti-inflammatory 

and immunosuppressive action. Steroids reduce the synthesis of leukotrienes 

and prostaglandins via inhibition of phosphodiesterase A2. Immunosuppressive 

activity is multifactorial and includes: 

1. Absolute T-lymphocyte depletion via induction of apoptosis 

2. Inhibition of T-cell activation and proliferation via reduced cytokine gene transcription 

of IL-1, IL-2, IL-6, TNF, and interferon-γ 

3. Reduced HLA and adhesion molecule expression 

4. Inhibition of monocyte chemotaxis and migration to sites of inflammation (33) 

4. Treatment of Persistent and Recurrent Rejection 

The definition of persistent rejection in organ transplantation is histologically 

confirmed rejection that persists on a follow-up biopsy performed after a 

prior treated episode. The follow-up period varies depending on routine institutional 

practices, type of transplant procedure, and presence of clinical features 

of rejection. Recurrent rejection refers to at least three discrete episodes 

of rejection, not necessarily consecutive, within a defined period of time generally 

measured in months. Table 7 outlines therapeutic options for patients 

with persistent or recurrent rejection. The management strategies include optimization 

of existing immunosuppressive regimens, treatment with OKT3 MAb 

or polyclonal ALS and changing immunosuppression to a tacrolimus- and/or 

MMF-based protocol. Cytolytic therapy has demonstrated efficacy in the treatment 

of steroid-resistant allograft rejection. A study in 18 cardiac recipients 

with resistant or recurrent rejection confirmed 88 and 100% efficacy, respectively, 

with either OKT3 5 mg/d or ATG 1.5–2.5 mg/kg/d in reversing histological 

findings. Throughout follow-up averaging 50 mo, there was a trend 

towards lower incidence of subsequent AR after ATG (25 vs 69%; p = 0.09) 

and similar incidence of infections, graft atherosclerosis, and mortality. No 

cases of PTLD were observed (84). A randomized study in 163 renal recipients 

comparing ATG with equine-derived ATGAM was published in 1998. ATG 

had a higher rejection reversal rate than ATGAM (88 vs 76%; p = 0.027, primary 

endpoint). T-cell depletion was more significant with ATG and main-


Table 7 

Therapeutic Options for Persistent or Recurrent 

Acute Rejection Solid Organ Transplantation 

500–1000 mg intravenous methylprednisolone in association with one or 

more of the following: 

1. Optimization of current immunosuppression: 

• Assess compliance 

• Target higher blood levels 

• Increase baseline oral prednisone dosage to 0.2 mg/kg/d 

2. Alteration of maintenance triple immunosuppression: 

• Change from cyclosporine to tacrolimus 

• Convert azathiprine to MMF 

• Change route of administration: nebulized cyclosporine 

(in lung transplant recipients) 

3. Cytolytic therapy (duration 3–14 d): 

• Polyclonal antilymphocyte sera 

• OKT3 

4. Addition of or substitution with another immunosuppressive agent: 

• Methotrexate 

• Cyclophosphamide 

• TOR inhibitor (sirolimus or RAD) 

• Leflunomide (experimental) 

tained more effectively at d 30 posttherapy (p = 0.016). Recurrent rejection at 3 

mo after treatment occurred less frequently with ATG than with ATGAM (17 

vs 36%; p = 0.011). A similar incidence of adverse events, opportunistic infection, 

12-mo patient and graft survival were observed with both therapies (85). 

Early studies in renal transplantation confirmed the success of MMF as rescue 

therapy in 69% of patients with refractory rejection to ALS preparations (86). 

The MMF Renal Study Group evaluated 150 patients with refractory rejection 

and randomized them to either MMF 1.5 g twice daily or further intravenous 

steroids 5 mg/kg/d for 5 d. The primary efficacy variable of graft loss or death 

was reduced by 45% in the MMF group while the steroid cohort was twice as 

likely to require subsequent ALS therapy (87). Similar studies in cardiac, lung, 

renal, and liver transplantation evaluating tacrolimus have achieved results 

comparable to MMF (88–92). A study by Onsager and colleagues in thoracic 

organ transplant recipients showed reversal of rejection refractory to steroids 

and OKT3 in 73% of cases following conversion to tacrolimus from cyclosporine 

(93). Inhibition of IL-10 production is a critical factor in the ability of 

tacrolimus to reverse ongoing allograft rejection compared with cyclosporine 

(94). Methotrexate administered either as a single high dose (5 mg/kg) or as a

390 Hopkins 

supplement to maintenance immunosuppression at 7.5–22.5 mg/wk has proved 

successful for refractory rejection in cardiac and lung transplantation (95– 

98). Predictable side effects of folic acid analog therapy are mild pancytopenia 

and agranulocytosis. The mechanism of immunosuppression with methotrexate 

remains to be elucidated but is probably related to reduced intercellular 

adhesion molecule (ICAM)-1 expression in lymphoid tissue (99). Aerosolized 

cyclosporine has displayed in a dose-dependent manner some success in lung 

transplantation in protecting against further rejection episodes and improving 

graft histology (100,101). Administration consists of 300 mg of cyclosporine 

in 4.8 mL of propylene glycol using a jet nebulizer daily for 10–12 d, and then 

three times a week. A strong correlation exists between cyclosporine deposition 

in lung parenchyma measured by radioisotopic techniques and improvement 

in forced expiratory volume in 1 s. In a murine model, reversal of ongoing 

cardiac, kidney, and pancreas allograft rejection was achieved by rapamycin, 

although human studies are limited (102). Sirolimus vs MMF rescue therapy 

has been evaluated in 36 renal transplant patients with ongoing rejection despite 

steroids and 14–21 d of ALS. Reversal of renal dysfunction was observed in 

96% of patients in the sirolimus group compared with 67% in the MMF group 

(p = 0.03). One-year graft and patient survival rates were similar (103). 

Leflunomide is a xenobiotic agent that demonstrates selective inhibition of 

pyrimidine synthesis. In experimental canine transplantation it has prolonged 

renal allograft survival when given in combination with either cyclosporine or 

tacrolimus (104,105). 

Total lymphoid irradiation (TLI) is a potential therapy reserved for rejection 

refractory to all other conventional immunotherapy (106,107). TLI involves the 

delivery of low-dose radiotherapy in a 5- to 6-wk fractionated regimen (total 

dose 600–840 cGy) to lymphoid tissue in a supradiaphragmatic mantle and 

abdomino-pelvic inverted Y distribution. Nucleotide blocking agents are discontinued 

prior to initial treatment given the risks of profound bone marrow 

suppression. An additional disadvantage of TLI is prolonged lymphopenia with 

risk of opportunistic infection, especially invasive fungal and CMV infection. 

Mutagenesis with an excess risk of lymphoma and acute megakaryocytic leukemia 

have followed this modality. Trials in cardiac transplantation have found 

TLI to be a risk factor for transplant coronary vasculopathy (108). Although 

TLI has merit for the treatment of intractable AR, toxicity limits its more widespread 

application. Extracorporeal photochemotherapy (ECPC) or photopheresis 

is a relatively new immunomodulatory treatment, studied in predominately 

renal, cardiac, and lung transplant rejection (109). This costly technique involves 

the removal of recipient leukocytes using a cell separator and then irradiating an 

enriched lymphocyte solution with ultraviolet (UV) A light in the presence of 

8-methoxypsoralen. This compound, administered orally 2 h prior, cross-links


with DNA strands following UV application inducing apoptosis in activated T 

cells, phenotypic change to suppressor T-cell capability, and humoral inhibition 

(33). A typical treatment regimen involves one session per week in the first 

month, every 2 wk in the second and third month, and then monthly thereafter. 

Dall’Amico et al. have published a trial of ECPC in cardiac recipients with 

recurrent rejection. Only 18% of endomyocardial biopsies during 6 mo of 

photopheresis showed 3A/3B rejection, and a significant reduction in dosage of 

baseline immunosuppression was achieved (110). Depletion of circulating T 

lymphocytes does not occur with photopheresis, but precautions are required 

during the delivery of UV light to prevent retinal scarring and sunburn. 

5. Future Directions in Immunosuppression and Novel Agents 

Despite recent advances in immunosuppressive protocols for solid organ transplantation, 

acute allograft rejection remains a significant source of patient morbidity 

and mortality. While the field of transplantation continues to expand with 

new immunosuppressive formulations, the overall goal of achieving immune tolerance 

remains elusive. One novel avenue of investigation is the inhibition of 

those additional pathways critical to effective T-cell activation using monoclonal 

antibodies. For example, it is postulated that self-tolerance may involve the inhibition 

or absence of a costimulatory signal normally involved in the amplification 

of T-cell activity (111). Such signals may include the T-cell ligands 

leukocyte function antigen-1 (LFA-1), very late antigen-4, B7, VCAM-1, and 

ICAM-1. Therefore, interference with these molecules even in the presence of 

foreign or transplanted tissue may induce tolerance. An indefinite survival of 

cardiac allografts between fully incompatible mice strains has been documented 

using monoclonal antibodies to LFA-1 and ICAM-1 early posttransplant (112). 

Other drugs have been reported as possessing immunomodulatory properties, 

including pravastatin, aminoguanidine, and thalidomide, although have little 

clinical experience in this context (113). Finally, genetic alteration of the donor 

organ during procurement may ameliorate graft rejection by inducing donorspecific 

tolerance. Modern genetic techniques using vectors such as liposomes, 

adenovirus, and hyperbaric pressure to deliver molecules inhibiting donor gene 

expression have been employed (111). 

References 

1. King-Biggs, M. B. (1997) Acute pulmonary allograft rejection: mechanisms, diagnosis 

and management, in Clinics in Chest Medicine (Maurer, J. R., ed.), WB 

Saunders Company, London, pp. 301–310. 

2. Devouassoux, G., Pison, C., Drouet, C., Pin, I., Brambilla, C., and Brambilla, E. 

(2001) Early lung leukocyte infiltration, HLA and adhesion molecule expression 

predict chronic rejection. Transplant. Immunol. 8, 229–236.

392 Hopkins 

3. Kauppinen, H., Soots, A., Krogerus, L., et al. (2000) Sequential analysis of adhesion 

molecules and their ligands in rat renal allografts during the development of 

chronic rejection. Transplant. Int. 13, 247–254. 

4. Demirci, G., Hoshino, K., and Nashan, B. (1999) Expression patterns of integrin 

receptors and extracellular matrix proteins in chronic rejection of human liver 

allografts. Transplant. Immunol. 7, 229–237. 

5. Von Willebrand, E., Jurcic, V., Isoniemi, H., Hayry, P., Paavonen, T., and 

Krogerus, L. (1997) Adhesion molecules and their ligands in chronic rejection of 

human renal allografts. Transplant. Proc. 29, 1530–1531. 

6. Charpentier, B., Hiesse, C., Durrbach, A., et al. (2000) Immunosuppression 

advancing in the new millenium: lessons learned from recent multicentre and 

single centre clinical trials. Curr. Opin. Organ Transplant. 5, 249–254. 

7. Game, D. S. and Lechler, R. I. (2002) Pathways of allorecognition: implications 

for transplantation tolerance. Transplant. Immunol. 10, 101–108. 

8. Mosmann, T. R. and Coffman, R. L. (1989) TH1 and TH2 cells: different patterns 

of lymphokine secretion lead to different functional properties. Annu. Rev. 

Immunol. 7, 145–173. 

9. Nickerson, P., Steurer, W., and Steiger, J. (1994) Cytokines and the Th1/Th2 

paradigm in transplantation. Curr. Opin. Immunol. 6, 757–764. 

10. Hopkins, P. M., Aboyoun, C. L., Chhajed, P. N., et al. (2002) Prospective analysis 

of 1235 transbronchial lung biopsies in lung transplant recipients. J. Heart 

Lung Transplant. 21, 1062–1067. 

11. Starzl, T. E., Porter, K. A., and Iwasaki, Y. (1967) The use of heterologous antilymphocyte 

globulins in human homotransplantation in Antilymphocyte Serum 

(Wolstenholme, G. E. W., O’Connor, M., eds.), Little, Brown, Boston, p. 1. 

12. Rebellato, L. M., Gross, U., and Verbanac, K. M. (1994) A comprehensive definition 

of the major antibody specificities in polyclonal rabbit antithymocyte 

globulin. Transplantation 57, 685–694. 

13. Bourdage, J. S. and Hamlin, D. M. (1995) Comparative polyclonal antithymocyte 

globulin and antilymphocyte/antilymphoblast globulin anti-CD antigen analysis 

by flow cytometry. Transplantation 59, 1194–1200. 

14. Swinnen, L. J., Costanzo-Nordin, M. R., and Fisher, S. G. (1990) Increased incidence 

of lymphoproliferative disorder after immunosuppression with the monoclonal 

antibody OKT3 in cardiac transplant recipients. N. Engl. J. Med. 323, 

1723–1728. 

15. Kusne, S., Shapiro, R., and Fung, J. (1999) Prevention and treatment of cytomegalovirus 

infection in organ transplant recipients. Transplant. Infect. Dis. 1, 187–203. 

16. Jamil, B., Nicholls, K. M., Becker, G. J., and Walker, R. G. (2000) Influence of 

anti-rejection therapy on the timing of cytomegalovirus disease and other infections 

in renal transplant recipients. Clin. Transplant. 14, 14–18. 

17. Piaggio, G., Podesta, M., Pitto, A., et al. (1998) TNF-alpha, IFN-gamma and 

GM-CSF production by purified normal marrow CD3 cells in response to horse 

anti-lymphocyte and rabbit antithymocyte globulin. Eur. J. Haematol. 60, 240– 

244.


18. Rameshwar, P. and Gascon, P. (1992) Release of interleukin-1 and interleukin-6 

from human monocytes by antithymocyte globulin: requirement for de novo synthesis. 

Blood 15, 2531–2538. 

19. Oettinger, C. W., D’Souza, M., and Milton, G. V. (1996) In vitro comparison of 

cytokine release from antithymocyte serum and OKT3. Inhibition with soluble 

and microencapsulated neutralising antibodies. Transplantation 15, 1690–1693. 

20. Cosimi, A. B., Burton, R. C., and Colvin, R. B. (1981) Treatment of acute renal 

allograft rejection with OKT3 monoclonal antibody. Transplantation 32, 535. 

21. Bonnefoy-Berard, N. and Revillard, J.P. (1996) Mechanisms of immunosuppression 

induced by antithymocyte globulins and OKT3. J. Heart Lung Transplant. 

15, 435–442. 

22. Shihab, F. S., Barry, J. M., and Norman, D. J. (1993) Encephalopathy following 

the use of OKT3 in renal allograft transplantation. Transplant. Proc. 25, 31–34. 

23. Adair, J. C., Woodley, S. L., O’Connell, J. B., Call, G. K., and Baringer, J. R. 

(1991) Aseptic meningitis following cardiac transplantation: clinical characteristics 

and relationship to immunosuppressive regimen. Neurology 41, 249–252. 

24. Kuus-Reichel, K., Grauer, L. S., Karavodin, L. M., Knott, C., Krusemeier, M., 

and Kay, N. E. (1994) Will immunogenecity limit the use, efficacy and future 

development of therapeutic monoclonal antibodies? Clin. Diagn. Lab. Immunol. 

1, 365–372. 

25. Krasinskas, A. M., Kreisel, D., Acker, M. A., et al. (2002) CD3 monitoring of 

antithymocyte globulin therapy in thoracic organ transplantation. Transplantation 

73, 1339–1341. 

26. Wechter, W. J., Broodie, J. A., and Morrell, R. M. (1979) Antithymocyte globulin 

(ATGAM) in renal allograft recipients. Transplantation 28, 294–307. 

27. Cosimi, A. B. (1981) The clinical value of antilymphocyte antibodies. Transplant. 

Proc. 13, 462–468. 

28. Norman, D. J., Kahana, L., Stuart, F. P., et al. (1993) A randomised clinical trial 

of induction therapy with OKT3 in kidney transplantation. Transplantation 55, 

44–50. 

29. Farges, O., Ericzon, B. G., Bresson-Hadni, S., et al. (1994) A randomised trial of 

OKT3-based versus cyclosporine-based immunoprophylaxis after liver transplantation. 

Long term results of a European and Australian multicentre study. Transplantation 

58, 891–898. 

30. Barr, M. L., Sanchez, J. A., Seche, L. A., Schulman, L. L., Smith, C. R., and 

Rose, E. A. (1990) Anti-CD3 monoclonal antibody induction therapy. Immunological 

equivalency with triple-drug therapy in heart transplantation. Circulation 

82, 291–294. 

31. Palmer, S. M., Miralles, A. P., Lawrence, C. M., Gaynor, J. W., Davis, R. D., and 

Tapson, V. F. (1999) Rabbit antilymphocyte globulin decreases acute rejection 

after lung transplantation: results of a randomised, prospective study. Chest 116, 

127–133. 

32. Klepetko, W., Jaksch, P., Kocher, A.A., et al. (2002) Prospective, randomised 

trial comparing induction therapy with daclizumab or rabbit antithymocyte glob-

394 Hopkins 

uline versus no induction therapy after lung transplantation. J. Heart Lung Transplant. 

21, A33. 

33. George, J. F. (2002) Immunosuppressive modalities, in Heart Transplantation 

(Kirklin, J. K., Young, J. B., and McGiffin, D. C., eds.), Churchill Livingstone, 

London, pp. 390–462. 

34. Henry, M. L. and Rajab, A. (2002) The use of basiliximab in solid organ transplantation. 

Expert. Opin. Pharmacother. 3, 1657–1663. 

35. Lawen, J. G., Davies, E. A., Mourad, G., et al. (2003) Randomised double-blind 

study of immunoprophylaxis with basiliximab, a chimeric anti-interleukin-2 receptor 

monoclonal antibody, in combination with mycophenolate mofetil-containing 

triple therapy in renal transplantation. Transplantation 75, 37–43. 

36. Sollinger, H., Kaplan, B., Pescovitz, M. D., et al. (2001) Basiliximab versus 

antithymocyte globulin for prevention of acute renal allograft rejection. Transplantation 

72, 1915–1919. 

37. Calmus, Y., Scheele, J. R., Gonzalez-Pinto, I., et al. (2002) Immunoprophylaxis 

with basiliximab, a chimeric anti-interleukin-2 receptor monoclonal antibody, in 

combination with azathioprine-containing triple therapy in liver transplant recipients. 

Liver Transplant. 8, 123–131. 

38. Clark, G., Walsh, G., Deshpande, P., and Koffman, G. (2002) Improved efficacy of 

basiliximab over antilymphocyte globulin induction therapy in paediatric renal 

transplantation. Nephrol. Dial. Transplant. 17, 1304–1309. 

39. Cantarovich, M., Metrakos, P., Giannette, N., Cecere, R., Barkun, J., and 

Tchervenkov, J. (2002) Anti-CD25 monoclonal antibody coverage allows for calcineurin 

inhibitor “holiday” in solid organ transplant patients with acute renal 

dysfunction. Transplantation 73, 1169–1172. 


with daclizumab to prevent acute rejection in renal transplantation. 

Daclizumab Triple Therapy Study Group. N Engl J Med 338, 161–165. 

41. Beniaminovitz, A., Itescu, S., Lietz, K., et al. (2000) Prevention of rejection in 

cardiac transplantation by blockade of the interleukin-2 receptor with a monoclonal 

antibody. N. Engl. J. Med. 342, 613–619. 

42. Brock, M.V., Borja, M. C., Ferber, L., et al. (2001) Induction therapy in lung 

transplantation: a prospective controlled clinical trial comparing OKT3, anti-thymocyte 

globulin and daclizumab. J. Heart Lung Transplant. 20, 1282–1290. 

43. Charpentier, B., Hiesse, C., Durrbach, A., et al. (2000) Immunosuppression advancing 

in the new millennium: lessons learned from recent multicentre and single 

centre clinical trials. Curr. Opin. Organ. Transplant. 5, 249–254. 

44. Calne, R. Y., White, D. J., Thiru, S., et al. (1978) Cyclosporin A in patients receiving 

renal allografts from cadaver donors. Lancet 2, 1323–1327. 

45. Todo, S., Fung, J. J., Tzakis, A., et al. (1991) One hundred ten consecutive primary 

orthotopic liver transplants under FK 506 in adults. Transplant. Proc. 23, 

1397–1402. 

46. Mahalati, K. and Kahan, B.D. (2000) Advancing the art of immunosuppression 

with the science of pharmacology. Curr. Opin. Organ Transplant. 5, 255–262.


47. Briffa, N. and Morris, R.E. (1997) New immunosuppressive regimens in lung 

transplantation. Eur. Respir. J. 10, 2630–2637. 

48. Keown, P. A. (2002) New concepts in cyclosporine monitoring. Curr. Opin. 

Nephrol. Hypertens. 11, 619–626. 

49. Tredger, J. M., Roberts, N., Sherwood, R., Higgins, G., and Keating, J. (2000) 

Comparison of five cyclosporin immunoassays with HPLC. Clin. Chem. Lab. 

Med. 38, 1205–1207. 

50. Barone, G., Chang, C. T., Choc, M. G., Jr., et al. (1996) The pharmacokinetics of 

a microemulsion formulation of cyclosporin in primary renal allograft recipients. 


51. Freeman, D., Grant, D., Levy, G., et al. (1995) Pharmacokinetics of a new formulation 

of cyclosporin in liver transplant recipients. Ther. Drug Monit. 17, 213– 

216. 

52. Andrews, D. J. and Cramb, R. (2002) Cyclosporin: revisions in monitoring and 

review of current analytical methods. Ann. Clin. Biochem. 39, 424–435. 

53. Ihara, H., Shinkuma, D., Ichikawa, Y., Nojima, M., Nagano, S., and Ikoma, F. 

(1995) Intra- and interindividual variation in the pharmacokinetics of tacrolimus 

(FK506) in kidney transplant recipients – importance of trough levels as a practical 

indicator. Int. J. Urol. 2, 151–155. 

54. Jusko, W. J., Piekoszewski, W., Klintmalm, G. B., et al. (1995) Pharmacokinetics 

of tacrolimus in liver transplant recipients. Clin. Pharmacol. 57, 281–290. 

55. Baz, M. A., Layish, D. T., Govert, J. A., et al. (1996) Diagnostic yield of bronchoscopies 

after isolated lung transplantation. Chest 110, 84–88. 

56. Sollinger, H. W., Deierhoi, M. H., Belzer, F. O., Diethelm, A. G., and Kauffman, 

R. S. (1992) RS-61443—a phase I clinical trial and pilot rescue study. Transplantation 

53, 428–432. 

57. European Mycophenolate Mofetil Cooperative Study Group. (1995) Placebo-controlled 

study of mycophenolate mofetil combined with cyclosporin and corticosteroids 

for prevention of acute rejection. Lancet 345, 1321–1325. 

58. Kung, L., Gourishankar, S., and Halloran, P. F. (2000) Molecular pharmacology 

of immunosuppressive agents in relation to their clinical use. Curr. Opin. Organ 


59. Rayhill, S. C. and Sollinger, H. W. (1999) Mycophenolate mofetil: experimental 

and clinical experience, in Immunosuppression in Transplantation (Ginns, L. C., 

Cosimi, A. B., and Morris P., eds.), Blackwell Science, Malden, pp. 47–66. 

60. Weber, L. T., Schutz, E., Lamersdorf, T., et al. (1999) Therapeutic drug monitoring 

of total and free mycophenolic acid (MPA) and limited sampling strategy for 

determination of MPA-AUC in paediatric renal transplant recipients. The German 

Study Group on Mycophenolate Mofetil (MMF) Therapy. Nephrol. Dial. 


61. Meiser, B. M., Pfeiffer, M., Schmidt, D., et al. (1999) Combination therapy with 

tacrolimus and mycophenolate mofetil following cardiac transplantation: importance 

of mycophenolic acid therapeutic drug monitoring. J. Heart Lung Transplant. 

18, 143–149.

396 Hopkins 

62. Mycophenolate Mofetil Investigators. (1998) A randomised active controlled 

trial of mycophenolate mofetil in heart transplant recipients. Transplantation 

66, 507–515. 

63. Glanville, A. R., Corris, P. A., McNeil, K. D., and Wahlers, T., on behalf of the 

International MMF Lung Study Group. (2003) Mycophenolate mofetil (MMF) 

versus mzathioprine (AZA) in lung transplantation for the prevention of bronchiolitis 

obliterans syndrome (BOS): results of a 3 year international randomised 

trial. J. Heart Lung Transplant. 22, A410. 

64. Mathew, T. H. (1998) Tricontinental Mycophenolate Mofetil Renal Transplantation 

Study Group. A blinded long term randomised multicentre study of 

mycophenolate mofetil in cadaveric renal transplantation: results at three years. 


65. Senel, F. and Kahan, B. D. (1999) New small molecule immunosuppressive 

agents, in Immunosuppression in Transplantation (Ginns, L. C., Cosimi, A. B., 

and Morris, P. J., eds.), Blackwell Science, Malden, pp. 67–84. 

66. Ruygrok, P. N., Muller, D. W., and Serruys, P. W. (2003) Rapamycin in cardiovascular 

medicine. Intern. Med. J. 33, 103–109. 

67. Nashan, B. (2002) Review of the proliferation inhibitor everolimus. Expert. Opin. 

Invest. Drugs 11, 1845–1857. 

68. Kahan, B. D., Napoli, K. L., Kelly, P. A., et al. (2000) Therapeutic drug monitoring 

of sirolimus: correlations with efficacy and toxicity. Clin. Transplant. 14, 97–109. 

69. Kahan, B. D., Podbielski, J., Napoli, K. L., Katz, S. M., Meier-Kriesche, H. U., 

and Van Buren, C. T. (1998) Immunosuppressive effects and safety of a 

sirolimus/cyclosprine combination regimen for renal transplantation. Transplantation 

66, 1040–1046. 

70. Kovarik, J. M., Kaplan, B., Tedesco, S. H., et al. (2002) Exposure-response relationships 

for everolimus in de novo kidney transplantation: defining a therapeutic 

range. Transplantation 73, 920–925. 

71. Eisen, H., Dorent, R., Mancini, D., et al. (2002) the RAD B253 Study Group. 

Safety and efficacy of everolimus (RAD) as part of a triple immunosuppressive 

regimen in de novo cardiac transplant recipients: six month analysis. J. Heart 

Lung Transplant. 21, A1. 

72. Kahan, B. D., Kaplan, B., Lorber, M. I., Winkler, M., Cambon, N., and Boger, R. 

S. (2001) RAD in de novo renal transplantation: comparison of three doses on the 

incidence and severity of acute rejection. Transplantation 71, 1400–1406. 

73. Keogh, A. (2002) Sirolimus immunotherapy reduces the rates of cardiac allograft 

rejection: 6 month results from a phase 2, open label study. Am. J. Transplant. 2, 

246. 

74. Keogh, A. (2002) Progression of graft vessel disease in cardiac allograft recipients 

is significantly reduced by sirolimus immunotherapy: 6 month results from a 

phase 2, open label study. Am. J. Transplant. 2, 246. 

75. Snell, G. I., Valentine, V. G., Love, R. B., Vitulo, P., Glanville, A. R., and Pirron, 

U. (2003) One-year results of an international, randomised double blind study of 

everolimus versus azathioprine as adjunctive therapy to inhibit the decline of


pulmonary function in stable lung or heart-lung transplant recipients. J. Heart 

Lung Transplant. 22, A411. 

76. Snell, G. I., Frost, A., Glanville, A. R., et al. (2002) Results of a 1 year randomised 

open label multicentre study of RAD versus antilymphocyte globulin (ALG) and 

azathioprine in lung transplant recipients with bronchiolitis obliterans syndrome 

(BOS). J. Heart Lung Transplant. 21, A36. 

77. Kahan, B. D. (2003) Two-year results of multicentre phase III trials on the effect 

of the addition of sirolimus to cyclosporine based immunosuppressive regimens 

in renal transplantation. Transplant. Proc. 35, S37–51. 

78. Orta-Sibu, N., Chantler, C., Bewick, M., and Haycock, G. (1982) Comparison of 

high-dose intravenous methylprednisolone with low-dose oral prednisolone in 

acute renal allograft rejection in children. Br. Med. J. 285, 258–260. 

79. Park, M. H., Starling, R. C., Ratliff, N. B., et al. (1999) Oral steroid pulse without 

taper for the treatment of asymptomatic moderate cardiac allograft rejection. J. 


80. Hopkins, P. M. A., Aboyoun, C. L., Chhajed, P. C., et al. (2002) Outcome of 

minimal acute rejection (grade A 1) in lung transplant recipients: the need for careful 

observation. J. Heart Lung Transplant. 21, A144. 

81. Clelland, C., Higenbottam, T., Otulana, B., et al. (1990) Histologic prognostoc 

indicators for the lung allografts of heart-lung transplants. J. Heart Lung Transplant. 

9, 177–186. 

82. Tanizaki, Y., Kitani, H., Mifune, T., Mitsunobu, F., Kajimoto, K., and Sugimoto, 

K. (1993) Effects of glucocorticoids on humoral and cellular immunity and on 

airway inflammation in patients with steroid-dependant intractable asthma. J. 

Asthma 30, 485–492. 

83. Schuyler, M. R., Bondarevsky, E., Schwartz, H. J., and Schmitt, D. (1981) Corticosteroid-sensitive 

lymphocytes are normal in atopic asthma. J. Allergy Clin. 

Immunol. 68, 72–78. 

84. Cantarovich, M., Latter, D. A., and Loertscher, R. (1997) Treatment of steroidresistant 

and recurrent acute cardiac transplant rejection with a short course of 

antibody therapy. Clin. Transplant. 11, 316–321. 

85. Gaber, A. O., First, M. R., Tesi, R. J., Gaston, R. S., Mendez, R., and Mulloy, L. 

L. (1998) Results of the double blind, randomised, multicentre, phase III clinical 

trial of thymoglobulin versus ATGAM in the treatment of acute graft rejection 

episodes after renal transplantation. Transplantation 66, 29–37. 

86. Sollinger, H. W., Deierhoi, M. H., Belzer, F. O., Diethelm, A. G., and Kauffman, 

R. S. (1992) RS-61443: phase I clinical trial and pilot rescue study. Transplantation 

53, 428–432. 

87. The Mycophenolate Mofetil Renal Refractory Rejection Study Group. (1996) 

Mycophenolate mofetil for the treatment of refractory, acute cellular renal transplant 

rejection. Transplantation 61, 722–729. 

88. Klein, A. (1999) Tacrolimus rescue in liver transplant patients with refractory 

rejection or intolerance or malabsorption of cyclosporin. The US Multicentre 

FK506 Liver Study Group. Liver Transplant. Surg. 5, 502–508.

398 Hopkins 

89. Mentzer, R. M., Jahania, M. S., and Lasley, R. D. (1998) Tacrolimus as a rescue 

immunosuppressant after heart and lung transplantation. The US Multicentre 

FK506 Study Group. Transplantation 65, 109–113. 

90. Jordan, M. L., Naraghi, R., Shapiro, R., et al. (1997) Tacrolimus rescue therapy 

for renal allograft rejection – five year experience. Transplantation 63, 223– 

228. 

91. De Bonis, M., Reynolds, L., Barros, J., and Madden, B. P. (2001) Tacrolimus as 

a rescue immunosuppressant after heart transplantation. Eur. J. Cardiothorac. 

Surg. 19, 690–695. 

92. Wong, P., Devlin, J., Gane, E., Ramage, J., Portmann, B., and Williams, R. (1994) 

FK506 rescue therapy for intractable liver allograft rejection. Transplant. Int. 7, 

S70–76. 

93. Onsager, D. R., Canver, C. C., Jahania, M. S., et al. (1999) Efficacy of tacrolimus 

in the treatment of refractory rejection in heart and lung transplant recipients. J. 


94. Jiang, H., Wynn, C., Pan, F., Ebbs, A., Erickson, L. M., and Kobayashi, M. (2002) 

Tacrolimus and cyclosporin differ in their capacity to overcome ongoing allograft 

rejection as a result of their differential abilities to inhibit interleukin-10 production. 


95. Cahill, B. C., O’Rourke, M. K., Strasburg, K. A., et al. (1996) Methotrexate for 

lung transplant recipients with steroid-resistant acute rejection. J. Heart Lung 

Transplant. 15, 1130–1137. 

96. Ferraro, P., Carrier, M., White, M., Pelletier, G. B., and Pelletier, L. C. (1995) 

Antithymocyte globulin and methotrexate therapy of severe or persistent cardiac 

allograft rejection. Ann. Thorac. Surg. 60, 372–376. 

97. Ross, H. J., Gullestad, L., Pak, J., Slauson, S., Valantine, H. A., Hunt, S. A. 

(1997) Methotrexate or total lymphoid radiation for treatment of persistent or 

recurrent allograft cellular rejection: a comparative study. J. Heart Lung Transplant. 

16, 179–189. 

98. Boettcher, H., Costard-Jackle, A., Moller, F., Hirt, S. W., and Cremer, J. (2002) 

Methotrexate as rescue therapy in lung transplantation. Transplant. Proc. 34, 

3255–3257. 

99. Ciesielski, C. J., Pflug, J. J., Mei, J., and Piccinini, L. A. (1998) Methotrexate 

regulates ICAM-1 expression in recipients of rat cardiac allografts. Transplant. 

Immunol. 6, 111–121. 

100. Keenan, R. J., Iacono, A., Dauber, J. H., et al. (1997) Treatment of refractory 

acute allograft rejection with aerosolized cyclosporin in lung transplant recipients. 

J. Thorac. Cardiovasc. Surg. 113, 335–340. 

101. Iacono, A. T., Smaldone, G. C., Keenan, R. J., et al. (1997) Dose related reversal 

of acute lung rejection by aerosolized cyclosporin. Am. J. Respir. Crit. Care Med. 

155, 1690–1698. 

102. Chen, H., Wu, J., Xu, D., Luo, H., and Daloze, P. M. (1993) Reversal of ongoing 

heart, kidney and pancreas allograft rejection and suppression of accelerated heart 

allograft rejection in the rat by rapamycin. Transplantation 56, 661–666.


103. Hong, J. C. and Kahan, B. D. (2001) Sirolimus rescue therapy for refractory 

rejection in renal transplantation. Transplantation 71, 1579–1584. 

104. Jin, M. B., Nakayama, M., Ogata, T., et al. (2002) A novel leflunomide derivative, 

FK778, for immunosuppression after kidney transplantation in dogs. Surgery 

132, 72–79. 

105. Kyles, A. E., Gregory, C. R., Griffey, S. M., Bernsteen, L., Pierce, J., and Lilja, 

H. S. (2003) Immunosuppression with a combination of the leflunomide analog, 

FK778, and microemulsified cyclosporine for renal transplantation in mongrel 

dogs. Transplantation 75, 1128–1133. 

106. Keogh, A. M., Arnold, R. H., Macdonald, P. S., Hawkins, R. C., Morgan, G. W., 

and Spratt, P. M. (2001) A randomised trial of tacrolimus (FK506) versus total 

lymphoid irradiation for the control of repetitive rejection after cardiac transplantation. 


107. Valentine, V. G., Robbins, R. C., Wehner, J. H., Patel, H. R., Berry, G. J., and 

Theodore, J. (1996) Total lymphoid irradiation for refractory acute rejection in 

heart-lung and lung allografts. Chest 109, 1184–1189. 

108. Asano, M., Gundry, S. R., Razzouk, A. J., et al. (2002) Paediatric Heart Transplantation 

Group. Total lymphoid irradiation for refractory rejection in paediatric 

heart transplantation. Ann. Thorac. Surg. 74, 1979–1985. 

109. Dall’Amico, R. and Murer, L. (2002) Extracorporeal photochemotherapy: a new 

therapeutic approach for allograft rejection. Transfus. Apheresis Sci. 26, 197– 

204. 

110. Dall’Amico, R., Montini, G., Murer, L., et al. (2000) Extracorporeal 

photochemotherapy after cardiac transplantation: a new therapeutic approach to 

allograft rejection. Int..J. Artif. Organs 23, 49–54. 

111. Koransky, M. L. and Robbins, R. C. (2002) Additional strategies for Immunosuppression, 

in Heart and Lung Transplantation (Baumgartner, W. A., Kasper, 

E., Theodore, J., and Reitz, B., eds.), WB Saunders Company, London, pp. 341– 

351. 

112. Isobe, M., Yagita, H., Okumura, K., and Ihara, A. (1992) Specific acceptance of 

cardiac allograft after treatment with antibodies to ICAM-1 and LFA-1. Science 

255, 1125–1127. 

113. Ross, D. J. and Kass, R. M. (2002) Treatment of acute lung allograft rejection, in 

Heart and Lung Transplantation (Baumgartner, W. A., Kasper, E., Theodore, J., 

and Reitz, B., eds.), WB Saunders Company, London, pp. 333–340.

Experimental Models of Graft Arteriosclerosis 401 

17 

Experimental Models of Graft Arteriosclerosis 

Behzad Soleimani and Victor C. Shi 

Summary 

Graft arteriosclerosis (GA) is the leading cause of mortality in long-term survivors of 

solid organ transplantation. Although clinical studies have suggested a multifactorial 

etiology, the precise mechanism of disease remains obscure. Many animal models have 

been developed that manifest lesions resembling those of human arteriosclerosis. These 

models have helped us address specific mechanistic and interventional issues but, for 

reasons that will be discussed, have failed to assign a unitary pathogenic mechanism to 

clinical GA. In this chapter we describe the commonly available experimental models of 

GA. We further discuss the merits and limitations of each model and outline their contribution 

to our understanding of the pathogenesis of the disease. 

Key Words: Graft arteriosclerosis; experimental models; transplantation. 


Transplantation-associated GA is the major cause of cardiac allograft failure 

after the first postoperative year (1), and it appears to be a significant problem 

in the long-term survival of other solid organ transplants (2). Also, despite 

the success of immunosuppressive agents in the treatment of acute rejection 

(AR), there is considerable debate about whether these drugs influence the progression 

of GA (3). Both the gross and histological features of GA differentiate 

it from commonly occurring native vessel arteriosclerosis. In contrast with 

common arteriosclerosis, the lesion associated with GA involves the artery in a 

concentric rather than eccenteric fashion and often involves both the epicardial 

and intramyocardial coronary arteries (1). Lipid accumulation is less common 

in the early development of GA, and the tempo of the disease is faster. The 

cellular composition of GA lesion and the sparing of the native vessels, as well 



401

402 Soleimani and Shi 

as the likely participation of a variety of growth factors and cytokines, suggest 

stimulation by an immune mechanism. However, the precise mechanism of the 

disease remains obscure. 

There has, however, been significant progress in this area in the recent years 

thanks, in part at least, to the contribution made by animal models that manifest 

lesions resembling those of human arteriosclerosis. The first report of allograft 

coronary disease in an experimental animal was in a series of orthotopic cardiac 

allografts in dogs (4). In this model allografts surviving more than 3 mo developed 

circumferential intimal thickening in the coronary arteries causing luminal 

stenosis. Subsequent to this early work by Kosek et al., many other animal 

models have been developed that have helped to address both mechanistic and 

interventional issues related to the disease. 

There are two principal issues to consider in evaluating experimental models 

of GA: the choice of the species and the choice of the allograft. Experimental 

models of this disease have been described in all commonly available 

laboratory animals ranging from rodents to primates. Although it is generally 

recognized that each species offers a different perspective of the disease and 

confers certain advantages and disadvantages in the study of GA, the question 

of choice of allograft is more contentious. 

The allografts hitherto described can be broadly divided into whole organ 

and isolated arterial grafts. In this chapter we discuss the merits and deficits of 

all major animal models of GA, paying particular attention to selection of species 

and the type of allograft used. It is important to note that the etiology of 

clinical GA is likely to be multifactorial, and in general terms the choice of 

experimental model adopted is to a great extent dictated by the nature of the 

question being addressed. Secondary consideration must also be given to the 

availability of technical expertise and personal preference. 

2. Species Selection 

Among laboratory animals, rodents are the most commonly used species in 

experimental models of GA. Availability of inbred strains with defined major 

and minor histocompatibility antigens allows transplantation between animals 

with different degrees of mismatch. Moreover, these experiments can be controlled 

against nonimmune mediated vascular injury such as ischemia/reperfusion 

injury or surgical trauma by performing isografts between inbred animals. 

Murine species in particular offer a large range of genetically altered strains, 

which can be used to investigate the role of particular gene products in GA. 

However, although studies based on rodent models have generated significant 

amounts of useful information, it must be kept in mind that there are important 

physiological and anatomical differences between murine species and humans 

(5). In particular, lack of constitutive endothelial expression of major histo-


compatibility antigen (MHC) class II antigen, absence of neointimal lipid deposition, 

and resistance of rodents to native vessel arteriosclerosis are major limitations 

of mouse-based models of GA (6). In addition, in many murine heart 

transplantation models, GA is generated in the context of indefinite graft survival 

in the absence of long-term immunosuppression (7). It is conceivable that 

pathogenesis of GA seen in this setting may be different to that seen in clinical 

GA, which develops in the context of chronic immunosuppression. 

Larger laboratory animals, although not as versatile in terms of availability of 

genetically altered strains, have some notable advantages compared to rodents. 

These are anatomically and physiologically closer to humans, and therefore models 

may be more representative of clinical GA. In addition, large animals allow 

multiple blood sampling, repeated biopsies, orthotopic transplantation, and in 

some cases serial imaging with intracoronary ultrasonography. This latter technology 

can facilitate assessment of progression of GA as manifested by intimal 

thickening in vivo and therefore allow continuous monitoring of the impact of 

therapeutic interventions on the disease process. The advantages of using large 

animals are offset by higher operative mortality and a significantly higher cost 

of purchase and maintenance. 

Porcine models are particularly attractive, as their cardiovascular physiology 

and anatomy closely resemble those found in humans. There is also important 

homology between the immune systems of pig and human. For instance, 

unlike the situation in rodents, porcine coronary endothelium constitutively 

expresses class II antigens, a difference that may be particularly relevant given 

the importance of vascular endothelium in atherogenesis (6). 

Rabbit models also offer all the advantages of a large laboratory animal at a 

relatively low cost. Susceptibility of rabbits to hypercholesterolemia is well 

recognized and has been exploited in animal models of native vessel atherosclerosis 

for many years (8). Studies on the role of gene therapy in prevention 

of GA represent one further area that has benefited from rabbit-based models 

(9). 

In contrast to lower species, a limited number of nonhuman primate models of 

GA have been described and characterized. Nevertheless, primates are considered 

to be particularly important in the study of the disease because of their close 

phylogenetic relationship to humans. This functional and structural homology 

can be exploited to evaluate novel therapeutic agents and “humanized” monoclonal 

antibodies (MAbs) prior to embarking on clinical trials. Susceptibility of 

primates to native vessel atherosclerosis is well recognized and has formed the 

basis of the use of these animals in atherosclerosis research (10). The significant 

cost of purchase and maintenance of primates has, however, proved prohibitive. 

and the use of these species has generally been restricted to immediate preclinical 

evaluation of therapeutic strategies.


3. Cardiac Allograft Models 

The techniques for heart transplantation in laboratory animals were described 

the 1960s (11), and it has long been recognized that GA can be generated experimentally 

provided the allograft is allowed to survive for a sufficient length of 

time. The arterial lesions observed in these models are morphologically similar 

to clinical GA, comprised of concentric intimal hyperplasia affecting all epicardial 

and intramyocardial coronary arteries to varying degrees. The prolonged 

graft survival necessary to allow development of GA is generally achieved by 

the use of immunosuppressive agents. Introduction of immunosupressants can, 

however, increase the complexity of the models given that many of these agents 

have themselves been implicated in the pathogenesis of GA (12,13). Additionally, 

the immunosuppressants used experimentally, such as anti-CD4 and anti- 

CD8 MAbs, have in general no clinical application and in some models result in 

permanent graft survival following only a brief period of peri-operative treatment 

(14). This is clearly not the case in the clinical setting, and this discrepancy 

may have important implications when extrapolating results from these models 

to clinical GA. One further characteristic of these models to consider is that, as 

in clinical GA, the coronary artery lesions in experimental cardiac allografts are 

generally heterogeneous in terms of their location, distribution, and intensity 

(Fig. 1). This is true for different regions of the same vessel, different vessels in 

the same graft region, and the same vessels in different grafts (15). This heterogeneity 

in lesion distribution makes quantitative evaluation of GA severity in 

these models somewhat complex. 

3.1. Orthotopic Heart Transplantation 

In 1968, Kosek reported a series of orthotopic heart transplants in dogs (4). 

The operation, which required the use of cardiopulmonary bypass, was performed 

through a left thoracotomy. Azathioprine and methylprednisolone were 

used as immunosuppressants to allow prolonged allograft survival. The allografts 

in long-term survivors developed circumferential intimal thickening in the coronary 

arteries, similar to clinical GA both morphologically and in terms of distribution. 

Orthotopic heart transplantation has also been described in pigs (16) and nonhuman 

primates (17), although these models have not been specifically used to 

address issues relevant to pathogenesis of GA. Experimental orthotopic heart 

transplantation has the clear advantage of simulating clinical transplantation both 

physiologically and anatomically. Its application in the study of GA has, however, 

been limited by the complexity of the procedure, the need for cardiopulmonary 

bypass, and significant peri-operative mortality. In addition, the operation 

can only be performed in higher animals, imposing substantial expense on the 

investigator.

405 

Fig. 1. Variation in GA severity among cardiac allograft vessels. The center image is a histological cross section taken from the 

middle portion of a 55-d mouse heart allograft (Verhoeff elastin stain, original magnification ´ 10). Four coronary arteries 

are enlarged from the cross section to show the diversity of intimal thickening observed within a given section of a murine heart 

allograft. 

Experimental Models of Graft Arteriosclerosis 405


Fig. 2. Surgical photographs showing the donor heart attached to the recipient 

abdominal aorta and inferior vena cava. The bowel has been displaced laterally to 

expose the great vessels. LV, left ventricle; RV, right ventricle; PA, pulmonary artery; 

LA, left atrium; IVC, inferior vena cava; SB, small bowel. 

3.2. Heterotopic Heart Transplantation 

Intra-abdominal cardiac allografting was described by Ono and Lindsey in the 

1960s (11). In this operation the donor heart is transplanted into the abdominal 

cavity of the recipient animal by anastomozing the donor ascending aorta and 

pulmonary artery to the recipient abdominal aorta and inferior vena cava, respectively 

(Fig. 2). Heterotopically transplanted rat cardiac allografts were shown


by Laden and others to develop GA, which is morphologically indistinguishable 

from clinical graft coronary disease provided the grafts survive long 

enough (18,19). This long-term survival can be achieved by exchanging grafts 

between strains that are disparate in non-MHC loci only (20,21) in the absence 

of immunosuppression or, alternatively, in MHC-mismatched transplants by 

the use of chronic immunosuppression (22). The versatility of this model has 

rendered it ideal for evaluating novel therapeutic agents (23–26). The rat model 

also provides abundant graft tissue for gene-expression studies. For example, 

these studies have demonstrated increased allograft expression of monocyte 

chemoattractant protein-1 in the Lewis to F-344 heart transplantation model 

(27). The same model has been used to demonstrate upregulation in the cardiac 

allograft of genes encoding interferon (IFN)-γ, interleukin(IL)-6, endothelin-1, 

inflammatory factor-1, and inducible nitric oxide (28–31). Other studies have 

shown upregulation of platelet-derived growth factor expression, which has 

been implicated in smooth muscle proliferation and migration into the neointima 

(32,33). An extension of the rat heterotopic heart model has been a 

retransplantation model that has been used to study the early events after transplantation. 

In this model, retransplantation of allografts back into the original 

donor strain failed to prevent GA if the grafts had resided in the primary recipient 

for up to 5 d; residence in the primary allogeneic recipient for less than 4 d 

did not result in GA in the secondary recipient (34). This indicated that the 

immune injury responsible for development of GA in this model occurs early 

after transplantation and becomes irreversible after the fifth day. 

Although the technique of heterotopic heart transplantation in mice was 

described in the 1970s (35), it was not until recently that this model was 

adapted for the study of GA. The surgical technique in humans is identical to 

that in rats, albeit on a smaller scale. It has been shown that if cardiac allografts 

are exchanged between inbred strains that differ in only a single MHC locus 

(e.g., B10.A and B10.BR), prolonged graft survival could be achieved without 

the use of immunosuppression (36). In this setting intimal hyperplasia develops, 

affecting the coronary arteries within 30–50 d of transplantation. Since its 

original description, a number of variants of this model have been described 

that are based on the choice of strain combination and the use of immunosuppressant 

agents (7,37,38). These models have been used extensively to study 

many aspects of GA. GA has, for example, been produced in this model by 

transfer of alloantibodies to severe combined immune deficiency recipients of 

cardiac allografts (39). This important observation is generally taken as evidence 

that alloantibodies are necessary to promote GA. Further evidence for 

the role of alloantibodies came from studies on B-cell-deficient cardiac allograft 

recipients, which failed to generate typical intimal proliferation (40). 

More recently, it has been shown that the detrimental effects of alloantibodies


can be averted by allograft expression of antioxidant and antiapoptotic genes 

and that passive transfer of alloantibody can only result in GA if it is done 

before allograft expression of protective genes (7). 

The use of blocking monoclonal antibodies has allowed identification of several 

key elements in the pathogenesis of GA such as adhesion molecules (41), 

T-cell co-stimulatory molecules (7), and chemokines (42). However, the main 

contribution of the mouse models stems from the availability of strains with targeted 

gene deletions. The use of knockout and transgenic strains used as cardiac 

allograft donors or recipients has allowed the identification of key gene products 

in the pathogenesis of GA. The Th1 cytokine IFN-γ has, for example, been implicated 

in pathogenesis of GA because IFN-γ-deficient recipients of cardiac 

allografts do not develop GA (43,44). Similarly targeted deletion of the transcription 

factor signal transducer and activation of transcription-4 resulted in attenuation 

of GA, possibly by promoting Th2 lymphocyte differentiation (45). In 

contrast, recipient’s deficiencies of IL-4 or tumor necrosis factor-α receptor-1 

did not diminish (46,47), and IL-10, transforming growth factor-β1, nitric oxide 

synthase (NOS)2, or apolipoprotein-E deficiency augmented GA (48–52). 

A variant of rodent abdominal heart transplantation is cervical transplantation. 

In this operation the graft ascending aorta and pulmonary artery are anastomosed 

end-to-side to the recipient common carotid artery and external jugular 

vein, respectively. This approach obviates the need to breach the recipient peritoneal 

cavity and thus carries a lower surgical mortality. Concern, however, 

has been expressed about the sufficiency of flow in the recipient carotid artery 

to sustain the cardiac graft (53–55). 

The porcine heterotopic heart transplantation model was described to allow 

the study of the immunological basis of GA in a large animal setting (6). Porcine 

species offer the advantage of having immune and cardiovascular systems similar 

to those of humans, with comparable susceptibility to atherosclerosis (56). 

Partially inbred miniature swine offer the possibility of transplantation across 

defined MHC barriers. There is the additional advantage of performing intracoronary 

ultrasonography, as the porcine coronary arteries are large enough to admit 

catheterization. In this model the donor heart is transplanted heterotopically in 

the recipient’s retroperitoneal space. The donor ascending aorta and pulmonary 

artery are anastomosed end-to-side to the recipient infrarenal abdominal aorta 

and inferior vena cava, respectively. Before the anastomoses are constructed, an 

atrial septal defect is created and the graft mitral apparatus is disrupted to avoid 

left ventricular atrophy by increasing the preload. This model has been used to 

assess the impact of donor-specific tolerance (57) and mixed hematopoietic chimerism 

in the recipient (58) on the development of GA. 

Cervical cardiac transplantation in the rabbit was described in the late 1970s 

(59) in a series of experiments in which recipients fed on a lipid-poor diet were


shown to develop proliferative coronary arterial lesions typical of GA. In cholesterol-fed 

rabbits, arterial lesions were similarly distributed, but the majority 

of lesions were fatty-proliferative. It was concluded from these studies that 

immunological arterial injury due to allograft rejection acting in synergy with 

hypercholesterolemia could lead to rapidly developing arteriosclerosis. The 

role of hypercholesterolemia was further supported by studies in which pharmacological 

(60) or mechanical (61) reduction of cholesterol level diminished 

GA in this model. The question of the relationship between episodes of AR and 

development of GA was recently revisited using this model. In a study in which 

episodes of AR were manipulated using cyclosporine, it was shown that AR 

could accelerate graft vascular disease (62). 

Heterotopic heart transplantation models have also been described in nonhuman 

primates. The technique is identical to that in other animal models (63). 

When cardiac allografts were exchanged between MHC class II-mismatched 

cynomolgus monkeys, prolonged graft survival was achieved by treatment of 

the recipient with humanized anti-CD154 antibody. It was shown that sustained 

treatment with this antibody resulted in longer median graft survival and diminished 

GA when compared with peri-operative dosing alone (63). 

3.3. Heterotopic “Functioning” Heart Transplantation 

Heterotopic cardiac allografts are physiologically “nonfunctioning” and thus 

may behave differently from an orthotopic heart transplant. Hemodynamic offloading 

of the heart in heterotopic models has been shown to lead to atrophy at 

organ and molecular levels (64). Although “functioning” heterotopic cardiac 

allografts have been described (64), these models have not been adapted for the 

study of GA. In the model described by Klein et al. (64) hearts are transplanted 

heterotopicaly using an end-to-side anastomosis between the donor’s superior 

vena cava and the recipient’s abdominal inferior vena cava. The right ventricle 

loads the left ventricle via a direct anastomosis of the pulmonary artery to the 

left atrium. The left ventricle ejects volume through an end-to-side anastomosis 

of the donor aorta to the recipient abdominal aorta. 

4. Arterial Models 

Arterial allograft models were developed as an alternative to whole-organ 

grafts to allow mechanistic study of GA without the complications of an immune 

and nonimmune response to parenchymal tissue. In contrast with the organ allograft 

models, the lesions seen in these models are concentric, uniform, and reproducible 

(Fig. 3). Additionally, most vessel models described to date require no 

immunosuppression because there is no acute destructive parenchymal rejection 

that would otherwise precede the emergence of GA. This is an important point 

because a number of immunosuppressive agents have themselves been impli-


Fig. 3. Photomicrographs showing cross sections of arterial allografts. (A) 75-d rat 

aortic allograft (H&E stain, original magnification ×100). (B–D) 30-d mouse carotid 

artery allograft (original magnification ×200): (B) stained with Verhoeff stain (elastic 

lamina is stained black) delineating near-occlusive neointima, (C) stained for a-actin 

showing abundance of smooth muscle cells in the neointima, and (D) stained for CD45. 

(E,F) 45- and 75-d rat carotid artery allografts (original magnification ×100). Elastic 

lamina is stained black (Verhoeff stain), delineating the neointima. It is evident that the 

neointimal thickness in the rat is only moderate (nonocclusive). 

cated in the pathogenesis of transplant arteriosclerosis (3,12,13). Lack of immunosuppression 

is, however, regarded by some as a potential concern. It has, for 

instance, been suggested that GA seen in vessel allografts in the absence of 

immunosuppression may be initiated by a different mechanism from that seen


in whole-organ allografts (65). Notwithstanding these concerns, and as is outlined 

here, arterial models of GA have helped address a number of important 

mechanistic and interventional issues in this disease. 

4.1. Aortic Allograft Model 

The rat aortic allograft was the first vessel model described for the study of 

GA (66). In relative terms, this is a simple procedure whereby a segment of 

donor descending aorta is transplanted as an interposition graft into the 

infrarenal descending aorta of the recipient. The model takes advantage of all 

the merits of isolated vessel allograft in addition to relative ease of surgery 

conferred by the size of rat aorta. The degree of intimal hyperplasia is, however, 

modest relative to the vessel diameter, in part because of the paucity of 

smooth muscle cells in the aortic media (Fig. 3A). Also, the operation involves 

invasion of the peritoneal space and hence carries a higher mortality than the 

procedures in the neck or the groin. The rat aortic model became immediately 

popular after its description, particularly for evaluation of preexisting and novel 

agents for prevention of GA. These included cyclosporine (13), the angiotensin-converting 

enzyme inhibitor perindopril (67), platelet-activating factor 

receptor blockers (68), angiopeptin (69), mycophenolate mofetil (70), and lowmolecular-weight 

heparin (71). 

Unlike many murine vessel models, the rat aortic allograft provides abundant 

tissue for gene-expression studies. For example, expression of inducible 

NOS (72) and Fas-ligand (73) has been shown to be associated with GA. 

Like the heterotopic heart model, the aortic allograft model has been extended 

to address the early events after transplantation by performing graft retransplantation 

(74). Using this modification it was possible to corroborate the notion that 

the vascular insult that ultimately leads to GA occurs early after transplantation 

and that elimination of histoincompatibility after this early phase did not alter the 

disease process (74). 

A murine abdominal aortic model has also been described (75), which, although 

technically more demanding, confers the added advantage of using genetically 

modified strains not available in rats. 

The aortic model has also been extended to larger animals. The rabbit aortic 

allograft model was described primarily to study cholesterol metabolism in 

transplanted arteries (76). The technique is similar to other vessel allograft 

models, albeit in a larger scale. Briefly, the donor thoracic aorta is grafted onto 

the recipient abdominal aorta in an end-to-side fashion to construct a bypass 

graft. In addition to studies on cholesterol metabolism, this model has been 

used to show protective roles for estrogens (77) in GA. The rabbit model of 

aortic transplantation has also been used to investigate the feasibility of adenovirus-mediated 

gene transfer to prevent GA (9).


A primate aortic model of allograft arteriosclerosis has been described specifically 

to study disease progression using serial intravascular ultrasound (IVUS) 

(78). In this model, aortic allografts were transplanted below the inferior mesenteric 

artery of recipient rhesus monkeys. Removed and reimplanted aortic segments 

between renal arteries and the inferior mesenteric arteries served as control 

autografts. Serial postoperative IVUS studies demonstrated progressive increase 

in the intimal area over the 98-d observation period. Histological analysis of 

allografts removed at autopsy showed typical concentric intimal hyperplasia. 

4.2. Carotid Artery Models 

The carotid artery has been perceived to be a suitable vessel for transplantation 

because of a number of technical considerations. First, the operation is performed 

in the neck region, obviating the need to breach the peritoneum with its 

associated complications. Second, the common carotid artery bears no side 

branches, facilitating both the donor and recipient procedures. Third, the carotid 

artery represents a small-caliber artery, reflecting the changes in smaller sized 

vessels in solid organ transplants that develop arteriosclerosis. Fourth, two genetically 

identical grafts are available from the same donor for two comparative 

transplants. 

In the first description of a murine carotid transplant model, a segment of 

donor common carotid artery was transplanted as a paratopic loop graft onto the 

recipient carotid artery (79) (Fig. 4). In this model, allografts had near-occlusive 

intimal hyperplasia within 30 d of transplantation in the absence of immunosuppressive 

agents (Fig. 3B). This was in contrast with preservation of normal morphology 

in isografts within the same time scale (79). The neointima in allografts, 

initially composed of macrophage/monocytes and lymphocytes (CD4 + and 

CD8 + ), was replaced with smooth muscle cells and extracellular matrix by d 30 

(Fig. 3C,D). 

The vascular remodeling seen in this model is morphologically similar to 

clinical allograft coronary disease with a smooth-muscle-rich concenteric 

neointima. Furthermore, the model confers uniformity and reproducibility of 

the neointima, which would facilitate accurate quantitative evaluation of lesion 

severity. Because the vessel allograft is transplanted as a loop, there was initial 

concern that potentially turbulent flow could cause endothelial injury and promote 

neointima formation. However, the absence of neointima in isografts or in 

allografts transplanted into certain knockout strains would suggest that turbulence 

alone is not a significant contributing factor in this model. 

The immunological basis of GA was first addressed systematically in this 

model using genetically manipulated mouse strains as recipients of carotid artery 

allografts. It therefore became possible to decipher the relative contribution of 

key gene products to pathogenesis of GA. Allografts from Rag-2-/- recipients, for


Fig. 4. Photograph of operative field showing the left carotid artery of the recipient, 

to which the donor artery has been sutured as a loop. 

instance, which lack immunoglobulins and T-cell receptors had no neointima, 

indicating that GA is primarily an immune-mediated process. In addition, grafts 

from recipients deficient in MHC class II antigen or CD4 + cells but not CD8 + 

cells had a significantly diminished neointima (80). Likewise, allografts from 

apoE knockout recipients had enhanced, and those from plasminogen-deficient 

recipients diminished, neointima formation (81,82). 

Using knockout strains as donors, it was then possible to demonstrate that 

donor expression of MHC class II but not class I was needed for GA to develop. 

Similarly, graft expression of intercellular adhesion molecule (ICAM)-1 but not 

P-selectin was shown to be necessary (83). 

Modifications of this model have been described in which interposition 

grafts were used in an attempt to reduce flow turbulence. These models use 

suture or cuff techniques (84), adding to the complexity of the procedure. In 

addition, the reduced length of the interposition graft diminishes the amount of 

tissue available for analysis. 

Carotid artery loop transplantation has also been described in rats (85). The 

procedure is identical to that in the mouse. In this model the observation period 

is longer (45–75 d), and unlike the mouse carotid artery, the rat arterial lesions 

rarely become occlusive (Fig. 3E,F). However, larger vessel sizes in the rat 

makes the surgery easier to perform and also allow for noninvasive imaging of 

the graft using Doppler ultrasound (85). Ultrasound imaging may allow con-


tinuous study of vascular remodeling in response to therapeutic interventions. 

In the LEW-to-F344 strain combination, the neointima, although rich in lymphocytes, 

lacked a significant smooth muscle cell component as compared with 

vessels seen in cardiac allografts of the same age (85). Whether this discrepancy 

in cellularity of the neointima in different allografts is significant remains 

uncertain. 

4.3. Femoral Artery Model 

In this model, a segment of donor femoral artery is transplanted orthotopically 

to the recipient femoral artery (86). Like the carotid artery, the rat femoral 

artery is a small-caliber muscular artery and therefore a suitable alternative 

to the aorta. The model also obviates the need to breach the peritoneal space. 

An interesting observation made in this model was that in 40-d allografts, 

neointimal and medial smooth muscle cells were entirely of recipient origin 

(87). The recipient origin of the neointimal cells led to the speculation that the 

mechanism of neointima formation may be different in vessel allografts as compared 

with organ allografts (65). Further evidence supporting this notion came 

from a study using the rat aortic model, in which recolonization of allograft 

with recipient origin endothelial cells by the 18th postoperative day was demonstrated 

(88). Also in this study, by postoperative day 60 the neointimal cells 

were noted to be of recipient origin. In contrast, in a study of long-term murine 

cardiac allografts (38), graft endothelial and medial smooth muscle cells were 

shown to express donor-specific MHC class II molecules. However, the origin 

of neointimal smooth muscle cells was not determined in this study. It is evident 

from these studies that there is no clear consensus over the origin of vascular 

endothelial and smooth muscle cells in the remodeled arterial allograft. 

Nor is it established whether the origin of cellular components has any bearing 

toward the mechanism of vascular remodeling. 

4.4. Coronary Artery Model 

The isolated coronary artery transplantation model was developed in an attempt 

to overcome the structural differences between the coronary artery and other 

vessel grafts and also the heterogeneity of arterial lesions in solid organ allografts 

(89). Like other vessel models, this model has the added advantage of not 

requiring the use of immunosuppression. 

Technically, a segment of donor coronary artery was transplanted heterotopically 

into the recipient common carotid artery position. The grafts were anastomosed 

end-to-side to the recipient artery, and the intervening carotid artery was 

excised for baseline histological analysis. Allografts exhibited rapidly progressive 

vascular remodeling with endothelial hyperplasia, intimal fibromuscular 

hyperplasia, and medial necrosis.



The myriad of experimental models available for the study of GA is itself a 

testament to the fact that there is no single “ideal” model that can represent all 

aspects of what is undoubtedly a multifactorial clinical entity. The common 

theme in all the models described is morphological resemblance of arterial 

lesions in experimental allografts with lesions encountered in clinical GA. It is 

entirely possible that the mechanism by which this common endpoint is reached 

may be different in each model. It is also conceivable that the disease mechanism 

in each model may or may not be that which is relevant in clinical GA. 

This view may explain the variation in the impact of novel therapeutic strategies 

in various model systems and the ultimate disappointing outcome often 

encountered in clinical trials. This concept of model generation based on morphological 

outcome is, however, a consequence of the fact that clinical studies 

have not thus far pointed to a unitary mechanism for the disease. Until such 

time that clinical studies can focus our attention on relevant pathways of the 

disease, we are obliged to address each potential mechanism by adopting a 

different model. Therefore, potentially relevant early events can be targeted by 

using models that do not require immunosuppression such as vessel models, 

and later more chronic events can be addressed by adopting organ-based models. 

However, neither approach can unequivocally define the mechanisms that 

are both necessary and sufficient to produce clinical GA, and therapeutic strategies 

based on these models must be regarded as tentative until verified in 

clinical trials. 

6. Technical Procedures 

6.1. Surgical Technique: Murine Heterotopic Heart (35) 

6.1.1. Donor Procedure 

1. The animal is anesthetized and fixed in supine position. 

2. A midline thoraco-abdominal incision is made exposing the heart and the entire 

length of aorta and inferior vena cava (IVC). 

3. After injecting 5 mL of heparinized saline, the inferior vena cava is divided followed 

by division of the superior vena cava. 

4. The ascending aorta and the main pulmonary artery are then divided allowing 

ligation of all pulmonary veins en bloc. 

5. The allograft is then stored in heparinized saline on ice. 

6.1.2. Recipient Procedure 

1. The animal is anesthetized and fixed in supine position. 

2. The operation is performed under an operating microscope (×16 magnification). 

3. A Gable type rooftop incision is made, allowing access to the abdomen. 

4. The bowel is displaced laterally to expose the infrarenal aorta and the IVC.


5. Lumbar vein and arteries are identified and cauterized. The aorta and the IVC are 

then clamped above and below, exposing a 1-cm infrarenal segment of the great 

vessels. 

6. The donor ascending aorta is anastomosed end-to-side using 10-0 nylon to the 

recipient aorta. 

7. The donor pulmonary artery is anastomosed end-to-side to the recipient IVC using 

10-0 nylon suture. 

8. The clamps are removed, allowing perfusion of the graft and commencement of 

sinus rhythm. 

6.2. Surgical Technique: Murine Carotid Artery Model (79) 

6.2.1. Donor Procedure 

1. The donor animal is fixed in a supine position with its neck extended. 

2. Following a midline incision in the neck the cleidomastoid muscles are resected. 

Both the left and right carotid arteries are fully dissected from the arch to the 

bifurcation and removed. 

3. Harvested arteries are washed with heparinized saline and preserved in isotonic 

saline at room temperature until grafted into two recipient animals. 

6.2.2. Recipient Procedure 

1. The recipient animal is then fixed in a supine position with its neck extended. 

2. A midline incision is made on the ventral surface of the neck from the suprasternal 

notch to the chin. 

3. The left cleidomastoid muscle is resected. The left carotid artery is dissected 

from the bifurcation in the distal end toward the proximal end as far as technically 

possible. 

4. The artery is then occluded with two microvascular clamps, one at each end, and 

two longitudinal arteriotomies (0.5–0.6 mm) are made with a fine (30-gauge) 

needle and scissors. 

5. The graft is then transplanted paratopically into the recipient with an end-to-side 

anastomosis with an 11/0 continuous nylon suture under ×16–25 magnification. 

6. Before the distal anastomosis is constructed, the proximal clamp is released to 

flush away residual blood inside the lumen. Both clamps are released after the 

two anastomoses are completed. At this point prominent pulsations should be 

visible in both the transplanted loop and the native vessel. If there are no pulsations 

or they are diminished within a few minutes of restoration of blood flow, 

thrombosis at the anastomosis is assumed and the procedure is terminated and 

considered a surgical failure. 

7. If there are vigorous pulsations in the transplanted vessel, the skin incision is 

closed. 

6.3. Surgical Technique: Rat Aortic Model (66) 

6.3.1. Donor Operation 

1. A midline abdominal incision is made and the bowel is retracted to the right. 

2. A segment of aorta between the renal arteries and its bifurcation is separated 

from the vena cava.


3. Following injection of 0.5 mL of saline solution containing 50 U of heparin into 

the inferior vena cava, the segment of aorta is removed. 

6.3.2. Recipient Operation 

1. A midline incision is made from the xiphoid to the pelvis, and the abdominal 

walls are retracted. 

2. The bowel is wrapped in saline-solution-moistened gauze and displaced to the 

animal’s right. 

3. The infrarenal aorta is dissected free and mobilized as far as possible, between 

the renal arteries proximally and the bifurcation distally. 

4. All of the small branches of this segment are cut with the fine-tip cautery. 

5. The proximal and distal portions of the aorta are clamped, and the intervening 

segment is resected. 

6. The donor aorta is placed in the orthotopic position, and the anastomosis is performed 

using interrupted 10-0 nylon suture. 

References 

1. Billingham, M. E. (1987) Graft coronary disease: the lesions and the patients. 

Transplant. Proc. 19, 19. 

2. Hayry, P., Paavonen, T., Mennander, A., Ustinov, J., Raisanen, A., and Lemstrom, 

K. (1993) Pathophysiology of allograft arteriosclerosis. Transplant. Proc. 25, 

2070. 

3. Meiser, B. M., Billingham, M. E., and Morris, R. E. (1991) Effects of 

cyclosporin, FK506, and rapamycin on graft-vessel disease [see comments]. 

Lancet 338, 1297. 

4. Kosek, J. C., Hurley, E. J., and Lower, R. R. (1968) Histopathology of orthotopic 

canine cardiac homografts. Lab. Invest. 19, 97. 

5. Muller, D. W., Ellis, S. G., and Topol, E. J. (1992) Experimental models of coronary 

artery restenosis [published erratum appears in J. Am. Coll.Cardiol.1992 

19(7),1678]. J. Am. Coll. Cardiol. 19, 418. 

6. Madsen, J. C., Sachs, D. H., Fallon, J. T., and Weissman, N. J. (1996) Cardiac 

allograft vasculopathy in partially inbred miniature swine. I. Time course, pathology, 

and dependence on immune mechanisms. J. Thorac. Cardiovasc. Surg. 111, 

1230. 

7. Hancock, W. W., Buelow, R., Sayegh, M. H., and Turka, L. A. (1998) Antibodyinduced 

transplant arteriosclerosis is prevented by graft expression of anti-oxidant 

and anti-apoptotic genes. Nat. Med. 4, 1392. 

8. Besterman, E. M. (1970) Experimental coronary atherosclerosis in rabbits. Atherosclerosis 

12, 75. 

9. Mehra, M. R., Stapleton, D. D., Cook, J. L., et al. (1996) Adenovirus-mediated in 

vivo gene transfer in a rabbit model of allograft vasculopathy. J. Heart Lung 

Transplant. 15, 51. 

10. Vesselinovitch, D. (1988) Animal models and the study of atherosclerosis. Arch. 

Pathol. Lab. Med. 112, 1011.


11. Ono, K., and Lindsey, E. S. (1969) Improved technique of heart transplantation in 

rats. J. Thorac. Cardiovasc. Surg. 57, 225. 

12. Arai, S., Teramoto, S., and Senoo, Y. (1992) The impact of FK506 on graft coronary 

disease of rat cardiac allograft—a comparison with cyclosporine. J. Heart 


13. Mennander, A., Tiisala, S. Paavonen, T. Halttunen, J., and Hayry, P. (1991) 

Chronic rejection of rat aortic allograft. II. Administration of cyclosporin induces 

accelerated allograft arteriosclerosis. Transplant. Int. 4, 173. 

14. Russell, P. S., Chase, C. M., Winn, H. J., and Colvin, R. B. (1994) Coronary 

atherosclerosis in transplanted mouse hearts. I. Time course and immunogenetic 

and immunopathological considerations. Am. J. Pathol. 144, 260. 

15. Armstrong, A. T., Strauch, A. R., Starling, R. C., Sedmak, D. D., and Orosz, C. G. 

(1997) Morphometric analysis of neointimal formation in murine cardiac allografts. 

Transplantation 63, 941. 

16. Cullum, P. A., Baum, M., Clarke, A., Wemyss-Gorman, P. B., Howard, E., and 

McClelland, R. M. (1970) Orthotopic transplantation of the pig heart. Thorax 25, 

744. 

17. Pennock, J. L., Reitz, B. A., Bieber, C. P., et al. (1981) Survival of primates following 

orthotopic cardiac transplantation treated with total lymphoid irradiation 

and chemical immune suppression. Transplantation 32, 467. 

18. Laden, A. M. and Sinclair, R. A. (1971) Thickening of arterial intima in rat cardiac 

allografts. A light and electron microscopic study. Am. J. Pathol. 63, 69. 

19. Lurie, K. G., Billingham, M. E., Jamieson, S. W., Harrison, D. C., and Reitz, B. 

A. (1981) Pathogenesis and prevention of graft arteriosclerosis in an experimental 

heart transplant model. Transplantation 31, 41. 

20. Laden, A. M. (1972) The effects of treatment on the arterial lesions of rat and 

rabbit cardiac allografts. Transplantation 13, 281. 

21. Adams, D. H., Tilney, N. L., Collins, Jr., J. J., and Karnovsky, M. J. (1992) Experimental 

graft arteriosclerosis. I. The Lewis-to-F-344 allograft model. Transplantation 

53, 1115. 

22. Hosenpud, J. D., Boyle, T. M., Hensler, H., Sanford, G., and Khanna, A. K. (2000) 

The relationship between acute rejection and chronic rejection is highly dependent 

on specific MHC matching: a multi-strain rat heterotopic heart transplant 

study. Transplantation 69, 2173. 

23. Hachida, M., Lu, H., Zhang, X., et al. (1999) Inhibitory effect of triptolide on 

platelet derived growth factor-A and coronary arteriosclerosis after heart transplantation. 


24. Hachida, M., Zhang, X. L., Lu, H., Hoshi, H., and Koyanagi, H. (1999) Late 

multiglycosidorum tripterygium treatment ameliorates established graft coronary 

arteriosclerosis after heart transplantation in the rat. Transplant. Proc. 31, 

2020. 

25. Zhang, X., Hachida, M., Lu, H., Hoshi, H., and Koyanagi, H. (1999) Effect of 15deoxyspergualine 

on coronary arteriosclerosis and platelet-derived growth factor- 

A mRNA expression in the transplanted heart. Transplant. Proc 31, 1706.


26. Teranishi, K., Poston, R. S., Reitz, B. A., and Robbins, R. C. (1998) Oral delivery 

of low molecular weight heparin in rat cardiac allografts. Transplant. Proc. 30, 

996. 

27. Russell, M. E., Adams, D. H., Wyner, L. R., Yamashita, Y., Halnon, N. J., and 

Karnovsky, M. J. (1993) Early and persistent induction of monocyte 

chemoattractant protein 1 in rat cardiac allografts. Proc. Natl. Acad. Sci. USA 90, 

6086. 

28. Russell, M. E., Wallace, A. F., Hancock, W. W., et al. (1995) Upregulation of 

cytokines associated with macrophage activation in the Lewis-to-F344 rat transplantation 

model of chronic cardiac rejection. Transplantation 59, 572. 

29. Watschinger, B., Sayegh, M. H., Hancock, W. W., and Russell, M. E. (1995) 

Up-regulation of endothelin-1 mRNA and peptide expression in rat cardiac allografts 

with rejection and arteriosclerosis. Am. J. Pathol. 146, 1065. 

30. Utans, U., Arceci, R. J., Yamashita, Y., and Russell, M. E. (1995) Cloning and 

characterization of allograft inflammatory factor-1: a novel macrophage factor 

identified in rat cardiac allografts with chronic rejection. J. Clin. Invest. 95, 2954. 

31. Russell, M. E., Wallace, A. F., Wyner, L. R., Newell, J. B., and Karnovsky, M. J. 

(1995) Upregulation and modulation of inducible nitric oxide synthase in rat cardiac 

allografts with chronic rejection and transplant arteriosclerosis. Circulation 

92, 457. 

32. Hachida, M., Zhang, X., Lu, H., et al. (1998) Association between the degree of 

platelet-derived growth factor-A chain mRNA expression and coronary arteriosclerosis 

in the transplanted heart. Heart Vessels 13, 24. 

33. Ito, H., Hamano, K., Gohra, H., et al. (1998) Coronary arteriosclerosis did not 

occur in the transplanted hearts of tolerance-induced rats, analysis from plateletderived 

growth factor expression. Transplant. Proc. 30, 3871. 

34. Izutani, H., Miyagawa, S., Shirakura, R., et al. (1995) Evidence that graft coronary 

arteriosclerosis begins in the early phase after transplantation and progresses 

without chronic immunoreaction. Histopathological analysis using a retransplantation 

model. Transplantation 60, 1073. 

35. Corry, R. J., Winn, H. J., and Russell, P. S. (1973) Heart transplantation in 

congenic strains of mice. Transplant. Proc. 5, 733. 

36. Ardehali, A., Billingsley, A., Laks, H., Drinkwater, Jr., D. C., Sorensen, T. J., and 

Drake, T. A. (1993) Experimental cardiac allograft vasculopathy in mice. J. Heart 


37. Hirozane, T., Matsumori, A., Furukawa, Y., and Sasayama, S. (1995) Experimental 

graft coronary artery disease in a murine heterotopic cardiac transplant model. 

Circulation 91, 386. 

38. Hasegawa, S., Becker, G., Nagano, H., Libby, P., and Mitchell, R. N. (1998) Pattern 

of graft- and host-specific MHC class II expression in long-term murine cardiac 

allografts: origin of inflammatory and vascular wall cells. Am. J. Pathol. 153, 69. 

39. Russell, P. S., Chase, C. M., Winn, H. J., and Colvin, R. B. (1994) Coronary 

atherosclerosis in transplanted mouse hearts. II. Importance of humoral immunity. 

J. Immunol. 152, 5135.


40. Russell, P. S., Chase, C. M., and Colvin, R. B. (1997) Alloantibody- and T cellmediated 

immunity in the pathogenesis of transplant arteriosclerosis: lack of progression 

to sclerotic lesions in B cell-deficient mice. Transplantation 64, 1531. 

41. Russell, P. S., Chase, C. M., and Colvin, R. B. (1995) Coronary atherosclerosis in 

transplanted mouse hearts. IV Effects of treatment with monoclonal antibodies to 

intercellular adhesion molecule-1 and leukocyte function-associated antigen-1. 

Transplantation 60, 724. 

42. Gao, W., Topham, P. S., King, J. A., et al. (2000) Targeting of the chemokine 

receptor CCR1 suppresses development of acute and chronic cardiac allograft 

rejection. J. Clin. Invest. 105, 35. 

43. Nagano, H., Mitchell, R. N., Taylor, M. K., Hasegawa, S., Tilney, N. L., and Libby, 

P. (1997) Interferon-gamma deficiency prevents coronary arteriosclerosis but not 

myocardial rejection in transplanted mouse hearts. J. Clin. Invest. 100, 550. 

44. Raisanen-Sokolowski, A., Glysing-Jensen, T., Koglin, J., and Russell, M. E. 

(1998) Reduced transplant arteriosclerosis in murine cardiac allografts placed in 

interferon-gamma knockout recipients. Am. J. Pathol. 152, 359. 

45. Koglin, J., Glysing-Jensen, T., Gadiraju, S., and Russell, M. E. (2000) Attenuated 

cardiac allograft vasculopathy in mice with targeted deletion of the transcription 

factor STAT4. Circulation 101, 1034. 

46. Nagano, H., Tilney, N. L., Stinn, J. L., et al. (1999) Deficiencies of IL-4 or TNFalpha 

receptor-1 do not diminish graft arteriosclerosis in cardiac allografts. Transplant. 

Proc. 31, 152. 

47. Mottram, P. L., Raisanen-Sokolowski, A., Glysing-Jensen, T., Stein-Oakley, A. 

N., and Russell, M. E. (1998) Cardiac allografts from IL-4 knockout recipients: 

assessment of transplant arteriosclerosis and peripheral tolerance. J. Immunol. 

161, 602. 

48. Raisanen-Sokolowski, A., Glysing-Jensen, T., and Russell, M. E. (1998) Leukocyte-suppressing 

influences of interleukin (IL)-10 in cardiac allografts: insights 

from IL-10 knockout mice. Am. J. Pathol. 153, 1491. 

49. Furukawa, Y., Becker, G., Stinn, J. L., Shimizu, K., Libby, P., and Mitchell, R. 

N. (1999) Interleukin-10 (IL-10) augments allograft arterial disease: paradoxical 

effects of IL-10 in vivo. Am. J. Pathol. 155, 1929. 

50. Koglin, J., Glysing-Jensen, T., Raisanen-Sokolowski, A., and Russell, M. E. (1998) 

Immune sources of transforming growth factor-beta1 reduce transplant arteriosclerosis: 

insight derived from a knockout mouse model. Circ Res 83, 652. 

51. Koglin, J., Glysing-Jensen, T., Mudgett, J. S., and Russell, M. E. (1998) NOS2 

mediates opposing effects in models of acute and chronic cardiac rejection: insights 

from NOS2-knockout mice. Am. J. Pathol. 153, 1371. 

52. Russell, P. S., Chase, C. M., and Colvin, R. B. (1996) Accelerated atheromatous 

lesions in mouse hearts transplanted to apolipoprotein-E-deficient recipients. Am. 

J. Pathol. 149, 91. 

53. Tomita, Y., Zhang, Q. W., Yoshikawa, M., Uchida, T., Nomoto, K., and Yasui, H. 

(1997) Improved technique of heterotopic cervical heart transplantation in mice. 

Transplantation 64, 1598.


54. Chen, Z. H. (1991) A technique of cervical heterotopic heart transplantation in 

mice. Transplantation 52, 1099. 

55. Matsuura, A., Abe, T., and Yasuura, K. (1991) Simplified mouse cervical heart 

transplantation using a cuff technique. Transplantation 51, 896. 

56. Fuster, V., Badimon, L., Badimon, J. J., Ip, J. H., and Chesebro, J. H. (1991) The 

porcine model for the understanding of thrombogenesis and atherogenesis. Mayo 

Clin. Proc. 66, 818. 

57. Madsen, J. C., Yamada, K., Allan, J. S., et al. (1998) Transplantation tolerance 

prevents cardiac allograft vasculopathy in major histocompatibility complex class 

I-disparate miniature swine. Transplantation 65, 304. 

58. Schwarze, M. L., Menard, M. T., Fuchimoto, Y., et al. (2000) Mixed hematopoietic 

chimerism induces long-term tolerance to cardiac allografts in miniature 

swine. Ann. Thorac. Surg. 70, 131. 

59. Alonso, D. R., Starek, P. K., and Minick, C. R. (1977) Studies on the pathogenesis 

of atheroarteriosclerosis induced in rabbit cardiac allografts by the synergy of 

graft rejection and hypercholesterolemia. Am. J. Pathol. 87, 415. 

60. Ogawa, N., Koyama, I., Shibata, T., et al. (1996) Pravastatin prevents the progression 

of accelerated coronary artery disease after heart transplantation in a rabbit 

model. Transplant. Int. 9, S226. 

61. Esper, E., Glagov, S., Karp, R. B., et al. (1997) Role of hypercholesterolemia in 

accelerated transplant coronary vasculopathy: results of surgical therapy with partial 

ileal bypass in rabbits undergoing heterotopic heart transplantation. J. Heart 


62. Nakagawa, T., Sukhova, G. K., Rabkin, E., Winters, G. L., Schoen, F. J., and 

Libby, P. (1995) Acute rejection accelerates graft coronary disease in transplanted 

rabbit hearts. Circulation 92, 987. 

63. Pierson, R. N., 3rd, Chang, A. C., Blum, M. G., et al. (1999) Prolongation of 

primate cardiac allograft survival by treatment with ANTI-CD40 ligand (CD154) 

antibody. Transplantation 68, 1800. 

64. Klein, I., Hong, C., and Schreiber, S. S. (1990) Cardiac atrophy in the 

heterotopically transplanted rat heart: in vitro protein synthesis. J. Mol. Cell. 

Cardiol. 22, 461. 

65. Orosz, C. G. (2000) Considerations regarding the contributions of B cells to 

chronic allograft rejection in experimental animal models. J. Heart Lung Transplant. 

19, 634. 

66. Halttunen, J., Partanen, T., Leszczynski, D., Rinta, K., and Hayry, P. (1990) Rat 

aortic allografts: a model for chronic vascular rejection. Transplant. Proc. 22, 

125. 

67. Michel, J. B., Plissonnier, D., and Bruneval, P. (1992) Effect of perindopril on the 

immune arterial wall remodeling in the rat model of arterial graft rejection. Am. J. 

Med. 92, 39S. 

68. Raisanen, A., Mennander, A., Ustinov, J., Paavonen, T., and Hayry, P. (1993) 

Effect of platelet-activating factor (PAF) receptor blockers on smooth muscle cell 

replication in vitro and allograft arteriosclerosis in vivo. Transplant. Int. 6, 251.


69. Raisanen-Sokolowski, A., Mennander, A., Ustinov, J., Paavonen, T., and Hayry, 

P. (1993) Chronic rejection in rat aortic allograft: mechanism of angiopeptin (BIM 

23014C) inhibition on vascular smooth muscle cell proliferation in chronic rejection. 


70. Raisanen-Sokolowski, A., Myllarniemi, M., and Hayry, P. (1994) Effect of 

mycophenolate mofetil on allograft arteriosclerosis (chronic rejection). Transplant. 

Proc. 26, 3225. 

71. Akyurek, M. L., Larsson, E., Funa, K., Wanders, A., Kaijser, M., and Fellstrom, 

B. C. (1995) Experimental transplant arteriosclerosis: inhibition by angiopeptin 

and low molecular weight heparin derivatives. Transplant. Proc. 27, 3555. 

72. Akyurek, L. M., Fellstrom, B. C., Yan, Z. Q., Hansson, G. K., Funa, K., and 

Larsson, E. (1996) Inducible and endothelial nitric oxide synthase expression during 

development of transplant arteriosclerosis in rat aortic grafts. Am. J. Pathol. 

149, 1981. 

73. Akyurek, L. M., Johnsson, C., Lange, D., et al. (1998) Tolerance induction ameliorates 

allograft vasculopathy in rat aortic transplants. Influence of Fas-mediated 

apoptosis. J. Clin. Invest. 101, 2889. 

74. Mennander, A. and Hayry, P. (1996) Reversibility of allograft arteriosclerosis 

after retransplantation to donor strain. Transplantation 62, 526. 

75. Koulack, J., McAlister, V. C., Giacomantonio, C. A., Bitter-Suermann, H., 

MacDonald, A. S., and Lee, T. D. (1995) Development of a mouse aortic transplant 

model of chronic rejection. Microsurgery 16, 110. 

76. Hjelms, E. and Stender. S. (1992) Accelerated cholesterol accumulation in homologous 

arterial transplants in cholesterol-fed rabbits. A surgical model to study 

transplantation atherosclerosis. Arterioscler. Thromb. 12, 771. 

77. Jacobsson, J., Cheng, L., Lyke, K., et al. (1992) Effect of estradiol on accelerated 

atherosclerosis in rabbit heterotopic aortic allografts. J. Heart Lung Transplant. 

11, 1188. 

78. Gummert, J. F., Ikonen, T., Briffa, N., et al. (1998) A new large-animal model for 

research of graft vascular disease. Transplant. Proc. 30, 4023. 

79. Shi, C., Russell, M. E., Bianchi, C., Newell, J. B., and Haber, E. (1994) Murine 

model of accelerated transplant arteriosclerosis. Circ. Res. 75, 199. 

80. Shi, C., Lee, W. S., He, Q., et al. (1996) Immunologic basis of transplant-associated 

arteriosclerosis. Proc. Natl. Acad. Sci. USA 93, 4051. 

81. Shi, C., Lee, W. S., Russell, M. E., et al. (1997) Hypercholesterolemia exacerbates 

transplant arteriosclerosis via increased neointimal smooth muscle cell 

accumulation: studies in apolipoprotein E knockout mice. Circulation 96, 2722. 

82. Moons, L., Shi, C., Ploplis, V., et al. (1998) Reduced transplant arteriosclerosis in 

plasminogen-deficient mice. J. Clin. Invest. 102, 1788. 

83. Shi, C., Feinberg, M. W., Zhang, D., et al. (1999) Donor MHC and adhesion molecules 

in transplant arteriosclerosis. J. Clin. Invest. 103, 469. 

84. Dietrich, H., Hu, Y., Zou, Y., et al. (2000) Mouse model of transplant arteriosclerosis: 

role of intercellular adhesion molecule-1. Arterioscler. Thromb. Vasc. Biol. 

20, 343.


85. Hancock, W. W., Shi, C., Picard, M. H., Bianchi, C., and Russell, M. E. (1995) 

LEW-to-F344 carotid artery allografts: analysis of a rat model of posttransplant 

vascular injury involving cell-mediated and humoral responses. Transplantation 

60, 1565. 

86. Gregory, C. R., Huie, P., Shorthouse, R., et al. (1993) Treatment with rapamycin 

blocks arterial intimal thickening following mechanical and alloimmune injury. 


87. Brazelton, T. R., Adams, B., Shorthouse, R., and Morris, R. E. (1999) Chronic 

rejection: the result of uncontrolled remodelling of graft tissue by recipient mesenchymal 

cells? Data from two rodent models and the effects of immunosuppressive 

therapies. Inflamm. Res. 48, S134. 

88. Plissonnier, D., Nochy, D., Poncet, P., et al. (1995) Sequential immunological 

targeting of chronic experimental arterial allograft. Transplantation 60, 414. 

89. Tixier, D. B., Czer, L. S., Fishbein, M. C., et al. (1996) Isolated coronary artery 

transplantation in pigs: a new model to study transplantation arteriosclerosis and 

humoral rejection. J. Heart Lung Transplant. 15, 919.

METHODS IN MOLECULAR BIOLOGY • 333 

SERIES EDITOR: John M. Walker 

Methods in Molecular Biology • 333 

TRANSPLANTATIONAL IMMUNOLOGY 

METHODS AND PROTOCOLS 

ISBN: 1-58829-544-3 E-ISBN: 1-59745-049-9 

ISSN: 1064–3745 humanapress.com 

Transplantation Immunology 

Methods and Protocols 

Edited by 


National Heart and Lung Institute, London, UK 

Marlene Rose 

National Heart and Lung Institute, Harefield, UK 

Technical innovations in the laboratory over the past ten years have greatly improved our understanding 

of the immunological mechanisms of transplanted organ rejection. In Transplantation Immunology: 

Methods and Protocols, leading experts in solid organ transplantation review the current status of the field 

and describe cutting-edge techniques for detecting the immune response to the allografted organ. The 

authors present the latest techniques for HLA typing, detecting HLA antibodies, and monitoring T-cell 

response, and examine more specialized methods utilizing proteomics, laser dissection microscopy, and 

real-time polymerase chain reaction. The area of tolerance induction and reprogramming of the immune 

system is also covered, along with a discussion of up-to-date methods of organ preservation, of today’s 

optimal immunosuppressive drug regimens, as well as the difficulty of mimicking chronic rejection in 

experimental models. Introductory chapters provide a theoretical update on current practices in renal, liver, 

islet, and lung transplantation and on the pathways of antigen presentation and chronic rejection. 

State of the art and highly practical, Transplantation Immunology: Methods and Protocols illuminates 

for clinicians and scientists—both newcomers and experts—the new world of detecting and monitoring 

patients‘ immunological responses to solid organ transplantation. 

• Comprehensive review of the current status 

and methods of solid organ transplantation 

• Specialized laboratory methods such as proteomics 

and laser dissection microscopy 

• New methods for HLA typing, detecting HLA 

antibodies, and monitoring T-cell response 

Current Status of Renal Transplantation. Current Status of 

Liver Transplantation. Current Status of Clinical Islet Cell 

Transplantation. Current Status of Lung Transplantation. 

Chronic Rejection in the Heart. Direct and Indirect 

Allorecognition. HLA Typing and Its Influence on Organ 

Transplantation. Strategies for Gene Transfer to Solid 

Organs: Viral Vectors. Nonviral Vectors. Detection and 

Clinical Relevance of Antibodies After Transplantation. 

FEATURES 

CONTENTS 

• Current practices involving organ preservation 

and immunosuppressive drugs 

• Theoretical update on the current status of renal, 

liver, islet, and lung transplantation 

Reprogramming the Immune System Using Antibodies. In 

Vitro Assays for Immune Monitoring in Transplantation. 

Proteomics and Laser Microdissection. Real-Time Quantitative 

Polymerase Chain Reaction in Cardiac Transplant 

Research. Organ Preservation. Pharmacological Manipulation 

of the Rejection Response. Experimental Models of 

Graft Arteriosclerosis. Index.

Transplantation Immunology.pdf - E-Lib FK UWKS

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?